Starting /dee2/code/volunteer_pipeline.sh SRR7172099 current disk space = 3086950084608 free memory = 1017769248 SRR7172099 SRAfilesize 6e66d9d5191f01869aac39b97b04c4a4 SRR7172099.sra SRR7172099.sra file validated SRR7172099 is paired end SRR7172099 is conventional basespace SRR7172099 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172099_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.01675 18.0 18.0 18.0 18.0 30.0 2 22.68725 25.0 18.0 27.0 18.0 29.0 3 24.076 25.0 18.0 30.0 18.0 32.0 4 28.149 32.0 25.0 32.0 15.0 33.0 5 30.6795 32.0 31.0 33.0 27.0 33.0 6 36.096 37.0 36.0 38.0 33.0 38.0 7 37.2485 38.0 37.0 38.0 36.0 38.0 8 37.29425 38.0 38.0 38.0 36.0 38.0 9 37.439 38.0 38.0 38.0 36.0 38.0 10-14 37.470150000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.623 38.0 38.0 38.0 37.8 38.0 20-24 37.639300000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.65375 38.0 38.0 38.0 38.0 38.0 30-34 37.6008 38.0 38.0 38.0 38.0 38.0 35-39 37.57285 38.0 38.0 38.0 38.0 38.0 40-44 37.495799999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.5126 38.0 38.0 38.0 37.6 38.0 50-54 37.40585 38.0 38.0 38.0 37.0 38.0 55-59 37.313050000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.267199999999995 38.0 38.0 38.0 36.6 38.0 65-69 37.206599999999995 38.0 38.0 38.0 36.2 38.0 70-74 37.18025 38.0 38.0 38.0 36.0 38.0 75-79 37.04600000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.013999999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.8695 38.0 38.0 38.0 35.2 38.0 90-94 36.74895 38.0 38.0 38.0 35.0 38.0 95-99 36.73465 38.0 38.0 38.0 34.8 38.0 100-104 36.5773 38.0 38.0 38.0 34.4 38.0 105-109 36.25070000000001 38.0 37.6 38.0 33.6 38.0 110-114 36.1387 38.0 37.0 38.0 33.6 38.0 115-119 35.94755 38.0 37.0 38.0 32.6 38.0 120-124 35.89305 38.0 36.8 38.0 32.6 38.0 125-129 35.622699999999995 38.0 36.2 38.0 31.0 38.0 130-134 35.399100000000004 38.0 35.8 38.0 30.4 38.0 135-139 35.0035 38.0 35.2 38.0 28.2 38.0 140-144 34.554500000000004 38.0 35.0 38.0 27.2 38.0 145-149 33.92615 38.0 34.8 38.0 23.2 38.0 150-151 30.33425 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 3.0 18 5.0 19 5.0 20 1.0 21 4.0 22 5.0 23 4.0 24 6.0 25 9.0 26 10.0 27 8.0 28 12.0 29 28.0 30 23.0 31 55.0 32 59.0 33 93.0 34 191.0 35 355.0 36 1255.0 37 1861.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.310344827586203 8.116710875331565 24.53580901856764 38.03713527851459 2 18.725 24.7 40.475 16.1 3 18.224999999999998 29.049999999999997 28.299999999999997 24.425 4 21.3 35.35 22.375 20.974999999999998 5 20.5 36.675000000000004 24.5 18.325 6 15.7 37.375 26.200000000000003 20.724999999999998 7 11.975 20.0 46.725 21.3 8 17.525 20.65 29.65 32.175 9 17.424999999999997 21.95 30.7 29.925 10-14 19.545 29.965000000000003 26.32 24.169999999999998 15-19 19.34 28.360000000000003 28.194999999999997 24.104999999999997 20-24 19.27 29.520000000000003 28.01 23.200000000000003 25-29 19.615 29.695 27.29 23.400000000000002 30-34 19.41 29.01 28.060000000000002 23.52 35-39 19.885 29.425 27.245 23.445 40-44 19.96 29.42 27.400000000000002 23.22 45-49 19.715 28.505000000000003 27.900000000000002 23.880000000000003 50-54 19.875 29.21 27.52 23.395 55-59 19.595000000000002 28.975 28.235 23.195 60-64 19.46 28.544999999999998 28.470000000000002 23.525 65-69 19.82 28.945 27.755000000000003 