Starting /dee2/code/volunteer_pipeline.sh SRR7172103 current disk space = 3110522490880 free memory = 1568231280 SRR7172103 SRAfilesize c01eac58e600a4ed08259990edb35c3c SRR7172103.sra SRR7172103.sra file validated SRR7172103 is paired end SRR7172103 is conventional basespace SRR7172103 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172103_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.16575 25.0 18.0 33.0 18.0 33.0 2 25.67225 27.0 18.0 31.0 18.0 33.0 3 29.5805 30.0 28.0 33.0 27.0 33.0 4 31.47725 33.0 31.0 33.0 29.0 33.0 5 31.808 33.0 32.0 33.0 31.0 33.0 6 36.47125 38.0 37.0 38.0 34.0 38.0 7 36.64025 38.0 37.0 38.0 34.0 38.0 8 37.116 38.0 38.0 38.0 36.0 38.0 9 37.37725 38.0 38.0 38.0 37.0 38.0 10-14 37.47695 38.0 38.0 38.0 37.4 38.0 15-19 37.584 38.0 38.0 38.0 38.0 38.0 20-24 37.57255 38.0 38.0 38.0 38.0 38.0 25-29 37.476350000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.511399999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.4542 38.0 38.0 38.0 37.8 38.0 40-44 37.3233 38.0 38.0 38.0 37.0 38.0 45-49 37.396249999999995 38.0 38.0 38.0 37.2 38.0 50-54 37.431149999999995 38.0 38.0 38.0 37.4 38.0 55-59 37.43025 38.0 38.0 38.0 37.2 38.0 60-64 37.4769 38.0 38.0 38.0 37.2 38.0 65-69 37.43605 38.0 38.0 38.0 37.0 38.0 70-74 37.3341 38.0 38.0 38.0 37.0 38.0 75-79 37.28915 38.0 38.0 38.0 37.0 38.0 80-84 37.2016 38.0 38.0 38.0 36.6 38.0 85-89 37.0728 38.0 38.0 38.0 36.2 38.0 90-94 36.98565 38.0 38.0 38.0 36.0 38.0 95-99 36.90689999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.80025 38.0 38.0 38.0 35.0 38.0 105-109 36.811150000000005 38.0 38.0 38.0 35.2 38.0 110-114 36.43245 38.0 38.0 38.0 34.2 38.0 115-119 36.01635 38.0 37.2 38.0 32.6 38.0 120-124 36.38595 38.0 38.0 38.0 34.0 38.0 125-129 36.13085 38.0 37.8 38.0 33.6 38.0 130-134 35.9793 38.0 37.2 38.0 32.6 38.0 135-139 35.69435 38.0 36.4 38.0 31.2 38.0 140-144 35.35995 38.0 36.0 38.0 31.0 38.0 145-149 34.947 38.0 36.0 38.0 29.8 38.0 150-151 30.307624999999998 35.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 0.0 18 2.0 19 2.0 20 2.0 21 3.0 22 3.0 23 4.0 24 2.0 25 6.0 26 9.0 27 14.0 28 16.0 29 22.0 30 35.0 31 44.0 32 60.0 33 91.0 34 144.0 35 231.0 36 689.0 37 2614.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.65 15.25 14.85 35.25 2 20.7 23.775 38.175 17.349999999999998 3 16.825000000000003 31.5 26.1 25.575 4 19.45 38.25 22.3 20.0 5 20.474999999999998 38.5 22.95 18.075 6 17.0 36.425000000000004 25.35 21.224999999999998 7 13.075000000000001 20.1 45.475 21.349999999999998 8 17.575 20.825 29.5 32.1 9 17.45 23.25 30.8 28.499999999999996 10-14 19.182059368273517 30.264804525203985 26.370325874755967 24.18281023176653 15-19 19.68 29.415000000000003 27.200000000000003 23.705000000000002 20-24 19.41 28.765 27.485 24.34 25-29 19.28692869286929 29.667966796679668 28.02280228022802 23.022302230223023 30-34 19.13882776555311 29.080816163232647 27.965593118623726 23.814762952590517 35-39 20.017005952083228 29.240234081928673 27.35957585154804 23.383184114440052 40-44 19.495848754626387 29.478843653095925 27.76332899869961 23.26197859357807 45-49 19.985995798739623 28.75362608782635 27.20816244873462 24.05221566469941 50-54 20.046002300115006 29.03645182259113 27.906395319765988 23.011150557527877 55-59 19.82 28.88 27.685 23.615 60-64 19.675 28.78 27.85 23.695 65-69 19.925 29.13 27.67 23.275000000000002 70-74 20.532053205320533 28.927892789278932 27.08770877087709 