Starting /dee2/code/volunteer_pipeline.sh SRR7172101 current disk space = 3086901518336 free memory = 1446414868 SRR7172101 SRAfilesize 31078bf9a7a0ec919803d1255d24d29a SRR7172101.sra SRR7172101.sra file validated SRR7172101 is paired end SRR7172101 is conventional basespace SRR7172101 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172101_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2155 25.0 18.0 33.0 18.0 33.0 2 26.54325 29.0 18.0 31.0 18.0 33.0 3 30.305 31.0 29.0 33.0 27.0 33.0 4 31.523 33.0 31.0 33.0 29.0 33.0 5 32.7125 33.0 33.0 33.0 32.0 34.0 6 37.16625 38.0 37.0 38.0 36.0 38.0 7 37.4825 38.0 38.0 38.0 37.0 38.0 8 37.6115 38.0 38.0 38.0 38.0 38.0 9 37.61125 38.0 38.0 38.0 38.0 38.0 10-14 37.56015 38.0 38.0 38.0 38.0 38.0 15-19 37.6053 38.0 38.0 38.0 38.0 38.0 20-24 37.5913 38.0 38.0 38.0 38.0 38.0 25-29 37.5079 38.0 38.0 38.0 37.8 38.0 30-34 37.5291 38.0 38.0 38.0 37.8 38.0 35-39 37.42605 38.0 38.0 38.0 37.4 38.0 40-44 37.30325 38.0 38.0 38.0 37.0 38.0 45-49 37.39874999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.4144 38.0 38.0 38.0 37.0 38.0 55-59 37.47195 38.0 38.0 38.0 37.8 38.0 60-64 37.428200000000004 38.0 38.0 38.0 37.2 38.0 65-69 37.396499999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.33454999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.22765 38.0 38.0 38.0 37.0 38.0 80-84 37.162549999999996 38.0 38.0 38.0 36.6 38.0 85-89 37.03195 38.0 38.0 38.0 36.0 38.0 90-94 36.9377 38.0 38.0 38.0 36.0 38.0 95-99 36.894999999999996 38.0 38.0 38.0 35.6 38.0 100-104 36.766949999999994 38.0 38.0 38.0 35.0 38.0 105-109 36.799400000000006 38.0 38.0 38.0 35.0 38.0 110-114 36.45685 38.0 38.0 38.0 34.2 38.0 115-119 36.03785 38.0 37.2 38.0 32.6 38.0 120-124 36.340799999999994 38.0 38.0 38.0 34.0 38.0 125-129 36.008399999999995 38.0 37.2 38.0 32.8 38.0 130-134 35.906349999999996 38.0 37.0 38.0 32.8 38.0 135-139 35.7593 38.0 36.6 38.0 31.2 38.0 140-144 35.1793 38.0 36.0 38.0 30.6 38.0 145-149 34.7405 38.0 36.0 38.0 29.2 38.0 150-151 30.33975 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 0.0 17 3.0 18 1.0 19 1.0 20 3.0 21 2.0 22 5.0 23 7.0 24 7.0 25 4.0 26 6.0 27 16.0 28 18.0 29 18.0 30 36.0 31 43.0 32 72.0 33 70.0 34 131.0 35 235.0 36 718.0 37 2600.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.35 15.049999999999999 15.1 38.5 2 20.45 23.225 38.6 17.724999999999998 3 17.9 30.275000000000002 26.75 25.074999999999996 4 20.125 36.925000000000004 22.525000000000002 20.424999999999997 5 20.925 36.75 23.05 19.275000000000002 6 16.150000000000002 35.175 26.400000000000002 22.275 7 12.675 19.05 46.85 21.425 8 18.925 21.625 28.499999999999996 30.95 9 17.349999999999998 22.325 30.55 29.775000000000002 10-14 18.959907903298465 30.55207968366785 26.43775964763001 24.050252765403673 15-19 19.355 28.799999999999997 27.96 23.885 20-24 19.564999999999998 28.845 27.865000000000002 23.724999999999998 25-29 19.520976048802442 29.726486324316216 27.91639581979099 22.836141807090353 30-34 19.37596879843992 29.341467073353666 27.551377568878443 23.731186559327966 35-39 19.73592077623287 29.018705611683504 27.39821946583975 23.847154146243874 40-44 19.533906781356272 29.205841168233647 27.99059811962393 23.26965393078616 45-49 19.645982299114955 29.466473323666182 27.2063603180159 23.68118405920296 50-54 19.38 29.049999999999997 28.04 23.53 