23.48 70-74 20.294999999999998 28.9 27.16 23.645 75-79 20.02 28.79 27.485 23.705000000000002 80-84 20.055 29.03 27.334999999999997 23.580000000000002 85-89 20.419999999999998 28.485 27.339999999999996 23.755000000000003 90-94 19.945 28.575 27.71 23.77 95-99 19.735 28.455000000000002 28.205000000000002 23.605 100-104 19.759999999999998 28.660000000000004 27.405 24.175 105-109 19.93 28.970000000000002 27.74 23.36 110-114 20.45 28.59 27.750000000000004 23.21 115-119 20.785 27.73 27.615000000000002 23.87 120-124 20.485 28.325 27.445000000000004 23.745 125-129 20.74 28.505000000000003 27.655 23.1 130-134 20.505000000000003 28.48 27.045 23.97 135-139 20.445 28.360000000000003 27.005000000000003 24.19 140-144 20.645 28.794999999999998 27.26 23.3 145-149 20.385 28.785 27.175 23.655 150-151 20.0625 28.799999999999997 26.974999999999998 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.5 20 2.5 21 1.0 22 1.0 23 3.0 24 4.5 25 5.5 26 7.0 27 12.5 28 14.0 29 14.5 30 19.5 31 35.0 32 41.5 33 49.5 34 66.0 35 87.0 36 120.5 37 136.0 38 147.5 39 165.0 40 193.5 41 221.5 42 234.0 43 255.5 44 263.5 45 260.0 46 251.5 47 240.0 48 230.0 49 210.0 50 174.0 51 129.5 52 105.0 53 78.5 54 53.0 55 42.0 56 30.5 57 22.0 58 20.5 59 15.0 60 10.0 61 8.0 62 4.5 63 3.5 64 2.5 65 0.5 66 0.0 67 1.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.5875000000000004 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAG 10 0.006836113 144.9625 5 ATCCAGT 10 0.006836113 144.9625 6 CTGTGTG 10 0.006836113 144.9625 2 TGTGTGA 10 0.006836113 144.9625 3 >>END_MODULE SRR7172099 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172099_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3 34.0 33.0 34.0 33.0 34.0 2 33.4145 34.0 33.0 34.0 33.0 34.0 3 33.42025 34.0 33.0 34.0 33.0 34.0 4 33.37375 34.0 33.0 34.0 33.0 34.0 5 33.411 34.0 33.0 34.0 33.0 34.0 6 37.58375 38.0 38.0 38.0 38.0 38.0 7 37.62075 38.0 38.0 38.0 38.0 38.0 8 37.6175 38.0 38.0 38.0 38.0 38.0 9 37.589 38.0 38.0 38.0 38.0 38.0 10-14 37.628 38.0 38.0 38.0 38.0 38.0 15-19 37.6302 38.0 38.0 38.0 38.0 38.0 20-24 37.598850000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.585699999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5482 38.0 38.0 38.0 38.0 38.0 35-39 37.5117 38.0 38.0 38.0 38.0 38.0 40-44 37.4808 38.0 38.0 38.0 38.0 38.0 45-49 37.4539 38.0 38.0 38.0 37.6 38.0 50-54 37.46835 38.0 38.0 38.0 37.8 38.0 55-59 37.38625 38.0 38.0 38.0 37.0 38.0 60-64 37.346349999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.29665 38.0 38.0 38.0 37.0 38.0 70-74 37.20965 38.0 38.0 38.0 37.0 38.0 75-79 37.09160000000001 38.0 38.0 38.0 36.2 38.0 80-84 37.03445000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.9933 38.0 38.0 38.0 36.0 38.0 90-94 36.9422 38.0 38.0 38.0 36.0 38.0 95-99 36.78295000000001 38.0 38.0 38.0 35.2 38.0 100-104 36.77475 38.0 38.0 38.0 35.4 38.0 105-109 36.630399999999995 38.0 38.0 38.0 34.8 38.0 110-114 36.48855 38.0 38.0 38.0 34.0 38.0 115-119 36.24235 38.0 37.8 38.0 33.8 38.0 120-124 36.0772 38.0 37.4 38.0 33.6 38.0 125-129 35.76755 38.0 36.6 38.0 32.2 38.0 130-134 35.43135 38.0 36.0 38.0 31.0 38.0 135-139 35.24135 38.0 36.0 38.0 30.4 38.0 140-144 34.9159 38.0 35.4 38.0 28.4 38.0 145-149 34.23389999999999 38.0 34.4 38.0 26.6 38.0 150-151 30.72 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 0.0 19 4.0 20 3.0 21 3.0 22 2.0 23 4.0 24 5.0 25 16.0 26 9.0 27 11.0 28 15.0 29 23.0 30 19.0 31 37.0 32 47.0 33 79.0 34 106.0 35 234.0 36 653.0 37 2715.