Starting /dee2/code/volunteer_pipeline.sh SRR7172100 current disk space = 3111834451968 free memory = 1301036172 SRR7172100 SRAfilesize 12d563ef62a99ec7bafd5d98a29b8a8b SRR7172100.sra SRR7172100.sra file validated SRR7172100 is paired end SRR7172100 is conventional basespace SRR7172100 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172100_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.3035 31.0 18.0 33.0 18.0 33.0 2 25.479 27.0 18.0 31.0 18.0 33.0 3 29.429 30.0 27.0 33.0 25.0 33.0 4 31.54725 33.0 31.0 33.0 29.0 33.0 5 32.30225 33.0 32.0 33.0 32.0 33.0 6 36.98775 38.0 37.0 38.0 36.0 38.0 7 37.50125 38.0 38.0 38.0 37.0 38.0 8 37.558 38.0 38.0 38.0 37.0 38.0 9 37.5975 38.0 38.0 38.0 38.0 38.0 10-14 37.4689 38.0 38.0 38.0 38.0 38.0 15-19 37.578050000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.579499999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.43755 38.0 38.0 38.0 38.0 38.0 30-34 37.493550000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.40259999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.242399999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.359899999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.378699999999995 38.0 38.0 38.0 37.2 38.0 55-59 37.418549999999996 38.0 38.0 38.0 37.4 38.0 60-64 37.37925 38.0 38.0 38.0 37.0 38.0 65-69 37.3635 38.0 38.0 38.0 37.0 38.0 70-74 37.32935 38.0 38.0 38.0 37.0 38.0 75-79 37.209399999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.185849999999995 38.0 38.0 38.0 36.6 38.0 85-89 37.017849999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.9843 38.0 38.0 38.0 36.0 38.0 95-99 36.869800000000005 38.0 38.0 38.0 35.6 38.0 100-104 36.7906 38.0 38.0 38.0 35.0 38.0 105-109 36.708749999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.2813 38.0 38.0 38.0 34.2 38.0 115-119 35.93135 38.0 37.2 38.0 32.2 38.0 120-124 36.3112 38.0 38.0 38.0 34.0 38.0 125-129 35.8484 38.0 37.4 38.0 32.4 38.0 130-134 35.85680000000001 38.0 37.0 38.0 32.6 38.0 135-139 35.6309 38.0 37.0 38.0 31.2 38.0 140-144 35.1554 38.0 36.0 38.0 30.6 38.0 145-149 34.68185 38.0 35.8 38.0 29.2 38.0 150-151 30.614250000000002 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 3.0 15 1.0 16 1.0 17 2.0 18 2.0 19 1.0 20 4.0 21 3.0 22 2.0 23 6.0 24 7.0 25 9.0 26 11.0 27 8.0 28 22.0 29 19.0 30 32.0 31 38.0 32 60.0 33 90.0 34 143.0 35 236.0 36 661.0 37 2632.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.35 19.725 13.350000000000001 33.575 2 19.025 27.725 34.65 18.6 3 17.45 31.125000000000004 26.450000000000003 24.975 4 20.25 38.375 21.775 19.6 5 20.275000000000002 37.45 22.875 19.400000000000002 6 16.775000000000002 36.05 25.924999999999997 21.25 7 11.95 21.825 46.6 19.625 8 18.6 22.25 28.199999999999996 30.95 9 18.15 22.075 31.075000000000003 28.7 10-14 19.27372902579514 30.648635111445028 26.51640370648635 23.56123215627348 15-19 19.155 28.87 27.450000000000003 24.525 20-24 19.12 29.225 27.49 24.165 25-29 19.125 29.525000000000002 27.62 23.73 30-34 19.09 29.265 28.12 23.525 35-39 19.890994549727488 28.70143507175359 28.07640382019101 23.33116655832792 40-44 19.28 29.485 27.865000000000002 23.369999999999997 45-49 19.040000000000003 28.660000000000004 28.285 24.015 50-54 19.189999999999998 29.304999999999996 27.85 23.655 55-59 19.405 28.555000000000003 28.34 23.7 60-64 