55-59 19.314999999999998 29.84 27.47 23.375 60-64 20.080000000000002 28.560000000000002 28.494999999999997 22.865 65-69 19.794999999999998 28.685 27.625 23.895 70-74 20.155 29.060000000000002 27.62 23.165 75-79 19.675 28.42 28.499999999999996 23.405 80-84 19.936993699369935 28.512851285128516 27.767776777677767 23.78237823782378 85-89 19.632853141256504 28.371348539415763 28.096238495398158 23.89955982392957 90-94 20.02500625156289 28.877219304826205 27.631907976994246 23.465866466616657 95-99 20.04 27.98 28.455000000000002 23.525 100-104 20.147051468013803 28.77006952433352 28.054819186715353 23.028059820937326 105-109 20.09801470220533 27.809171375706356 28.43926588988348 23.65354803220483 110-114 20.20582329317269 28.473895582329316 27.52008032128514 23.80020080321285 115-119 19.85772968640417 28.67448151487827 27.767758741609054 23.700030057108506 120-124 20.28710048516981 28.40494172960536 27.62466863402191 23.68328915120292 125-129 20.537995291288887 28.457646646295647 27.35560787456795 23.64875018784752 130-134 20.581029051452575 28.54142707135357 27.76638831941597 23.111155557777888 135-139 20.89 28.410000000000004 27.405 23.294999999999998 140-144 20.548219287715085 28.61144457783113 27.641056422569026 23.199279711884753 145-149 21.366751713442394 28.92590925008755 26.354494972234725 23.352844064235327 150-151 20.599999999999998 28.1375 27.0 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 2.0 23 2.5 24 2.5 25 2.0 26 4.5 27 9.0 28 11.5 29 15.0 30 23.0 31 30.5 32 41.5 33 53.0 34 59.5 35 75.5 36 101.5 37 120.0 38 150.5 39 192.5 40 206.5 41 224.0 42 260.5 43 287.0 44 306.5 45 278.5 46 250.5 47 244.0 48 215.0 49 190.0 50 158.5 51 117.5 52 88.5 53 62.5 54 48.0 55 39.0 56 26.5 57 20.5 58 13.5 59 15.0 60 15.5 61 8.5 62 4.0 63 4.0 64 5.5 65 4.5 66 2.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.105 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.03 40-44 0.02 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.04 90-94 0.025 95-99 0.0 100-104 0.034999999999999996 105-109 0.015 110-114 0.4 115-119 0.19 120-124 0.034999999999999996 125-129 0.185 130-134 0.005 135-139 0.0 140-144 0.04 145-149 0.055 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.7249999999999996 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7874999999999996 0.0 0.0 0.0 0.0 134-135 4.1375 0.0 0.0 0.0 0.0 136-137 4.887499999999999 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAATTG 10 0.0068892627 144.5875 3 AAAAAAA 85 0.0032418494 11.907207 15-19 >>END_MODULE SRR7172101 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172101_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1015 33.0 33.0 34.0 32.0 34.0 2 33.16575 34.0 33.0 34.0 33.0 34.0 3 33.2435 34.0 33.0 34.0 33.0 34.0 4 33.14875 34.0 33.0 34.0 33.0 34.0 5 33.09325 34.0 33.0 34.0 33.0 34.0 6 37.266 38.0 38.0 38.0 37.0 38.0 7 37.30125 38.0 38.0 38.0 38.0 38.0 8 37.35225 38.0 38.0 38.0 38.0 38.0 9 37.33975 38.0 38.0 38.0 38.0 38.0 10-14 37.378350000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.29975 38.0 38.0 38.0 37.4 38.0 20-24 37.2416 38.0 38.0 38.0 37.0 38.0 25-29 37.34425 38.0 38.0 38.0 37.4 38.0 30-34 37.31935 38.0 38.0 38.0 37.0 38.0 35-39 37.24465 38.0 38.0 38.0 37.0 38.0 40-44 37.18275 38.0 38.0 38.0 37.0 38.0 45-49 37.24085 38.0 38.0 38.0 37.0 38.0 50-54 37.24855 38.0 38.0 38.0 37.0 