Starting /dee2/code/volunteer_pipeline.sh SRR7172097 current disk space = 3087180029952 free memory = 1482918252 SRR7172097 SRAfilesize 2ffd305de6c8f4ff8d05cedaf26baecf SRR7172097.sra SRR7172097.sra file validated SRR7172097 is paired end SRR7172097 is conventional basespace SRR7172097 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172097_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.847 18.0 18.0 18.0 18.0 32.0 2 22.578 18.0 18.0 27.0 18.0 32.0 3 27.90225 27.0 27.0 32.0 25.0 32.0 4 30.753 32.0 32.0 33.0 27.0 33.0 5 31.85575 33.0 32.0 33.0 31.0 33.0 6 36.76275 38.0 37.0 38.0 35.0 38.0 7 37.23475 38.0 38.0 38.0 36.0 38.0 8 37.28675 38.0 38.0 38.0 36.0 38.0 9 37.3075 38.0 38.0 38.0 37.0 38.0 10-14 37.311299999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.43235 38.0 38.0 38.0 37.0 38.0 20-24 37.444 38.0 38.0 38.0 37.2 38.0 25-29 37.3389 38.0 38.0 38.0 37.0 38.0 30-34 37.384 38.0 38.0 38.0 37.0 38.0 35-39 37.23909999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.21545 38.0 38.0 38.0 36.8 38.0 45-49 36.959500000000006 38.0 38.0 38.0 35.8 38.0 50-54 37.196349999999995 38.0 38.0 38.0 36.4 38.0 55-59 37.332499999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.29065 38.0 38.0 38.0 37.0 38.0 65-69 37.257400000000004 38.0 38.0 38.0 36.8 38.0 70-74 37.1145 38.0 38.0 38.0 36.0 38.0 75-79 36.985850000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.0188 38.0 38.0 38.0 35.8 38.0 85-89 36.819300000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.7741 38.0 38.0 38.0 35.0 38.0 95-99 36.74895 38.0 38.0 38.0 34.8 38.0 100-104 36.72735 38.0 38.0 38.0 35.0 38.0 105-109 36.55159999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.415549999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.142849999999996 38.0 37.2 38.0 33.2 38.0 120-124 36.09295 38.0 37.0 38.0 33.4 38.0 125-129 35.8582 38.0 36.8 38.0 32.2 38.0 130-134 35.53665 38.0 36.2 38.0 31.0 38.0 135-139 35.1913 38.0 36.0 38.0 31.0 38.0 140-144 34.654 38.0 35.0 38.0 28.2 38.0 145-149 33.86705 38.0 34.2 38.0 24.6 38.0 150-151 28.93125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 2.0 20 1.0 21 3.0 22 5.0 23 3.0 24 5.0 25 10.0 26 19.0 27 17.0 28 28.0 29 33.0 30 54.0 31 59.0 32 77.0 33 105.0 34 173.0 35 308.0 36 812.0 37 2279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 10.7 39.45 12.925 36.925000000000004 2 19.55 32.25 28.275 19.925 3 17.675 33.75 24.925 23.65 4 19.85 38.95 21.575 19.625 5 20.150000000000002 38.25 22.2 19.400000000000002 6 15.9 38.4 24.175 21.525 7 11.75 19.825 46.85 21.575 8 18.075 20.974999999999998 27.650000000000002 33.300000000000004 9 18.099999999999998 21.65 29.475 30.775000000000002 10-14 19.580244439991986 31.1310358645562 25.791424564215585 23.497295131236225 15-19 19.59 29.225 27.32 23.865 20-24 19.139999999999997 29.310000000000002 27.76 23.79 25-29 19.285 29.64 27.889999999999997 23.185 30-34 19.695 29.385 27.99 22.93 35-39 19.475 29.095 27.99 23.44 40-44 19.78 29.45 28.12 22.650000000000002 45-49 19.435 30.049999999999997 26.85 23.665 50-54 19.89 29.160000000000004 27.534999999999997 23.415 55-59 19.545 29.215000000000003 27.834999999999997 23.405 60-64 19.57 29.054999999999996 27.485 23.89 65-69 19.905 29.49 27.02 23.585 70-74 19.825 29.79 27.495000000000005 22.89 75-79 19.66 29.005 27.11 24.224999999999998 80-84 19.805 29.185 28.12 22.89 85-89 20.380000000000003 28.735 28.185 22.7 90-94 20.47 28.88 27.529999999999998 23.119999999999997 95-99 19.715 28.54 28.465 23.28 100-104 19.85 29.235 27.47 23.445 105-109 20.073010951642747 28.484272640896137 27.699154873230984 23.743561534230135 110-114 19.912986948042207 29.06435965394809 27.554133119967993 23.46852027804171 115-119 20.580000000000002 28.48 27.57 23.369999999999997 120-124 20.180045011252815 28.162040510127532 27.196799199799948 24.461115278819705 125-129 20.886709367493992 28.938150520416333 26.62630104083267 23.548839071257007 130-134 21.085 28.34 27.224999999999998 23.35 135-139 20.685000000000002 28.125 27.725 23.465 140-144 20.665 27.985 27.1 