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.375 14.499999999999998 18.25 33.875 2 23.075000000000003 22.325 38.275 16.325 3 20.875 25.900000000000002 31.175000000000004 22.05 4 24.5 33.5 22.325 19.675 5 24.675 36.65 22.425 16.25 6 17.625 37.65 24.9 19.825 7 17.424999999999997 14.674999999999999 45.175 22.725 8 20.7 21.85 27.175 30.275000000000002 9 22.6 24.725 28.050000000000004 24.625 10-14 22.775000000000002 28.79 26.615 21.82 15-19 22.895 27.85 28.235 21.02 20-24 22.905 28.810000000000002 27.639999999999997 20.645 25-29 22.15 28.165000000000003 28.689999999999998 20.995 30-34 23.195 28.09 27.589999999999996 21.125 35-39 22.765 27.91 28.389999999999997 20.935000000000002 40-44 23.36 28.084999999999997 28.13 20.424999999999997 45-49 23.745 27.77 27.815 20.669999999999998 50-54 23.09 28.165000000000003 28.365000000000002 20.380000000000003 55-59 23.599999999999998 27.88 27.965 20.555 60-64 23.169999999999998 27.755000000000003 28.194999999999997 20.880000000000003 65-69 22.955000000000002 28.415000000000003 28.21 20.419999999999998 70-74 23.1 27.839999999999996 28.299999999999997 20.76 75-79 23.125 28.055000000000003 28.715000000000003 20.105 80-84 23.255 27.765 28.26 20.72 85-89 22.945 27.994999999999997 28.165000000000003 20.895 90-94 23.830000000000002 28.599999999999998 27.33 20.24 95-99 23.335 27.825 28.499999999999996 20.34 100-104 23.86 27.33 28.305000000000003 20.505000000000003 105-109 23.29 27.82 28.105000000000004 20.785 110-114 23.849999999999998 27.975 28.005000000000003 20.169999999999998 115-119 23.905 27.76 28.305000000000003 20.03 120-124 23.599999999999998 28.03 28.4 19.97 125-129 24.035 28.560000000000002 27.525 19.88 130-134 23.625 27.845 28.125 20.405 135-139 24.145 28.189999999999998 27.85 19.814999999999998 140-144 24.395 27.839999999999996 27.779999999999998 19.985 145-149 23.75 28.444999999999997 27.450000000000003 20.355 150-151 24.462500000000002 27.275 27.6875 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 2.5 23 2.0 24 1.0 25 2.0 26 3.0 27 5.0 28 7.5 29 7.5 30 8.5 31 16.5 32 23.5 33 34.5 34 49.0 35 67.0 36 100.5 37 115.5 38 131.5 39 180.0 40 208.5 41 230.0 42 267.5 43 281.5 44 271.5 45 263.5 46 268.5 47 251.0 48 223.5 49 208.5 50 174.0 51 142.5 52 119.5 53 90.5 54 68.0 55 46.5 56 34.5 57 26.5 58 16.5 59 12.0 60 7.5 61 6.5 62 6.0 63 2.5 64 2.0 65 3.0 66 1.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.025 0.0 0.0 6 0.0 0.0 0.025 0.0 0.0 7 0.0 0.0 0.025 0.0 0.0 8 0.0 0.0 0.025 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.037500000000000006 0.0 0.025 0.0 0.0 72-73 0.075 0.0 0.025 0.0 0.0 74-75 0.075 0.0 0.025 0.0 0.0 76-77 0.075 0.0 0.025 0.0 0.0 78-79 0.075 0.0 0.025 0.0 0.0 80-81 0.0875 0.0 0.025 0.0 0.0 82-83 0.1 0.0 0.025 0.0 0.0 84-85 0.1 0.0 0.025 0.0 0.0 86-87 0.1125 0.0 0.025 0.0 0.0 88-89 0.16249999999999998 0.0 0.025 0.0 0.0 90-91 0.175 0.0 0.025 0.0 0.0 92-93 0.2 0.0 0.025 0.0 0.0 94-95 0.225 0.0 0.025 0.0 0.0 96-97 0.275 0.0 0.025 0.0 0.0 98-99 0.32499999999999996 0.0 0.025 0.0 0.0 100-101 0.375 0.0 0.025 0.0 0.0 102-103 0.44999999999999996 0.0 0.025 0.0 0.0 104-105 0.5 0.0 0.025 0.0 0.0 106-107 