Starting /dee2/code/volunteer_pipeline.sh SRR7172102 current disk space = 3085712486400 free memory = 1578838488 SRR7172102 SRAfilesize 58394ea9e8b11c7eccdb276661d9c31d SRR7172102.sra SRR7172102.sra file validated SRR7172102 is paired end SRR7172102 is conventional basespace SRR7172102 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172102_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78125 33.0 33.0 34.0 32.0 34.0 2 33.18275 34.0 33.0 34.0 32.0 34.0 3 32.764 33.0 33.0 34.0 32.0 34.0 4 32.909 33.0 33.0 34.0 32.0 34.0 5 33.08775 34.0 33.0 34.0 32.0 34.0 6 36.65425 38.0 37.0 38.0 34.0 38.0 7 37.19625 38.0 38.0 38.0 36.0 38.0 8 37.48425 38.0 38.0 38.0 37.0 38.0 9 37.367 38.0 38.0 38.0 37.0 38.0 10-14 37.49915 38.0 38.0 38.0 37.6 38.0 15-19 37.4894 38.0 38.0 38.0 37.6 38.0 20-24 37.49405 38.0 38.0 38.0 37.6 38.0 25-29 37.4793 38.0 38.0 38.0 37.6 38.0 30-34 37.3815 38.0 38.0 38.0 37.0 38.0 35-39 37.2899 38.0 38.0 38.0 36.8 38.0 40-44 37.3002 38.0 38.0 38.0 37.0 38.0 45-49 37.2805 38.0 38.0 38.0 37.0 38.0 50-54 37.37805 38.0 38.0 38.0 37.0 38.0 55-59 37.34779999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.2638 38.0 38.0 38.0 36.8 38.0 65-69 37.22265 38.0 38.0 38.0 36.4 38.0 70-74 37.16645 38.0 38.0 38.0 36.2 38.0 75-79 37.0266 38.0 38.0 38.0 36.0 38.0 80-84 36.93515 38.0 38.0 38.0 35.8 38.0 85-89 36.930150000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.80865 38.0 38.0 38.0 35.4 38.0 95-99 36.7247 38.0 38.0 38.0 34.8 38.0 100-104 36.529399999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.44235 38.0 38.0 38.0 33.8 38.0 110-114 36.152150000000006 38.0 37.4 38.0 33.4 38.0 115-119 36.03925 38.0 37.0 38.0 33.2 38.0 120-124 35.762950000000004 38.0 36.8 38.0 31.8 38.0 125-129 35.3753 38.0 36.2 38.0 30.6 38.0 130-134 35.3481 38.0 36.2 38.0 31.0 38.0 135-139 34.860350000000004 38.0 35.8 38.0 28.2 38.0 140-144 34.3087 38.0 34.2 38.0 25.8 38.0 145-149 33.822 38.0 34.0 38.0 24.4 38.0 150-151 28.2265 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 4.0 17 1.0 18 3.0 19 0.0 20 3.0 21 3.0 22 7.0 23 8.0 24 10.0 25 9.0 26 12.0 27 10.0 28 30.0 29 34.0 30 47.0 31 54.0 32 66.0 33 120.0 34 154.0 35 283.0 36 645.0 37 2495.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.225 17.025000000000002 15.125 36.625 2 19.55 23.925 38.224999999999994 18.3 3 18.525 29.45 27.35 24.675 4 21.380345086271568 36.434108527131784 21.530382595648913 20.655163790947736 5 18.925 39.0 24.45 17.625 6 14.875 37.6 26.875 20.65 7 12.1 20.474999999999998 46.475 20.95 8 18.275 22.0 28.549999999999997 31.175000000000004 9 17.27867203219316 22.585513078470825 32.3943661971831 27.74144869215292 10-14 18.849712428107026 30.27256814203551 26.581645411352838 24.296074018504626 15-19 19.509999999999998 29.435 27.49 23.565 20-24 19.075 29.835 27.439999999999998 23.65 25-29 18.990949547477374 29.84149207460373 27.391369568478424 23.77618880944047 30-34 19.040000000000003 29.78 27.93 23.25 35-39 19.5 28.744999999999997 28.21 23.544999999999998 40-44 19.097864679701956 29.23438515777367 28.39425913887083 23.27349102365355 45-49 19.217882682402358 29.76446466970046 27.44911736760514 23.568535280292043 50-54 18.85 29.645 27.68 23.825 55-59 19.74 28.515 27.83 23.915 60-64 19.42 29.520000000000003 27.625 23.435 65-69 19.735 29.17 27.405 23.69 70-74 19.785989299464973 28.7764388219411 28.24641232061603 23.1911595579779 75-79 19.810990549527478 