23.452345234523452 75-79 20.122012201220123 29.27792779277928 27.08770877087709 23.512351235123514 80-84 20.078031212484994 28.61144457783113 27.941176470588236 23.369347739095637 85-89 20.018011707609944 28.36343623355181 27.838094761595038 23.780457297243206 90-94 20.47716700845296 28.615015255339372 27.40459160706247 23.5032261291452 95-99 20.482048204820483 28.95789578957896 27.412741274127413 23.14731473147315 100-104 20.68 29.18 26.455000000000002 23.685000000000002 105-109 20.935000000000002 28.685 27.060000000000002 23.32 110-114 21.15713280386046 27.96320498642807 27.80737910927918 23.07228310043229 115-119 20.304517680056094 28.65371130922568 27.27636982870881 23.765401182009416 120-124 20.874174834966993 28.585717143428685 26.915383076615324 23.624724944988998 125-129 20.61370576162587 28.733042999449367 27.35645992891826 23.29679131000651 130-134 21.287128712871286 27.602760276027606 27.622762276227625 23.487348734873486 135-139 21.157115711571155 27.852785278527854 26.832683268326836 24.157415741574155 140-144 21.143457382953184 28.471388555422166 27.3609443777511 23.02420968387355 145-149 20.910455227613806 28.38419209604802 26.468234117058532 24.23711855927964 150-151 20.677584698087262 28.90361295161895 26.428303537942245 23.990498812351543 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 4.0 26 6.5 27 7.5 28 11.5 29 14.5 30 14.0 31 26.5 32 41.5 33 49.5 34 69.5 35 93.0 36 103.5 37 114.5 38 154.5 39 189.5 40 202.0 41 222.0 42 239.5 43 264.0 44 273.0 45 278.0 46 267.5 47 236.5 48 221.0 49 184.5 50 134.0 51 124.5 52 116.5 53 80.0 54 62.0 55 48.5 56 34.5 57 24.5 58 20.5 59 16.0 60 7.5 61 9.0 62 7.0 63 4.0 64 5.5 65 2.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.11499999999999999 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.02 35-39 0.034999999999999996 40-44 0.03 45-49 0.03 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.01 80-84 0.04 85-89 0.065 90-94 0.034999999999999996 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.53 115-119 0.16999999999999998 120-124 0.02 125-129 0.11499999999999999 130-134 0.01 135-139 0.01 140-144 0.04 145-149 0.05 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.199999999999999 0.0 0.0 0.0 0.0 130-131 4.550000000000001 0.0 0.0 0.0 0.0 132-133 4.85 0.0 0.0 0.0 0.0 134-135 5.4875 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAACC 10 0.0068555363 144.825 7 >>END_MODULE SRR7172103 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172103_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06075 33.0 33.0 34.0 32.0 34.0 2 33.15 34.0 33.0 34.0 33.0 34.0 3 33.2 34.0 33.0 34.0 33.0 34.0 4 33.1315 34.0 33.0 34.0 33.0 34.0 5 33.05475 34.0 33.0 34.0 33.0 34.0 6 37.24925 38.0 38.0 38.0 37.0 38.0 7 37.309 38.0 38.0 38.0 37.0 38.0 8 37.332 38.0 38.0 38.0 38.0 38.0 9 37.3335 38.0 38.0 38.0 38.0 38.0 10-14 37.313900000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.2417 38.0 38.0 38.0 37.0 38.0 20-24 37.194900000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.2136 38.0 38.0 38.0 37.2 38.0 30-34 37.224050000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.17130000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.12885 38.0 38.0 38.0 37.0 38.0 45-49 37.1795 38.0 38.0 38.0 37.0 38.0 50-54 37.1959 38.0 38.0 38.0 37.0 38.0 55-59 37.148250000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.12519999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.03445 38.0 