0.5625 0.0 0.025 0.0 0.0 108-109 0.7 0.0 0.025 0.0 0.0 110-111 0.8125 0.0 0.025 0.0 0.0 112-113 1.0 0.0 0.025 0.0 0.0 114-115 1.1375000000000002 0.0 0.025 0.0 0.0 116-117 1.275 0.0 0.025 0.0 0.0 118-119 1.5125 0.0 0.025 0.0 0.0 120-121 1.6875 0.0 0.025 0.0 0.0 122-123 1.9125 0.0 0.025 0.0 0.0 124-125 2.0375 0.0 0.025 0.0 0.0 126-127 2.2875 0.0 0.025 0.0 0.0 128-129 2.6500000000000004 0.0 0.025 0.0 0.0 130-131 2.9125 0.0 0.025 0.0 0.0 132-133 3.2 0.0 0.025 0.0 0.0 134-135 3.6624999999999996 0.0 0.025 0.0 0.0 136-137 4.025 0.0 0.025 0.0 0.0 138-139 4.425000000000001 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCTCT 10 0.006830828 145.0 3 TGACACT 10 0.006830828 145.0 1 AAAAAAA 40 0.0076550315 18.125 20-24 >>END_MODULE Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468944 spots for SRR7172099.sra Written 468944 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra Read 468928 spots for SRR7172099.sra Written 468928 spots for SRR7172099.sra SRR ids: ['SRR7172099.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ws_qmevp SRR7172099.sra spots: 9378576 blocks: [[1, 468928], [468929, 937856], [937857, 1406784], [1406785, 1875712], [1875713, 2344640], [2344641, 2813568], [2813569, 3282496], [3282497, 3751424], [3751425, 4220352], [4220353, 4689280], [4689281, 5158208], [5158209, 5627136], [5627137, 6096064], [6096065, 6564992], [6564993, 7033920], [7033921, 7502848], [7502849, 7971776], [7971777, 8440704], [8440705, 8909632], [8909633, 9378576]] SRR7172099 file size 3157605 SRR7172099 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172099 SRR7172099_1.fastq SRR7172099_2.fastq Input file: SRR7172099_1.fastq Paired file: SRR7172099_2.fastq trimmed: SRR7172099-trimmed-pair1.fastq, SRR7172099-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:51:07 2025 >> started Fri Feb 14 04:51:19 2025 >> done (12.150s) 9378576 read pairs processed; of these: 3423 ( 0.04%) short read pairs filtered out after trimming by size control 5616 ( 0.06%) empty read pairs filtered out after trimming by size control 9369537 (99.90%) read pairs available; of these: 4768149 (50.89%) trimmed read pairs available after processing 4601388 (49.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 4 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 1 0.00% 26 5 0.00% 27 5 0.00% 28 6 0.00% 29 6 0.00% 30 1 0.00% 31 4 0.00% 32 3 0.00% 33 6 0.00% 34 8 0.00% 35 9 0.00% 36 2 0.00% 37 6 0.00% 38 3 0.00% 39 3 0.00% 40 6 0.00% 41 3 0.00% 42 5 0.00% 43 5 0.00% 44 6 0.00% 45 11 0.00% 46 11 0.00% 47 13 0.00% 48 15 0.00% 49 14 0.00% 50 26 0.00% 51 20 0.00% 52 30 0.00% 53 38 0.00% 54 26 0.00% 55 27 0.00% 56 36 0.00% 57 41 0.00% 58 42 0.00% 59 57 0.00% 60 61 0.00% 61 67 0.00% 62 81 0.00% 63 98 0.00% 64 81 0.00% 65 112 0.00% 66 129 0.00% 67 166 0.00% 68 175 0.00% 69 178 0.00% 70 190 0.00% 71 217 0.00% 72 265 0.00% 73 320 0.00% 74 377 0.00% 75 433 0.00% 76 524 0.01% 77 618 0.01% 78 607 0.01% 79 680 0.01% 80 761 0.01% 81 859 0.01% 82 960 0.01% 83 1127 0.01% 84 1413 0.02% 85 1621 0.02% 86 1929 0.02% 87 2066 0.02% 88 2246 0.02% 89 2364 0.03% 90 2653 0.03% 91 2835 0.03% 92 2994 0.03% 93 3205 0.03% 94 3701 0.04% 95 3867 0.04% 96 4170 0.04% 97 4349 0.05% 98 4500 0.05% 99 4834 0.05% 100 5243 0.06% 101 5686 0.06% 102 5802 0.06% 103 6429 0.07% 104 6627 0.07% 105 7337 0.08% 