24.25 145-149 20.885 28.549999999999997 26.939999999999998 23.625 150-151 20.7 28.6375 26.8625 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.5 22 3.0 23 4.5 24 6.0 25 7.0 26 7.5 27 7.5 28 10.0 29 15.0 30 23.0 31 34.0 32 41.5 33 62.5 34 85.0 35 95.5 36 119.0 37 152.0 38 164.5 39 175.5 40 208.0 41 231.5 42 255.0 43 273.5 44 261.5 45 248.0 46 240.0 47 238.5 48 218.0 49 172.5 50 139.0 51 114.0 52 92.0 53 70.0 54 54.0 55 44.5 56 35.0 57 23.5 58 16.5 59 11.0 60 6.0 61 4.5 62 4.0 63 5.5 64 5.5 65 3.0 66 2.0 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.18 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.015 115-119 0.0 120-124 0.025 125-129 0.08 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.2761737383881496 0.5499999999999999 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.2125000000000004 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.7249999999999996 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.362500000000001 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172097 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172097_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91775 33.0 33.0 34.0 32.0 34.0 2 32.92425 34.0 33.0 34.0 32.0 34.0 3 32.98475 34.0 33.0 34.0 32.0 34.0 4 32.94575 34.0 33.0 34.0 32.0 34.0 5 32.989 34.0 33.0 34.0 33.0 34.0 6 37.125 38.0 38.0 38.0 37.0 38.0 7 37.2165 38.0 38.0 38.0 37.0 38.0 8 37.24475 38.0 38.0 38.0 37.0 38.0 9 37.23925 38.0 38.0 38.0 37.0 38.0 10-14 37.181650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.113749999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.0627 38.0 38.0 38.0 37.0 38.0 25-29 36.961299999999994 38.0 38.0 38.0 36.4 38.0 30-34 37.03705 38.0 38.0 38.0 36.8 38.0 35-39 36.95100000000001 38.0 38.0 38.0 36.6 38.0 40-44 36.929649999999995 38.0 38.0 38.0 36.4 38.0 45-49 36.96855000000001 38.0 38.0 38.0 36.6 38.0 50-54 36.98805 38.0 38.0 38.0 36.6 38.0 55-59 36.97439999999999 38.0 38.0 38.0 36.4 38.0 60-64 36.9003 38.0 38.0 38.0 36.0 38.0 65-69 36.86195 38.0 38.0 38.0 36.0 38.0 70-74 36.838849999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.79655 38.0 38.0 38.0 36.0 38.0 80-84 36.6858 38.0 38.0 38.0 35.4 38.0 85-89 36.52995 38.0 38.0 38.0 35.2 38.0 90-94 36.421749999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.19475 38.0 38.0 38.0 33.8 38.0 100-104 36.177499999999995 38.0 38.0 38.0 33.8 38.0 105-109 36.20745000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.0725 38.0 38.0 38.0 33.8 38.0 115-119 35.93175 38.0 37.6 38.0 33.0 38.0 120-124 35.71 38.0 37.0 38.0 31.6 38.0 125-129 35.608850000000004 38.0 37.0 38.0 31.8 38.0 130-134 35.2034 38.0 36.4 38.0 31.0 38.0 135-139 34.911649999999995 38.0 36.0 38.0 29.2 38.0 140-144 34.4396 38.0 35.4 38.0 26.4 38.0 145-149 33.8101 38.0 35.0 38.0 23.6 38.0 150-151 29.028 35.5 18.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 6.0 4 3.0 5 0.0 6 3.0 7 0.0 8 1.0 9 0.0 10 4.0 11 0.0 12 1.0 13 3.0 14 1.0 15 2.0 16 1.0 17 2.0 18 4.0 19 6.0 20 2.0 21 4.0 22 9.0 23 13.0 24 8.0 25 13.0 26 22.0 27 21.0 28 23.0 29 32.0 30 36.0 31 58.0 32 79.0 33 91.0 34 147.0 35 230.0 36 540.0 37 2625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.13913913913914 14.564564564564563 17.167167167167165 29.129129129129126 2 24.58072590738423 21.70212765957447 33.7171464330413 20.0 3 21.076345431789736 26.733416770963704 31.639549436795996 20.550688360450565 4 23.229036295369212 34.34292866082603 22.40300375469337 20.02503128911139 5 23.423423423423422 37.86286286286286 20.945945945945947 17.76776776776777 6 17.599999999999998 36.65 24.25 21.5 7 18.0 16.75 44.9 20.349999999999998 8 20.25 22.3 27.525 29.925 9 20.9 24.9 29.175 25.025 10-14 22.686134306715335 28.32641632081604 27.096354817740888 21.891094554727736 15-19 22.88 27.689999999999998 28.74 20.69 20-24 23.31 28.205000000000002 27.98 20.505000000000003 25-29 23.07 27.750000000000004 28.285 20.895 30-34 23.595 28.075 28.139999999999997 20.19 35-39 23.244999999999997 27.54 28.52 20.695 40-44 23.06 28.249999999999996 28.07 20.62 