29.741487074353717 27.561378068903448 22.88614430721536 80-84 20.06 29.12 27.689999999999998 23.13 85-89 19.906990699069908 29.687968796879687 27.39273927392739 23.01230123012301 90-94 19.776977697769777 28.66786678667867 27.677767776777678 23.877387738773876 95-99 20.01 28.585 27.839999999999996 23.565 100-104 19.875993799689983 28.87644382219111 27.36136806840342 23.886194309715485 105-109 20.196009800490025 28.706435321766087 27.936396819840994 23.161158057902895 110-114 20.537591350485535 28.48633496846531 27.680448493342674 23.295625187706477 115-119 20.355 28.720000000000002 27.384999999999998 23.54 120-124 20.285213910432827 28.62646985238929 27.790843132349263 23.297473104828622 125-129 20.700876095118897 28.53566958698373 27.319148936170212 23.44430538172716 130-134 20.549999999999997 28.83 27.595 23.025000000000002 135-139 20.43 28.465 26.955000000000002 24.15 140-144 20.55102755137757 28.40642032101605 27.27136356817841 23.771188559427973 145-149 20.535 28.84 26.740000000000002 23.885 150-151 20.025000000000002 29.4 26.75 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.5 24 4.0 25 5.5 26 5.0 27 6.0 28 13.5 29 25.5 30 30.5 31 33.5 32 44.5 33 61.5 34 78.0 35 93.0 36 114.5 37 135.0 38 157.5 39 196.5 40 213.5 41 233.5 42 256.5 43 252.5 44 268.0 45 270.5 46 243.5 47 226.0 48 214.5 49 181.5 50 131.5 51 103.5 52 89.5 53 70.5 54 58.0 55 42.5 56 35.0 57 30.5 58 19.5 59 13.5 60 10.5 61 7.0 62 4.0 63 2.5 64 3.0 65 2.5 66 0.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.6 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.005 80-84 0.0 85-89 0.01 90-94 0.01 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.11 115-119 0.0 120-124 0.075 125-129 0.125 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.8625 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.15 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGATTC 10 0.006601011 146.64557 3 GGAGGCC 10 0.0068573058 144.8125 145 >>END_MODULE SRR7172102 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172102_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.994 33.0 33.0 34.0 32.0 34.0 2 33.06825 34.0 33.0 34.0 32.0 34.0 3 33.095 34.0 33.0 34.0 33.0 34.0 4 33.1425 34.0 33.0 34.0 33.0 34.0 5 33.108 34.0 33.0 34.0 33.0 34.0 6 37.15325 38.0 38.0 38.0 37.0 38.0 7 37.2425 38.0 38.0 38.0 37.0 38.0 8 37.18275 38.0 38.0 38.0 37.0 38.0 9 37.19925 38.0 38.0 38.0 37.0 38.0 10-14 37.1648 38.0 38.0 38.0 37.0 38.0 15-19 37.15975 38.0 38.0 38.0 37.0 38.0 20-24 37.13055000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.071749999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.06165 38.0 38.0 38.0 36.8 38.0 35-39 37.044650000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.9853 38.0 38.0 38.0 36.6 38.0 45-49 36.966899999999995 38.0 38.0 38.0 36.4 38.0 50-54 37.00545 38.0 38.0 38.0 36.8 38.0 55-59 36.9664 38.0 38.0 38.0 36.4 38.0 60-64 36.948949999999996 38.0 38.0 38.0 36.2 38.0 65-69 36.81 38.0 38.0 38.0 36.0 38.0 70-74 36.7992 38.0 38.0 38.0 35.8 38.0 75-79 36.7401 38.0 38.0 38.0 35.8 38.0 80-84 36.69385 38.0 38.0 38.0 35.4 38.0 85-89 36.58705 38.0 38.0 38.0 35.0 38.0 90-94 36.40345 38.0 38.0 38.0 34.2 38.0 95-99 36.236450000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.2094 38.0 38.0 38.0 34.0 38.0 105-109 36.0982 38.0 38.0 38.0 33.8 38.0 110-114 35.861700000000006 38.0 37.6 38.0 32.0 38.0 115-119 35.78985 38.0 37.0 38.0 31.6 38.0 120-124 35.5905 