38.0 55-59 37.231 38.0 38.0 38.0 37.0 38.0 60-64 37.22165 38.0 38.0 38.0 37.0 38.0 65-69 37.11165 38.0 38.0 38.0 36.8 38.0 70-74 37.134699999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.049499999999995 38.0 38.0 38.0 36.6 38.0 80-84 36.94435 38.0 38.0 38.0 36.0 38.0 85-89 36.765 38.0 38.0 38.0 35.8 38.0 90-94 36.63405 38.0 38.0 38.0 35.0 38.0 95-99 36.54205 38.0 38.0 38.0 34.6 38.0 100-104 36.51755000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.48315 38.0 38.0 38.0 34.2 38.0 110-114 36.2781 38.0 38.0 38.0 34.0 38.0 115-119 36.203649999999996 38.0 38.0 38.0 33.8 38.0 120-124 36.0296 38.0 38.0 38.0 33.2 38.0 125-129 35.80195 38.0 37.6 38.0 31.6 38.0 130-134 35.40820000000001 38.0 36.4 38.0 30.0 38.0 135-139 34.89125 38.0 36.0 38.0 28.2 38.0 140-144 34.40405 38.0 35.8 38.0 27.0 38.0 145-149 33.348 38.0 33.6 38.0 18.4 38.0 150-151 28.0285 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 2.0 13 1.0 14 1.0 15 5.0 16 4.0 17 2.0 18 5.0 19 2.0 20 4.0 21 2.0 22 4.0 23 8.0 24 3.0 25 17.0 26 13.0 27 15.0 28 31.0 29 29.0 30 43.0 31 45.0 32 66.0 33 79.0 34 138.0 35 246.0 36 548.0 37 2674.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.358089522380595 13.653413353338333 18.229557389347338 35.75893973493373 2 23.1807951987997 22.43060765191298 37.65941485371343 16.729182295573892 3 21.10527631907977 26.356589147286826 31.48287071767942 21.05526381595399 4 23.6986986986987 34.95995995995996 21.02102102102102 20.32032032032032 5 24.524524524524523 36.311311311311314 21.996996996996998 17.167167167167165 6 16.624874623871616 38.89167502507522 25.125376128385156 19.358074222668005 7 16.23588456712673 14.830614805520703 48.38143036386449 20.55207026348808 8 20.125313283208023 21.228070175438596 29.273182957393484 29.3734335839599 9 22.91875626880642 22.24172517552658 29.413239719157474 25.426278836509532 10-14 23.159002103997594 28.30377717663561 26.640617172627994 21.896603546738806 15-19 22.677157462162974 28.295078680966224 28.154755938658916 20.873007918211886 20-24 22.87159455128205 28.340344551282055 28.145032051282055 20.643028846153847 25-29 23.444688937787557 27.805561112222442 27.99059811962393 20.759151830366072 30-34 22.925 28.525 27.965 20.585 35-39 22.695 28.78 28.215 20.31 40-44 22.955000000000002 28.275 28.34 20.43 45-49 22.689537907581517 27.675535107021403 28.355671134226846 21.279255851170234 50-54 22.884999999999998 28.555000000000003 28.084999999999997 20.474999999999998 55-59 23.16 27.73 28.65 20.46 60-64 23.34 28.325 28.050000000000004 20.285 65-69 23.575 28.005000000000003 28.01 20.41 70-74 23.085 28.675 28.205000000000002 20.035 75-79 23.525 28.96 27.6 19.915 80-84 23.685000000000002 27.800000000000004 28.555000000000003 19.96 85-89 23.69 28.415000000000003 27.605 20.29 90-94 22.99 28.335 28.205000000000002 20.47 95-99 23.44 28.33 28.360000000000003 19.869999999999997 100-104 23.715 28.349999999999998 27.92 20.015 105-109 23.419999999999998 28.1 28.315 20.165 110-114 24.02 28.060000000000002 28.165000000000003 19.755 115-119 23.86 28.13 27.92 20.09 120-124 23.599999999999998 27.815 28.365000000000002 20.22 125-129 24.0 27.639999999999997 28.16 20.200000000000003 130-134 24.099999999999998 28.15 27.92 19.830000000000002 135-139 24.46 27.794999999999998 27.925 19.82 140-144 24.505 28.235 27.76 19.5 145-149 25.169999999999998 27.985 27.150000000000002 19.695 150-151 25.575 28.125 27.187499999999996 19.