38.0 38.0 36.6 38.0 70-74 37.022400000000005 38.0 38.0 38.0 36.8 38.0 75-79 36.9195 38.0 38.0 38.0 36.2 38.0 80-84 36.822799999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.7094 38.0 38.0 38.0 35.6 38.0 90-94 36.5142 38.0 38.0 38.0 34.8 38.0 95-99 36.46555 38.0 38.0 38.0 34.6 38.0 100-104 36.472 38.0 38.0 38.0 34.6 38.0 105-109 36.427800000000005 38.0 38.0 38.0 34.4 38.0 110-114 36.2352 38.0 38.0 38.0 34.0 38.0 115-119 36.1246 38.0 38.0 38.0 33.8 38.0 120-124 35.91325 38.0 37.8 38.0 32.6 38.0 125-129 35.64540000000001 38.0 37.0 38.0 31.2 38.0 130-134 35.245250000000006 38.0 36.4 38.0 29.8 38.0 135-139 34.76525 38.0 36.0 38.0 28.0 38.0 140-144 34.31425 38.0 35.6 38.0 26.2 38.0 145-149 33.4884 38.0 33.8 38.0 19.2 38.0 150-151 27.877 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 1.0 5 2.0 6 0.0 7 1.0 8 2.0 9 2.0 10 0.0 11 3.0 12 3.0 13 2.0 14 3.0 15 4.0 16 1.0 17 1.0 18 1.0 19 7.0 20 4.0 21 5.0 22 8.0 23 6.0 24 7.0 25 16.0 26 14.0 27 17.0 28 23.0 29 44.0 30 25.0 31 47.0 32 67.0 33 95.0 34 116.0 35 220.0 36 533.0 37 2709.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.69234617308654 14.357178589294648 17.508754377188595 33.441720860430216 2 24.112056028014006 22.686343171585793 36.04302151075538 17.158579289644823 3 21.510755377688845 25.83791895947974 29.789894947473737 22.861430715357677 4 24.49337002752064 34.72604453340005 20.8656492369277 19.914936202151615 5 23.34834834834835 35.73573573573574 22.3973973973974 18.51851851851852 6 17.355371900826448 37.265214124718256 24.843476083145504 20.535937891309793 7 16.11125031320471 16.186419443748434 45.226760210473564 22.475570032573287 8 21.13169754631948 22.033049574361545 26.91537305958938 29.919879819729594 9 21.387427998998245 24.718256949661907 27.44803405960431 26.446280991735538 10-14 23.092711253504206 28.464156988386062 26.20144173007609 22.241690028033638 15-19 22.814221331998 27.501251877816724 28.487731597396092 21.196795192789182 20-24 22.80008008809691 28.03083391730904 27.790569626589246 21.378516368004803 25-29 22.46786375231331 28.194868203871355 28.074826189166206 21.26244185464913 30-34 23.185 28.28 28.144999999999996 20.39 35-39 22.91 27.700000000000003 28.360000000000003 21.029999999999998 40-44 23.044999999999998 27.68 28.155 21.12 45-49 23.046914074222265 27.608282484745423 28.79863959187756 20.54616384915475 50-54 23.48 27.73 28.33 20.46 55-59 22.905 28.084999999999997 27.87 21.14 60-64 23.71 27.965 27.939999999999998 20.385 65-69 23.494999999999997 28.315 27.334999999999997 20.855 70-74 23.755000000000003 27.975 27.860000000000003 20.41 75-79 23.865 27.46 28.075 20.599999999999998 80-84 24.07 27.35 28.015 20.565 85-89 23.674999999999997 28.01 27.85 20.465 90-94 23.400000000000002 27.58 28.17 20.849999999999998 95-99 23.405 27.79 27.76 21.044999999999998 100-104 23.78 27.07 28.24 20.91 105-109 23.515 27.560000000000002 28.305000000000003 20.62 110-114 23.485 27.744999999999997 27.944999999999997 20.825 115-119 23.799999999999997 27.825 28.110000000000003 20.265 120-124 23.945 27.91 27.85 20.294999999999998 125-129 24.645 27.74 27.595 20.02 130-134 24.005000000000003 27.48 28.24 20.275000000000002 135-139 24.825 27.195000000000004 28.32 19.66 140-144 24.915000000000003 28.144999999999996 27.3 19.64 145-149 24.33 27.72 27.505000000000003 20.445 150-151 25.1 26.987499999999997 27.800000000000004 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 1.5 28 