38.0 37.2 38.0 31.2 38.0 125-129 35.1743 38.0 36.4 38.0 29.2 38.0 130-134 34.7633 38.0 36.0 38.0 27.8 38.0 135-139 34.239549999999994 38.0 35.8 38.0 24.8 38.0 140-144 33.50475 38.0 33.4 38.0 20.4 38.0 145-149 32.97745 38.0 33.0 38.0 14.2 38.0 150-151 27.784000000000002 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 0.0 5 2.0 6 3.0 7 1.0 8 2.0 9 1.0 10 1.0 11 2.0 12 1.0 13 0.0 14 3.0 15 4.0 16 0.0 17 6.0 18 2.0 19 6.0 20 5.0 21 8.0 22 11.0 23 11.0 24 12.0 25 15.0 26 19.0 27 19.0 28 34.0 29 35.0 30 50.0 31 55.0 32 89.0 33 96.0 34 165.0 35 255.0 36 541.0 37 2533.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.81091910843977 14.425244177310292 18.582519408965688 32.181317305284246 2 23.761880940470235 22.911455727863935 37.918959479739875 15.407703851925964 3 20.135067533766886 26.463231615807903 32.3911955977989 21.010505252626313 4 24.68734367183592 33.01650825412706 21.76088044022011 20.535267633816908 5 23.461730865432717 36.743371685842924 22.011005502751377 17.78389194597299 6 17.413059794846134 37.0778083562672 24.943707780835627 20.565424068051037 7 16.7125344008006 15.561671253440078 46.10958218663998 21.61621215911934 8 22.386193096548272 22.211105552776388 28.339169584792394 27.063531765882942 9 22.211105552776388 24.012006003001503 29.014507253626814 24.7623811905953 10-14 23.081540770385192 28.244122061030513 26.943471735867934 21.73086543271636 15-19 23.018811286772063 28.582149289573742 27.721632979787874 20.67740644386632 20-24 23.453208623018057 28.259890961836643 27.57465112789476 20.712249287250536 25-29 23.42234223422342 28.577857785778576 27.75777577757776 20.242024202420243 30-34 22.93 28.475 28.12 20.474999999999998 35-39 23.28 27.82 28.555000000000003 20.345 40-44 23.255 28.425 27.93 20.39 45-49 23.075000000000003 28.4 27.415 21.11 50-54 23.291164558227912 28.0314015700785 28.116405820291014 20.56102805140257 55-59 23.625906476619154 27.846961740435113 27.961990497624406 20.56514128532133 60-64 23.280820205051263 28.11202800700175 27.97199299824956 20.635158789697424 65-69 23.545886471617905 28.362090522630655 27.80195048762191 20.29007251812953 70-74 23.760940235058765 28.33708427106777 27.996999249812454 19.904976244061015 75-79 23.13078269567392 27.936984246061513 28.327081770442607 20.605151287821954 80-84 23.37584396099025 28.387096774193548 28.037009252313077 20.200050012503127 85-89 23.730932733183295 27.38184546136534 28.91722930732683 19.96999249812453 90-94 23.72093023255814 27.521880470117527 28.057014253563388 20.70017504376094 95-99 24.419883976795358 28.515703140628123 27.845569113822766 19.21884376875375 100-104 23.778566785017752 27.97919687953193 28.274241136170424 19.96799519927989 105-109 23.985 28.12 28.38 19.515 110-114 23.77 28.360000000000003 28.000000000000004 19.869999999999997 115-119 23.533530029504426 28.144221633244985 28.09921488223234 20.223033455018253 120-124 23.335833958489623 27.941985496374095 29.15728932233058 19.564891222805702 125-129 24.10602650662666 28.00200050012503 28.18704676169042 19.70492623155789 130-134 24.50112528132033 27.516879219804952 28.18704676169042 19.794948737184296 135-139 24.951237809452362 27.526881720430108 28.192048012003003 19.32983245811453 140-144 24.196049012253063 28.442110527631908 27.911977994498628 19.449862465616405 145-149 24.422442244224424 28.402840284028404 27.467746774677465 19.706970697069707 150-151 25.0625 28.225 