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 2.5 26 4.0 27 6.0 28 6.0 29 7.5 30 12.0 31 17.0 32 22.5 33 25.5 34 41.5 35 68.0 36 94.5 37 124.0 38 149.5 39 179.0 40 209.0 41 240.5 42 281.0 43 292.0 44 308.0 45 299.0 46 273.0 47 259.0 48 223.0 49 181.5 50 147.5 51 135.5 52 109.0 53 73.5 54 52.0 55 39.0 56 24.5 57 20.0 58 17.0 59 11.0 60 11.5 61 7.0 62 5.5 63 5.0 64 1.5 65 1.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.1 5 0.1 6 0.3 7 0.375 8 0.25 9 0.3 10-14 0.19 15-19 0.22999999999999998 20-24 0.16 25-29 0.02 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6000000000000001 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.1875 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAAGA 10 0.00661466 146.54431 6 >>END_MODULE Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734636 spots for SRR7172101.sra Written 734636 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra Read 734632 spots for SRR7172101.sra Written 734632 spots for SRR7172101.sra SRR ids: ['SRR7172101.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yhnc9rt8 SRR7172101.sra spots: 14692644 blocks: [[1, 734632], [734633, 1469264], [1469265, 2203896], [2203897, 2938528], [2938529, 3673160], [3673161, 4407792], [4407793, 5142424], [5142425, 5877056], [5877057, 6611688], [6611689, 7346320], [7346321, 8080952], [8080953, 8815584], [8815585, 9550216], [9550217, 10284848], [10284849, 11019480], [11019481, 11754112], [11754113, 12488744], [12488745, 13223376], [13223377, 13958008], [13958009, 14692644]] SRR7172101 file size 4957154 SRR7172101 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172101 SRR7172101_1.fastq SRR7172101_2.fastq Input file: SRR7172101_1.fastq Paired file: SRR7172101_2.fastq trimmed: SRR7172101-trimmed-pair1.fastq, SRR7172101-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:51:29 2025 >> started Fri Feb 14 04:51:52 2025 >> done (23.249s) 14692644 read pairs processed; of these: 5893 ( 0.04%) short read pairs filtered out after trimming by size control 4845 ( 0.03%) empty read pairs filtered out after trimming by size control 14681906 (99.93%) read pairs available; of these: 7538644 (51.35%) trimmed read pairs available after processing 7143262 (48.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 4 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 3 0.00% 28 3 0.00% 29 5 0.00% 30 4 0.00% 31 2 0.00% 32 2 0.00% 33 4 0.00% 34 5 0.00% 35 3 0.00% 36 3 0.00% 37 7 0.00% 38 3 0.00% 39 6 0.00% 40 4 0.00% 41 8 0.00% 42 8 0.00% 43 13 0.00% 44 10 0.00% 45 9 0.00% 46 9 0.00% 47 10 0.00% 48 11 0.00% 49 13 0.00% 50 18 0.00% 51 23 0.00% 52 20 0.00% 53 30 0.00% 54 30 0.00% 55 24 0.00% 56 37 0.00% 57 40 0.00% 58 46 0.00% 59 71 0.00% 60 73 0.00% 61 88 0.00% 62 81 0.00% 63 109 0.00% 64 106 0.00% 65 123 0.00% 66 151 0.00% 67 191 0.00% 68 199 0.00% 69 221 0.00% 70 251 0.00% 71 294 0.00% 72 320 0.00% 73 383 0.00% 74 428 0.00% 75 527 0.00% 76 618 0.00% 77 693 0.00% 78 774 0.01% 79 867 0.01% 80 1098 0.01% 81 1162 0.01% 82 1363 0.01% 83 1577 0.01% 84 2182 0.01% 85 2617 0.02% 86 2927 0.02% 87 3185 0.02% 88 3356 0.02% 89 3704 0.03% 90 3833 0.03% 91 4350 0.03% 92 4507 0.03% 93 5063 0.03% 94 5320 0.04% 95 5985 0.04% 96 6487 0.04% 97 7196 0.05% 98 7519 0.05% 99 8138 0.06% 100 8731 0.06% 101 9591 