45-49 23.76 27.794999999999998 28.265 20.18 50-54 22.78 27.99 28.360000000000003 20.87 55-59 23.3 28.349999999999998 27.925 20.424999999999997 60-64 23.65 27.68 28.110000000000003 20.560000000000002 65-69 23.11 28.21 28.435 20.244999999999997 70-74 23.31 28.08 28.194999999999997 20.415 75-79 22.835 28.235 28.139999999999997 20.79 80-84 23.605 27.76 28.375 20.26 85-89 23.29 27.71 28.375 20.625 90-94 23.305 27.49 28.38 20.825 95-99 23.135 28.694999999999997 28.050000000000004 20.119999999999997 100-104 23.655 28.139999999999997 27.98 20.225 105-109 23.580000000000002 27.589999999999996 28.754999999999995 20.075000000000003 110-114 24.115000000000002 27.644999999999996 28.255000000000003 19.985 115-119 24.32 27.97 28.38 19.33 120-124 23.494999999999997 28.294999999999998 28.525 19.685 125-129 23.95 27.555000000000003 28.43 20.064999999999998 130-134 24.525 27.534999999999997 28.27 19.67 135-139 24.7 27.255000000000003 28.77 19.275000000000002 140-144 24.265 28.04 28.34 19.355 145-149 24.54 27.98 27.73 19.75 150-151 24.325 28.375 27.5875 19.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 1.0 24 2.5 25 3.5 26 5.0 27 5.5 28 5.0 29 4.5 30 11.0 31 22.5 32 27.0 33 35.5 34 49.0 35 61.5 36 85.5 37 100.5 38 133.0 39 177.0 40 205.0 41 246.5 42 270.0 43 281.0 44 299.0 45 293.0 46 271.0 47 251.5 48 218.0 49 189.5 50 163.0 51 123.0 52 104.0 53 90.5 54 72.0 55 55.5 56 32.0 57 21.0 58 21.5 59 18.5 60 13.0 61 8.0 62 5.0 63 3.0 64 3.0 65 2.5 66 2.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.125 4 0.125 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47129909365559 98.775 2 0.4028197381671702 0.8 3 0.10070493454179255 0.3 4 0.0 0.0 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.6125 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.775 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.824999999999999 0.0 0.0 0.0 0.0 138-139 5.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATCC 10 0.006830828 145.0 7 >>END_MODULE Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857638 spots for SRR7172097.sra Written 857638 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra Read 857622 spots for SRR7172097.sra Written 857622 spots for SRR7172097.sra SRR ids: ['SRR7172097.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yubtb84_ SRR7172097.sra spots: 17152456 blocks: [[1, 857622], [857623, 1715244], [1715245, 2572866], [2572867, 3430488], [3430489, 4288110], [4288111, 5145732], [5145733, 6003354], [6003355, 6860976], [6860977, 7718598], [7718599, 8576220], [8576221, 9433842], [9433843, 10291464], [10291465, 11149086], [11149087, 12006708], [12006709, 12864330], [12864331, 13721952], [13721953, 14579574], [14579575, 15437196], [15437197, 16294818], [16294819, 17152456]] SRR7172097 file size 5790704 SRR7172097 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172097 SRR7172097_1.fastq SRR7172097_2.fastq Input file: SRR7172097_1.fastq Paired file: SRR7172097_2.fastq trimmed: SRR7172097-trimmed-pair1.fastq, SRR7172097-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:43:01 2025 >> started Fri Feb 14 04:43:19 2025 >> done (17.963s) 17152456 read pairs processed; of these: 16694 ( 0.10%) short read pairs filtered out after trimming by size control 13437 ( 0.08%) empty read pairs filtered out after trimming by size control 17122325 (99.82%) read pairs available; of these: 8323884 (48.61%) trimmed read pairs available after processing 8798441 (51.