5.5 29 8.5 30 10.0 31 11.5 32 15.5 33 33.0 34 47.0 35 57.0 36 79.0 37 110.5 38 136.5 39 161.5 40 208.5 41 237.0 42 259.5 43 273.0 44 272.0 45 290.0 46 278.0 47 246.0 48 225.5 49 209.5 50 180.0 51 150.0 52 125.5 53 94.0 54 67.5 55 52.0 56 44.0 57 28.0 58 16.0 59 13.5 60 13.0 61 9.0 62 4.0 63 3.5 64 4.0 65 3.5 66 2.0 67 2.0 68 3.0 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.075 5 0.1 6 0.17500000000000002 7 0.22499999999999998 8 0.15 9 0.17500000000000002 10-14 0.12 15-19 0.15 20-24 0.11 25-29 0.034999999999999996 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.199999999999999 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.1125 0.0 0.0 0.0 0.0 138-139 6.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGAGG 10 0.006830828 145.0 1 >>END_MODULE Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885946 spots for SRR7172103.sra Written 885946 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra Read 885945 spots for SRR7172103.sra Written 885945 spots for SRR7172103.sra SRR ids: ['SRR7172103.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_acyu8r29 SRR7172103.sra spots: 17718901 blocks: [[1, 885945], [885946, 1771890], [1771891, 2657835], [2657836, 3543780], [3543781, 4429725], [4429726, 5315670], [5315671, 6201615], [6201616, 7087560], [7087561, 7973505], [7973506, 8859450], [8859451, 9745395], [9745396, 10631340], [10631341, 11517285], [11517286, 12403230], [12403231, 13289175], [13289176, 14175120], [14175121, 15061065], [15061066, 15947010], [15947011, 16832955], [16832956, 17718901]] SRR7172103 file size 5982653 SRR7172103 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172103 SRR7172103_1.fastq SRR7172103_2.fastq Input file: SRR7172103_1.fastq Paired file: SRR7172103_2.fastq trimmed: SRR7172103-trimmed-pair1.fastq, SRR7172103-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:03:01 2025 >> started Fri Feb 14 19:03:26 2025 >> done (24.330s) 17718901 read pairs processed; of these: 11602 ( 0.07%) short read pairs filtered out after trimming by size control 8579 ( 0.05%) empty read pairs filtered out after trimming by size control 17698720 (99.89%) read pairs available; of these: 9087293 (51.34%) trimmed read pairs available after processing 8611427 (48.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 6 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 7 0.00% 28 4 0.00% 29 3 0.00% 30 8 0.00% 31 2 0.00% 32 7 0.00% 33 8 0.00% 34 3 0.00% 35 6 0.00% 36 10 0.00% 37 9 0.00% 38 5 0.00% 39 2 0.00% 40 4 0.00% 41 4 0.00% 42 13 0.00% 43 15 0.00% 44 13 0.00% 45 12 0.00% 46 16 0.00% 47 23 0.00% 48 11 0.00% 49 17 0.00% 50 29 0.00% 51 21 0.00% 52 42 0.00% 53 35 0.00% 54 37 0.00% 55 53 0.00% 56 64 0.00% 57 64 0.00% 58 71 0.00% 59 82 0.00% 60 89 0.00% 61 113 0.00% 62 138 0.00% 63 170 0.00% 64 184 0.00% 65 173 0.00% 66 208 0.00% 67 272 0.00% 68 300 0.00% 69 344 0.00% 70 353 0.00% 71 454 0.00% 72 504 0.00% 73 659 0.00% 74 678 0.00% 75 826 0.00% 76 888 0.01% 77 970 0.01% 78 1211 0.01% 79 1342 0.01% 80 1562 0.01% 81 1725 0.01% 82 2047 0.01% 83 2384 0.01% 84 3254 0.02% 85 3953 0.02% 86 4462 0.03% 87 4888 0.03% 88 5274 0.03% 89 5446 0.03% 90 5746 0.03% 91 6154 0.03% 92 6650 0.04% 93 7290 0.04% 94 7853 0.04% 95 8606 0.05% 96 9454 0.05% 97 10037 0.06% 98 10610 0.06% 99 11364 0.06% 100 12386 0.07% 101 13038 0.07% 102 14037 0.08% 103 14728 0.08% 104 15732 0.09% 105 17092 0.10% 106 18077 0.10% 107 18935 0.11% 108 20016 0.11% 