0.07% 102 10211 0.07% 103 10981 0.07% 104 11725 0.08% 105 12715 0.09% 106 13587 0.09% 107 14292 0.10% 108 15069 0.10% 109 15382 0.10% 110 16407 0.11% 111 17189 0.12% 112 18099 0.12% 113 19243 0.13% 114 20112 0.14% 115 20869 0.14% 116 22348 0.15% 117 23149 0.16% 118 24399 0.17% 119 25282 0.17% 120 26268 0.18% 121 27706 0.19% 122 29201 0.20% 123 30299 0.21% 124 31736 0.22% 125 32838 0.22% 126 34444 0.23% 127 36227 0.25% 128 37882 0.26% 129 39914 0.27% 130 41439 0.28% 131 43573 0.30% 132 46361 0.32% 133 49338 0.34% 134 52189 0.36% 135 55722 0.38% 136 61777 0.42% 137 63310 0.43% 138 67566 0.46% 139 73866 0.50% 140 78478 0.53% 141 83656 0.57% 142 92045 0.63% 143 103976 0.71% 144 119803 0.82% 145 140938 0.96% 146 175521 1.20% 147 239269 1.63% 148 365993 2.49% 149 739341 5.04% 150 4100011 27.93% 151 7143262 48.65% 14681906 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=12.08 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=3.3 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=4.99 fanout-score-rank=10 prefix-density=0.70 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=128.62 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=17.5 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172101 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:52:40 Started mapping on | Feb 14 04:52:41 Finished on | Feb 14 04:54:18 Mapping speed, Million of reads per hour | 544.90 Number of input reads | 14681906 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13914274 Uniquely mapped reads % | 94.77% Average mapped length | 294.75 Number of splices: Total | 13545626 Number of splices: Annotated (sjdb) | 13293428 Number of splices: GT/AG | 13324684 Number of splices: GC/AG | 172568 Number of splices: AT/AC | 10370 Number of splices: Non-canonical | 38004 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.45 Insertion rate per base | 0.03% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437168 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 43363 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 338507 338507 338507 N_multimapping 437168 437168 437168 N_noFeature 377466 13771946 441896 N_ambiguous 155038 819 76747 UnstrandedReadsAssigned:13381770 PositiveStrandReadsAssigned:141509 NegativeStrandReadsAssigned:13395631 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172101 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172101-trimmed-pair1.fastq SRR7172101-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,681,906 reads, 13,274,625 reads pseudoaligned [quant] estimated average fragment length: 245.538 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7172101.ke.tsv 34699 SRR7172101.se.tsv 87100 total ==> SRR7172101.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.46 1390 55.7107 Potri.005G024800.1.v4.1 1035 790.462 456 41.0043 Potri.004G059700.1.v4.1 961 716.505 36 3.57132 Potri.007G009000.2.v4.1 1416 1171.46 0 0 Potri.003G141000.2.v4.1 2943 2698.46 563 14.8299 Potri.016G087400.1.v4.1 270 79.1193 774 695.352 Potri.015G069301.1.v4.1 564 324.378 0 0 Potri.010G195200.1.v4.1 1773 1528.46 196 9.1148 Potri.012G127500.1.v4.1 977 732.478 4467 433.478 ==> SRR7172101.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 480 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 198 SRR7172101 completed mapping pipeline successfully