19.09 28.910000000000004 27.725 24.275 65-69 19.32 28.749999999999996 28.050000000000004 23.880000000000003 70-74 19.42 28.68 27.48 24.42 75-79 20.05 28.79 27.605 23.555 80-84 19.31 28.645 28.549999999999997 23.494999999999997 85-89 19.684921230307577 28.79219804951238 27.82195548887222 23.700925231307828 90-94 19.45597279863993 28.846442322116104 27.901395069753487 23.796189809490475 95-99 19.56 29.195 27.61 23.635 100-104 19.997999699954995 28.144221633244985 28.079211881782268 23.778566785017752 105-109 19.745987299364966 29.316465823291164 27.481374068703435 23.45617280864043 110-114 19.87424547283702 29.230382293762574 27.736418511066397 23.158953722334005 115-119 20.128275792954852 29.47837851380468 27.44901538307361 22.94433031016686 120-124 20.473189275710286 28.186274509803923 27.275910364145656 24.064625850340136 125-129 20.121218192746944 28.967140853536367 27.569625325586056 23.342015628130635 130-134 20.605 28.860000000000003 27.310000000000002 23.225 135-139 20.47 28.15 27.51 23.87 140-144 20.447044704470446 28.412841284128415 27.17271727172717 23.96739673967397 145-149 20.59117735320596 28.123437031109333 27.62328698609583 23.662098629588876 150-151 20.3 27.650000000000002 28.037499999999998 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.5 22 2.5 23 1.5 24 1.0 25 2.0 26 6.5 27 11.5 28 10.5 29 14.0 30 20.5 31 28.0 32 43.0 33 51.5 34 63.5 35 82.5 36 105.5 37 136.5 38 165.5 39 188.0 40 213.0 41 243.5 42 263.0 43 287.0 44 297.0 45 276.0 46 251.5 47 219.5 48 189.5 49 157.0 50 130.5 51 119.5 52 93.0 53 70.5 54 60.0 55 43.5 56 33.5 57 30.0 58 22.0 59 14.0 60 10.5 61 6.5 62 5.0 63 6.5 64 4.0 65 3.0 66 3.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.17500000000000002 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.005 95-99 0.0 100-104 0.015 105-109 0.005 110-114 0.6 115-119 0.215 120-124 0.04 125-129 0.18 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.11249999999999999 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.475 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.25 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTG 10 0.006843168 144.91249 2 >>END_MODULE SRR7172100 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172100_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.069 33.0 33.0 34.0 32.0 34.0 2 33.12275 34.0 33.0 34.0 33.0 34.0 3 33.1025 34.0 33.0 34.0 33.0 34.0 4 33.07 34.0 33.0 34.0 33.0 34.0 5 33.035 34.0 33.0 34.0 33.0 34.0 6 37.19825 38.0 38.0 38.0 37.0 38.0 7 37.2775 38.0 38.0 38.0 37.0 38.0 8 37.248 38.0 38.0 38.0 38.0 38.0 9 37.21675 38.0 38.0 38.0 38.0 38.0 10-14 37.26565000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.174 38.0 38.0 38.0 37.2 38.0 20-24 37.117399999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.1803 38.0 38.0 38.0 37.0 38.0 30-34 37.17635 38.0 38.0 38.0 37.0 38.0 35-39 37.12485 38.0 38.0 38.0 37.0 38.0 40-44 37.04545 38.0 38.0 38.0 36.8 38.0 45-49 37.1077 38.0 38.0 38.0 37.0 38.0 50-54 37.12495 38.0 38.0 38.0 37.0 38.0 55-59 37.054950000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.015550000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.96875 38.0 38.0 38.0 36.4 38.0 70-74 37.005250000000004 38.0 38.0 38.0 37.0 38.0 75-79 36.90945000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.81840000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.62335 