26.700000000000003 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 3.5 26 5.5 27 3.5 28 2.5 29 7.0 30 14.0 31 19.5 32 29.0 33 42.0 34 48.5 35 57.5 36 87.0 37 108.5 38 130.0 39 173.0 40 206.0 41 234.0 42 256.5 43 285.0 44 310.0 45 307.0 46 280.0 47 249.5 48 235.0 49 199.0 50 144.5 51 118.0 52 105.0 53 75.5 54 58.5 55 48.5 56 38.0 57 32.0 58 19.0 59 13.0 60 10.0 61 11.5 62 10.0 63 3.5 64 3.5 65 2.0 66 1.5 67 2.5 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.05 3 0.05 4 0.05 5 0.05 6 0.075 7 0.075 8 0.05 9 0.05 10-14 0.05 15-19 0.06 20-24 0.034999999999999996 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.02 100-104 0.015 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.6 0.0 0.0 0.0 0.0 126-127 2.9124999999999996 0.0 0.0 0.0 0.0 128-129 3.0875 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.8499999999999996 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.3875 0.0 0.0 0.0 0.0 138-139 4.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGCCA 10 0.006830828 145.0 7 CAAGCCT 10 0.006830828 145.0 7 TTTTTTT 55 0.0025160722 15.818182 115-119 >>END_MODULE Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929700 spots for SRR7172102.sra Written 929700 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra Read 929683 spots for SRR7172102.sra Written 929683 spots for SRR7172102.sra SRR ids: ['SRR7172102.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jr9sy70y SRR7172102.sra spots: 18593677 blocks: [[1, 929683], [929684, 1859366], [1859367, 2789049], [2789050, 3718732], [3718733, 4648415], [4648416, 5578098], [5578099, 6507781], [6507782, 7437464], [7437465, 8367147], [8367148, 9296830], [9296831, 10226513], [10226514, 11156196], [11156197, 12085879], [12085880, 13015562], [13015563, 13945245], [13945246, 14874928], [14874929, 15804611], [15804612, 16734294], [16734295, 17663977], [17663978, 18593677]] SRR7172102 file size 6279086 SRR7172102 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172102 SRR7172102_1.fastq SRR7172102_2.fastq Input file: SRR7172102_1.fastq Paired file: SRR7172102_2.fastq trimmed: SRR7172102-trimmed-pair1.fastq, SRR7172102-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:58:21 2025 >> started Fri Feb 14 05:58:42 2025 >> done (20.610s) 18593677 read pairs processed; of these: 12505 ( 0.07%) short read pairs filtered out after trimming by size control 11342 ( 0.06%) empty read pairs filtered out after trimming by size control 18569830 (99.87%) read pairs available; of these: 10441447 (56.23%) trimmed read pairs available after processing 8128383 (43.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 8 0.00% 26 7 0.00% 27 5 0.00% 28 3 0.00% 29 9 0.00% 30 3 0.00% 31 2 0.00% 32 4 0.00% 33 13 0.00% 34 6 0.00% 35 12 0.00% 36 8 0.00% 37 5 0.00% 38 4 0.00% 39 5 0.00% 40 7 0.00% 41 9 0.00% 42 10 0.00% 43 7 0.00% 44 9 0.00% 45 5 0.00% 46 14 0.00% 47 18 0.00% 48 15 0.00% 49 12 0.00% 50 18 0.00% 51 15 0.00% 52 21 0.00% 53 36 0.00% 54 29 0.00% 55 40 0.00% 56 50 0.00% 57 76 0.00% 58 170 0.00% 59 322 0.00% 60 172 0.00% 61 113 0.00% 62 105 0.00% 63 111 0.00% 64 143 0.00% 65 136 0.00% 66 147 0.00% 67 168 0.00% 68 203 0.00% 69 241 0.00% 70 272 0.00% 71 330 0.00% 72 357 0.00% 73 417 0.00% 74 536 0.00% 75 580 0.00% 76 713 0.00% 77 817 0.00% 78 996 0.01% 79 1175 0.01% 80 1237 0.01% 81 1391 0.01% 82 1678 0.01% 83 2925 0.02% 84 4190 0.02% 85 4506 0.02% 86 4462 0.02% 87 5052 0.03% 