109 20561 0.12% 110 21989 0.12% 111 23060 0.13% 112 24011 0.14% 113 25003 0.14% 114 26335 0.15% 115 27836 0.16% 116 29490 0.17% 117 30657 0.17% 118 31618 0.18% 119 33001 0.19% 120 34197 0.19% 121 36181 0.20% 122 37695 0.21% 123 39084 0.22% 124 40940 0.23% 125 42446 0.24% 126 44815 0.25% 127 46889 0.26% 128 48055 0.27% 129 50901 0.29% 130 53241 0.30% 131 55883 0.32% 132 59530 0.34% 133 62241 0.35% 134 65448 0.37% 135 70441 0.40% 136 76953 0.43% 137 79698 0.45% 138 84032 0.47% 139 90955 0.51% 140 96593 0.55% 141 102561 0.58% 142 113564 0.64% 143 126544 0.71% 144 144553 0.82% 145 168723 0.95% 146 209337 1.18% 147 282285 1.59% 148 429671 2.43% 149 864326 4.88% 150 4862547 27.47% 151 8611427 48.66% 17698720 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=27 prefix-density=0.38 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=53.97 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=11.3 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGTGTCTGAGCTCTCGACCTCCAGAGTGATGGTCTT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.72 fanout-score-rank=16 prefix-density=0.63 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=150.54 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=17.0 sequence=GAGAAGAAATGGCATCTATCTGTCAAGGTAAGAGTTCATGGCC SRR7172103 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:04:28 Started mapping on | Feb 14 19:04:30 Finished on | Feb 14 19:07:05 Mapping speed, Million of reads per hour | 411.07 Number of input reads | 17698720 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16293435 Uniquely mapped reads % | 92.06% Average mapped length | 294.24 Number of splices: Total | 15633288 Number of splices: Annotated (sjdb) | 15355877 Number of splices: GT/AG | 15371016 Number of splices: GC/AG | 198578 Number of splices: AT/AC | 12002 Number of splices: Non-canonical | 51692 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.14 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514172 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 72891 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.48% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 904185 904185 904185 N_multimapping 514172 514172 514172 N_noFeature 377772 16120035 440895 N_ambiguous 189030 960 78244 UnstrandedReadsAssigned:15726633 PositiveStrandReadsAssigned:172440 NegativeStrandReadsAssigned:15774296 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172103 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172103-trimmed-pair1.fastq SRR7172103-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,698,720 reads, 15,662,675 reads pseudoaligned [quant] estimated average fragment length: 236.581 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7172103.ke.tsv 34699 SRR7172103.se.tsv 87100 total ==> SRR7172103.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.42 1457 45.6649 Potri.005G024800.1.v4.1 1035 799.419 794 55.4854 Potri.004G059700.1.v4.1 961 725.428 56 4.31247 Potri.007G009000.2.v4.1 1416 1180.42 0 0 Potri.003G141000.2.v4.1 2943 2707.42 601.168 12.4043 Potri.016G087400.1.v4.1 270 81.0578 1164.28 802.406 Potri.015G069301.1.v4.1 564 331.942 0 0 Potri.010G195200.1.v4.1 1773 1537.42 358 13.0084 Potri.012G127500.1.v4.1 977 741.428 9057 682.414 ==> SRR7172103.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 591 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 696 SRR7172103 completed mapping pipeline successfully