38.0 38.0 38.0 35.2 38.0 90-94 36.438849999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.41180000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.3668 38.0 38.0 38.0 34.2 38.0 105-109 36.33775 38.0 38.0 38.0 34.0 38.0 110-114 36.1713 38.0 38.0 38.0 34.0 38.0 115-119 36.0877 38.0 38.0 38.0 33.8 38.0 120-124 35.8983 38.0 38.0 38.0 32.8 38.0 125-129 35.5689 38.0 37.2 38.0 31.2 38.0 130-134 35.15895 38.0 36.4 38.0 29.8 38.0 135-139 34.7572 38.0 36.0 38.0 28.2 38.0 140-144 34.31490000000001 38.0 35.6 38.0 26.6 38.0 145-149 33.494899999999994 38.0 34.2 38.0 19.8 38.0 150-151 27.908875000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 1.0 6 2.0 7 7.0 8 1.0 9 1.0 10 3.0 11 1.0 12 2.0 13 3.0 14 0.0 15 0.0 16 1.0 17 4.0 18 2.0 19 9.0 20 4.0 21 9.0 22 7.0 23 11.0 24 16.0 25 8.0 26 18.0 27 16.0 28 23.0 29 32.0 30 29.0 31 49.0 32 60.0 33 85.0 34 135.0 35 219.0 36 520.0 37 2710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.5 15.4 17.75 27.35 2 24.65 22.675 33.875 18.8 3 20.599999999999998 26.8 31.3 21.3 4 24.981245311327832 33.33333333333333 21.05526381595399 20.630157539384847 5 22.40300375469337 36.77096370463079 22.377972465581976 18.448060075093867 6 17.8992228628729 37.87916771120582 23.43945851090499 20.782150915016295 7 17.071947856605664 16.971672098270243 43.29405866131862 22.662321383805466 8 20.275689223057643 21.07769423558897 27.89473684210526 30.751879699248118 9 21.93532213587365 23.013286537979443 28.72900476309852 26.322386563048383 10-14 22.37362857572266 29.056660487951508 26.54676619407845 22.022944742247383 15-19 22.70040080160321 28.14128256513026 28.547094188376754 20.61122244488978 20-24 22.881610576923077 28.074919871794872 27.979767628205128 21.063701923076923 25-29 22.999599919983996 28.760752150430086 27.495499099819966 20.744148829765955 30-34 23.135 28.13 27.38 21.355 35-39 22.755 28.465 28.000000000000004 20.78 40-44 22.715 28.235 28.57 20.48 45-49 23.4746949389878 27.595519103820763 28.430686137227447 20.49909981996399 50-54 23.03 28.310000000000002 28.060000000000002 20.599999999999998 55-59 23.525 28.225 27.83 20.419999999999998 60-64 23.21 28.215 28.165000000000003 20.41 65-69 23.435 28.349999999999998 27.994999999999997 20.22 70-74 23.635 28.515 28.03 19.82 75-79 23.21 27.935 28.7 20.155 80-84 24.135 28.044999999999998 27.68 20.14 85-89 23.585 27.279999999999998 28.084999999999997 21.05 90-94 23.395 27.88 28.945 19.78 95-99 23.599999999999998 27.73 28.005000000000003 20.665 100-104 23.69 28.065 28.044999999999998 20.200000000000003 105-109 23.810000000000002 27.79 28.16 20.24 110-114 23.43 28.335 28.000000000000004 20.235 115-119 23.880000000000003 27.779999999999998 28.64 19.7 120-124 24.125 27.450000000000003 28.125 20.3 125-129 23.885 28.244999999999997 27.975 19.895 130-134 24.84 27.435 27.73 19.994999999999997 135-139 23.785 28.28 28.01 19.925 140-144 24.04 27.505000000000003 28.775000000000002 19.68 145-149 25.31 27.700000000000003 27.775 19.215 150-151 24.95 27.224999999999998 28.275 19.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 0.0 24 1.5 25 3.0 26 2.5 27 2.0 28 4.5 29 8.0 30 11.0 31 15.0 32 21.5 33 44.0 34 56.0 35 57.5 36 76.0 37 104.5 38 134.5 39 171.5 40 207.0 41 250.5 42 274.0 43 286.5 44 305.5 45 298.5 46 275.0 47 247.0 48 223.0 49 193.0 50 154.5 51 131.0 52 108.0 53 82.0 54 63.5 55 46.0 56 33.0 57 22.5 58 19.0 59 11.0 60 8.0 61 8.5 62 7.0 63 7.0 64 5.5 65 3.5 66 3.5 67 3.0 68 2.