88 4908 0.03% 89 4894 0.03% 90 4738 0.03% 91 5277 0.03% 92 5579 0.03% 93 6171 0.03% 94 6540 0.04% 95 6979 0.04% 96 7684 0.04% 97 8767 0.05% 98 9103 0.05% 99 10121 0.05% 100 11417 0.06% 101 11387 0.06% 102 12244 0.07% 103 12842 0.07% 104 13570 0.07% 105 14470 0.08% 106 15609 0.08% 107 16154 0.09% 108 17576 0.09% 109 18327 0.10% 110 19674 0.11% 111 20830 0.11% 112 21764 0.12% 113 23169 0.12% 114 24264 0.13% 115 25539 0.14% 116 27154 0.15% 117 28745 0.15% 118 30227 0.16% 119 31789 0.17% 120 33697 0.18% 121 35700 0.19% 122 37191 0.20% 123 39437 0.21% 124 41810 0.23% 125 44023 0.24% 126 46241 0.25% 127 49561 0.27% 128 52229 0.28% 129 54473 0.29% 130 57327 0.31% 131 60027 0.32% 132 63674 0.34% 133 66529 0.36% 134 70960 0.38% 135 75513 0.41% 136 80805 0.44% 137 84605 0.46% 138 91783 0.49% 139 99944 0.54% 140 112277 0.60% 141 120922 0.65% 142 135935 0.73% 143 157023 0.85% 144 186012 1.00% 145 218084 1.17% 146 282360 1.52% 147 389653 2.10% 148 575862 3.10% 149 1161524 6.25% 150 5404589 29.10% 151 8128383 43.77% 18569830 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=44.00 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=TCATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=30.84 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172102 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:59:28 Started mapping on | Feb 14 05:59:28 Finished on | Feb 14 06:01:57 Mapping speed, Million of reads per hour | 448.67 Number of input reads | 18569830 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17350404 Uniquely mapped reads % | 93.43% Average mapped length | 294.34 Number of splices: Total | 15954423 Number of splices: Annotated (sjdb) | 15605298 Number of splices: GT/AG | 15690909 Number of splices: GC/AG | 202311 Number of splices: AT/AC | 13367 Number of splices: Non-canonical | 47836 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.40 Insertion rate per base | 0.03% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 502478 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 65193 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 731769 731769 731769 N_multimapping 502478 502478 502478 N_noFeature 566691 17158716 646462 N_ambiguous 204765 1087 92321 UnstrandedReadsAssigned:16578948 PositiveStrandReadsAssigned:190601 NegativeStrandReadsAssigned:16611621 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172102 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172102-trimmed-pair1.fastq SRR7172102-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,569,830 reads, 16,504,965 reads pseudoaligned [quant] estimated average fragment length: 245.82 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR7172102.ke.tsv 34699 SRR7172102.se.tsv 87100 total ==> SRR7172102.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.18 2036 60.1625 Potri.005G024800.1.v4.1 1035 790.18 585 38.791 Potri.004G059700.1.v4.1 961 716.199 42 3.07267 Potri.007G009000.2.v4.1 1416 1171.18 0 0 Potri.003G141000.2.v4.1 2943 2698.18 668 12.972 Potri.016G087400.1.v4.1 270 77.236 1309 888.016 Potri.015G069301.1.v4.1 564 323.518 0 0 Potri.010G195200.1.v4.1 1773 1528.18 874.857 29.996 Potri.012G127500.1.v4.1 977 732.185 8589 614.643 ==> SRR7172102.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 821 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 42 Potri.001G452600.v4.1 441 SRR7172102 completed mapping pipeline successfully