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 2 0.00% 21 4 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 3 0.00% 26 4 0.00% 27 8 0.00% 28 1 0.00% 29 3 0.00% 30 5 0.00% 31 3 0.00% 32 4 0.00% 33 2 0.00% 34 5 0.00% 35 4 0.00% 36 4 0.00% 37 4 0.00% 38 8 0.00% 39 5 0.00% 40 6 0.00% 41 6 0.00% 42 8 0.00% 43 12 0.00% 44 6 0.00% 45 12 0.00% 46 16 0.00% 47 12 0.00% 48 13 0.00% 49 11 0.00% 50 31 0.00% 51 21 0.00% 52 31 0.00% 53 18 0.00% 54 30 0.00% 55 40 0.00% 56 44 0.00% 57 53 0.00% 58 70 0.00% 59 65 0.00% 60 63 0.00% 61 110 0.00% 62 114 0.00% 63 110 0.00% 64 122 0.00% 65 140 0.00% 66 165 0.00% 67 177 0.00% 68 216 0.00% 69 276 0.00% 70 268 0.00% 71 315 0.00% 72 391 0.00% 73 477 0.00% 74 495 0.00% 75 560 0.00% 76 717 0.00% 77 787 0.00% 78 877 0.01% 79 984 0.01% 80 1089 0.01% 81 1361 0.01% 82 1593 0.01% 83 1778 0.01% 84 2875 0.02% 85 3485 0.02% 86 3671 0.02% 87 4285 0.03% 88 4323 0.03% 89 4310 0.03% 90 4805 0.03% 91 4977 0.03% 92 5353 0.03% 93 5804 0.03% 94 6462 0.04% 95 6808 0.04% 96 7325 0.04% 97 7725 0.05% 98 8252 0.05% 99 9072 0.05% 100 10131 0.06% 101 10356 0.06% 102 10996 0.06% 103 11964 0.07% 104 12202 0.07% 105 13381 0.08% 106 13778 0.08% 107 14951 0.09% 108 15327 0.09% 109 16355 0.10% 110 17158 0.10% 111 17793 0.10% 112 19330 0.11% 113 20201 0.12% 114 21421 0.13% 115 22650 0.13% 116 23723 0.14% 117 24365 0.14% 118 25599 0.15% 119 26324 0.15% 120 27315 0.16% 121 28707 0.17% 122 29675 0.17% 123 31971 0.19% 124 34027 0.20% 125 35002 0.20% 126 36536 0.21% 127 38116 0.22% 128 39734 0.23% 129 41541 0.24% 130 43363 0.25% 131 45010 0.26% 132 48398 0.28% 133 51668 0.30% 134 54448 0.32% 135 58510 0.34% 136 62658 0.37% 137 66042 0.39% 138 72123 0.42% 139 78982 0.46% 140 89525 0.52% 141 94864 0.55% 142 105259 0.61% 143 118596 0.69% 144 139715 0.82% 145 167090 0.98% 146 209328 1.22% 147 284079 1.66% 148 430125 2.51% 149 854657 4.99% 150 4455512 26.02% 151 8798441 51.39% 17122325 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=30 prefix-density=0.57 prefix-fanout=2.6 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=19 fanout-score=23.26 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=9.3 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=24 prefix-density=0.65 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.16 sequence-density-rank=17 fanout-score=19.91 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=8.5 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR7172097 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:44:03 Started mapping on | Feb 14 04:44:04 Finished on | Feb 14 04:46:31 Mapping speed, Million of reads per hour | 419.32 Number of input reads | 17122325 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15815261 Uniquely mapped reads % | 92.37% Average mapped length | 294.95 Number of splices: Total | 15208520 Number of splices: Annotated (sjdb) | 14926253 Number of splices: GT/AG | 14953531 Number of splices: GC/AG | 197055 Number of splices: AT/AC | 12054 Number of splices: Non-canonical | 45880 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.11 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450912 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 42218 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 873245 873245 873245 N_multimapping 450912 450912 450912 N_noFeature 467963 15636608 550146 N_ambiguous 185529 1080 88401 UnstrandedReadsAssigned:15161769 PositiveStrandReadsAssigned:177573 NegativeStrandReadsAssigned:15176714 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172097 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172097-trimmed-pair1.fastq SRR7172097-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,122,325 reads, 14,982,275 reads pseudoaligned [quant] estimated average fragment length: 249.283 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7172097.ke.tsv 34699 SRR7172097.se.tsv 87100 total ==> SRR7172097.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.72 1326 43.0054 Potri.005G024800.1.v4.1 1035 786.717 396 28.8908 Potri.004G059700.1.v4.1 961 712.722 57 4.59027 Potri.007G009000.2.v4.1 1416 1167.72 1 0.0491525 Potri.003G141000.2.v4.1 2943 2694.72 591.176 12.5918 Potri.016G087400.1.v4.1 270 77.7613 936.996 691.604 Potri.015G069301.1.v4.1 564 321.096 0 0 Potri.010G195200.1.v4.1 1773 1524.72 446.727 16.8165 Potri.012G127500.1.v4.1 977 728.717 14685 1156.64 ==> SRR7172097.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 106 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 472 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 424 SRR7172097 completed mapping pipeline successfully