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.125 6 0.27499999999999997 7 0.27499999999999997 8 0.25 9 0.27499999999999997 10-14 0.19499999999999998 15-19 0.2 20-24 0.16 25-29 0.02 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.11249999999999999 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8500000000000001 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.475 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGGCA 10 0.006830828 145.0 8 >>END_MODULE Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826956 spots for SRR7172100.sra Written 826956 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra Read 826953 spots for SRR7172100.sra Written 826953 spots for SRR7172100.sra SRR ids: ['SRR7172100.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_td6glcil SRR7172100.sra spots: 16539063 blocks: [[1, 826953], [826954, 1653906], [1653907, 2480859], [2480860, 3307812], [3307813, 4134765], [4134766, 4961718], [4961719, 5788671], [5788672, 6615624], [6615625, 7442577], [7442578, 8269530], [8269531, 9096483], [9096484, 9923436], [9923437, 10750389], [10750390, 11577342], [11577343, 12404295], [12404296, 13231248], [13231249, 14058201], [14058202, 14885154], [14885155, 15712107], [15712108, 16539063]] SRR7172100 file size 5582845 SRR7172100 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172100 SRR7172100_1.fastq SRR7172100_2.fastq Input file: SRR7172100_1.fastq Paired file: SRR7172100_2.fastq trimmed: SRR7172100-trimmed-pair1.fastq, SRR7172100-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:40:55 2025 >> started Fri Feb 14 16:41:16 2025 >> done (21.580s) 16539063 read pairs processed; of these: 18815 ( 0.11%) short read pairs filtered out after trimming by size control 19176 ( 0.12%) empty read pairs filtered out after trimming by size control 16501072 (99.77%) read pairs available; of these: 8449361 (51.20%) trimmed read pairs available after processing 8051711 (48.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 7 0.00% 23 7 0.00% 24 12 0.00% 25 8 0.00% 26 9 0.00% 27 5 0.00% 28 9 0.00% 29 9 0.00% 30 7 0.00% 31 7 0.00% 32 6 0.00% 33 5 0.00% 34 7 0.00% 35 5 0.00% 36 3 0.00% 37 5 0.00% 38 4 0.00% 39 7 0.00% 40 7 0.00% 41 13 0.00% 42 7 0.00% 43 3 0.00% 44 19 0.00% 45 8 0.00% 46 14 0.00% 47 16 0.00% 48 12 0.00% 49 18 0.00% 50 19 0.00% 51 24 0.00% 52 30 0.00% 53 32 0.00% 54 34 0.00% 55 43 0.00% 56 40 0.00% 57 48 0.00% 58 52 0.00% 59 85 0.00% 60 84 0.00% 61 87 0.00% 62 108 0.00% 63 110 0.00% 64 138 0.00% 65 146 0.00% 66 159 0.00% 67 179 0.00% 68 221 0.00% 69 233 0.00% 70 295 0.00% 71 364 0.00% 72 395 0.00% 73 450 0.00% 74 521 0.00% 75 559 0.00% 76 662 0.00% 77 781 0.00% 78 895 0.01% 79 1057 0.01% 80 1223 0.01% 81 1374 0.01% 82 1572 0.01% 83 1842 0.01% 84 3059 0.02% 85 3695 0.02% 86 4241 0.03% 87 4678 0.03% 88 4712 0.03% 89 4798 0.03% 90 5020 0.03% 91 5348 0.03% 92 5631 0.03% 93 6052 0.04% 94 6361 0.04% 95 6880 0.04% 96 7556 0.05% 97 7877 0.05% 98 8044 0.05% 99 8850 0.05% 100 9541 0.06% 101 10164 0.06% 102 10844 0.07% 103 11692 0.07% 104 12440 0.08% 105 13108 0.08% 106 14024 0.08% 107 14412 0.09% 108 15345 0.09% 109 15731 0.10% 110 16377 