106 7621 0.08% 107 7978 0.09% 108 8530 0.09% 109 8898 0.09% 110 9448 0.10% 111 9956 0.11% 112 10185 0.11% 113 10925 0.12% 114 11644 0.12% 115 12053 0.13% 116 12528 0.13% 117 13094 0.14% 118 13560 0.14% 119 14224 0.15% 120 14947 0.16% 121 15567 0.17% 122 16160 0.17% 123 16959 0.18% 124 18120 0.19% 125 18961 0.20% 126 19864 0.21% 127 21037 0.22% 128 22234 0.24% 129 23562 0.25% 130 24622 0.26% 131 25902 0.28% 132 27431 0.29% 133 29409 0.31% 134 31044 0.33% 135 32895 0.35% 136 35323 0.38% 137 37961 0.41% 138 40857 0.44% 139 44008 0.47% 140 48858 0.52% 141 53331 0.57% 142 60221 0.64% 143 68961 0.74% 144 81948 0.87% 145 101941 1.09% 146 132297 1.41% 147 187454 2.00% 148 303394 3.24% 149 617831 6.59% 150 2348936 25.07% 151 4601388 49.11% 9369537 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=3.5 sequence=CCACATTTGCAGCCATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=15.08 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=2.2 sequence=TTCTCAGCACCGAAGTCCATCTCAGACC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=4.82 fanout-score-rank=19 prefix-density=0.68 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=137.56 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.1 sequence=GATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGGGGAAGCCGGGCACTGTAATCTGCTGGAGTTATGTACATGATGGGGTTGCTAAGACTGCTAAGGAGGTTAT SRR7172099 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:52:16 Started mapping on | Feb 14 04:52:16 Finished on | Feb 14 04:53:46 Mapping speed, Million of reads per hour | 374.78 Number of input reads | 9369537 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8741430 Uniquely mapped reads % | 93.30% Average mapped length | 294.86 Number of splices: Total | 8539288 Number of splices: Annotated (sjdb) | 8384897 Number of splices: GT/AG | 8395950 Number of splices: GC/AG | 107921 Number of splices: AT/AC | 6782 Number of splices: Non-canonical | 28635 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245504 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 20675 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 387351 387351 387351 N_multimapping 245504 245504 245504 N_noFeature 229703 8651149 272393 N_ambiguous 94470 689 46404 UnstrandedReadsAssigned:8417257 PositiveStrandReadsAssigned:89592 NegativeStrandReadsAssigned:8422633 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172099 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172099-trimmed-pair1.fastq SRR7172099-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,369,537 reads, 8,346,985 reads pseudoaligned [quant] estimated average fragment length: 257.251 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7172099.ke.tsv 34699 SRR7172099.se.tsv 87100 total ==> SRR7172099.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.75 520 34.4369 Potri.005G024800.1.v4.1 1035 778.749 102 15.2815 Potri.004G059700.1.v4.1 961 704.815 14 2.31749 Potri.007G009000.2.v4.1 1416 1159.75 0 0 Potri.003G141000.2.v4.1 2943 2686.75 306 13.288 Potri.016G087400.1.v4.1 270 76.4276 566.653 865.029 Potri.015G069301.1.v4.1 564 315.396 0 0 Potri.010G195200.1.v4.1 1773 1516.75 118 9.0768 Potri.012G127500.1.v4.1 977 720.785 3796 614.448 ==> SRR7172099.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 120 SRR7172099 completed mapping pipeline successfully