0.10% 111 17485 0.11% 112 18445 0.11% 113 19718 0.12% 114 20707 0.13% 115 21584 0.13% 116 22182 0.13% 117 23387 0.14% 118 24626 0.15% 119 25555 0.15% 120 26713 0.16% 121 28129 0.17% 122 29637 0.18% 123 31352 0.19% 124 33058 0.20% 125 34061 0.21% 126 36261 0.22% 127 37849 0.23% 128 39180 0.24% 129 41732 0.25% 130 43406 0.26% 131 46734 0.28% 132 49362 0.30% 133 53453 0.32% 134 56757 0.34% 135 61831 0.37% 136 67500 0.41% 137 70117 0.42% 138 74636 0.45% 139 81812 0.50% 140 87487 0.53% 141 94290 0.57% 142 105038 0.64% 143 117649 0.71% 144 137007 0.83% 145 161967 0.98% 146 200577 1.22% 147 274830 1.67% 148 419720 2.54% 149 840171 5.09% 150 4622762 28.01% 151 8051711 48.80% 16501072 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=22 prefix-density=0.55 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=42.04 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=11.7 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGTGTCTGAGCTCTCGACCTCCAGAGTGATGGTCTT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=2.3 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=19 fanout-score=21.49 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172100 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:42:07 Started mapping on | Feb 14 16:42:08 Finished on | Feb 14 16:44:44 Mapping speed, Million of reads per hour | 380.79 Number of input reads | 16501072 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15136358 Uniquely mapped reads % | 91.73% Average mapped length | 294.85 Number of splices: Total | 15345164 Number of splices: Annotated (sjdb) | 15039747 Number of splices: GT/AG | 15087152 Number of splices: GC/AG | 196278 Number of splices: AT/AC | 12186 Number of splices: Non-canonical | 49548 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.16 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485429 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 61720 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.82% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 899328 899328 899328 N_multimapping 485429 485429 485429 N_noFeature 434342 14965911 516117 N_ambiguous 169091 1064 79790 UnstrandedReadsAssigned:14532925 PositiveStrandReadsAssigned:169383 NegativeStrandReadsAssigned:14540451 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172100 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172100-trimmed-pair1.fastq SRR7172100-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,501,072 reads, 14,462,197 reads pseudoaligned [quant] estimated average fragment length: 251.715 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR7172100.ke.tsv 34699 SRR7172100.se.tsv 87100 total ==> SRR7172100.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.29 1119 39.6577 Potri.005G024800.1.v4.1 1035 784.285 461 36.8155 Potri.004G059700.1.v4.1 961 710.322 95 8.37669 Potri.007G009000.2.v4.1 1416 1165.29 0 0 Potri.003G141000.2.v4.1 2943 2692.29 470.163 10.9378 Potri.016G087400.1.v4.1 270 77.268 916 742.506 Potri.015G069301.1.v4.1 564 319.429 0 0 Potri.010G195200.1.v4.1 1773 1522.29 270.847 11.1438 Potri.012G127500.1.v4.1 977 726.296 11388 982.06 ==> SRR7172100.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 541 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 423 SRR7172100 completed mapping pipeline successfully