Starting /dee2/code/volunteer_pipeline.sh SRR7172104 current disk space = 3086229704704 free memory = 1490718776 SRR7172104 SRAfilesize 6c233fac3a8e0febc4ae28de847e43eb SRR7172104.sra SRR7172104.sra file validated SRR7172104 is paired end SRR7172104 is conventional basespace SRR7172104 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172104_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.511 33.0 32.0 33.0 25.0 34.0 2 31.6535 33.0 32.0 33.0 27.0 34.0 3 31.60025 33.0 31.0 33.0 28.0 34.0 4 31.83675 33.0 31.0 33.0 29.0 34.0 5 32.053 33.0 33.0 33.0 31.0 34.0 6 35.8975 37.0 36.0 38.0 33.0 38.0 7 36.29675 38.0 36.0 38.0 33.0 38.0 8 37.11175 38.0 38.0 38.0 36.0 38.0 9 37.20925 38.0 38.0 38.0 36.0 38.0 10-14 37.30624999999999 38.0 38.0 38.0 36.2 38.0 15-19 37.34245 38.0 38.0 38.0 36.4 38.0 20-24 37.419650000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.442400000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.367050000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.3375 38.0 38.0 38.0 37.0 38.0 40-44 37.310249999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.21745 38.0 38.0 38.0 36.2 38.0 50-54 37.1556 38.0 38.0 38.0 36.0 38.0 55-59 37.10334999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.9804 38.0 38.0 38.0 35.4 38.0 65-69 36.880900000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.82415 38.0 38.0 38.0 34.6 38.0 75-79 36.694399999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.634249999999994 38.0 38.0 38.0 34.0 38.0 85-89 36.49395 38.0 37.2 38.0 34.0 38.0 90-94 36.328199999999995 38.0 37.0 38.0 33.4 38.0 95-99 36.1709 38.0 37.0 38.0 33.2 38.0 100-104 36.056 38.0 37.0 38.0 32.8 38.0 105-109 35.69395 38.0 36.2 38.0 30.4 38.0 110-114 35.60005 38.0 36.0 38.0 30.6 38.0 115-119 35.50895 38.0 36.0 38.0 30.0 38.0 120-124 35.0859 38.0 35.2 38.0 28.0 38.0 125-129 34.90214999999999 38.0 35.0 38.0 27.8 38.0 130-134 34.568149999999996 38.0 35.0 38.0 26.4 38.0 135-139 34.20055000000001 38.0 34.2 38.0 23.8 38.0 140-144 33.54605 38.0 34.0 38.0 21.4 38.0 145-149 32.57885 37.6 33.0 38.0 14.0 38.0 150-151 28.674500000000002 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 2.0 19 1.0 20 4.0 21 2.0 22 6.0 23 9.0 24 6.0 25 12.0 26 15.0 27 21.0 28 22.0 29 30.0 30 50.0 31 80.0 32 100.0 33 146.0 34 217.0 35 496.0 36 1120.0 37 1659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.22987288135593 18.19385593220339 13.50635593220339 36.06991525423729 2 19.625 25.874999999999996 36.9 17.599999999999998 3 17.8 30.325000000000003 27.275 24.6 4 20.7 36.425000000000004 23.325000000000003 19.55 5 21.575 37.8 23.125 17.5 6 17.275 36.449999999999996 24.325 21.95 7 12.7 20.25 46.45 20.599999999999998 8 18.475 20.775 27.500000000000004 33.25 9 18.125 21.25 31.874999999999996 28.749999999999996 10-14 19.72 30.235 26.555 23.49 15-19 20.49 28.825 27.27 23.415 20-24 20.27 29.285 27.279999999999998 23.165 25-29 20.064999999999998 29.604999999999997 27.93 22.400000000000002 30-34 19.74 29.395 27.41 23.455000000000002 35-39 19.295 29.725 27.63 23.35 40-44 20.544999999999998 29.315 27.37 22.770000000000003 45-49 19.86 29.459999999999997 27.384999999999998 23.294999999999998 50-54 20.11 29.020000000000003 27.68 23.189999999999998 55-59 20.095 29.375 27.595 22.935 60-64 19.48 28.53 28.33 23.66 65-69 20.13 28.95 27.555000000000003 23.365 70-74 20.435 28.425 27.965 23.175 75-79 19.975 29.310000000000002 27.505000000000003 23.21 80-84 19.785 28.470000000000002 27.474999999999998 24.27 85-89 20.44 28.205000000000002 28.000000000000004 23.355 90-94 20.0 28.985 27.43 23.585 95-99 20.865000000000002 28.194999999999997 27.634999999999998 23.305 100-104 20.605 28.544999999999998 27.67 23.18 105-109 20.095 28.765 27.865000000000002 23.275000000000002 110-114 20.21 28.59 27.805000000000003 23.395 115-119 20.505000000000003 29.125 27.474999999999998 22.895 120-124 20.73 28.275 27.625 23.369999999999997 125-129 20.59 27.584999999999997 28.110000000000003 23.715 130-134 20.945 28.54 26.93 23.585 135-139 20.735 28.294999999999998 27.500000000000004 23.47 140-144 21.2 27.794999999999998 27.634999999999998 23.369999999999997 145-149 21.345 28.15 27.060000000000002 23.445 150-151 20.3 28.225 26.724999999999998 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 5.0 26 7.5 27 10.5 28 11.0 29 14.5 30 25.0 31 38.0 32 40.0 33 42.5 34 65.0 35 84.0 36 103.0 37 127.0 38 147.0 39 169.0 40 190.0 41 211.0 42 249.5 43 277.5 44 287.0 45 292.0 46 269.5 47 257.0 48 235.0 49 182.0 50 144.0 51 121.0 52 99.0 53 70.5 54 50.5 55 40.5 56 33.0 57 26.0 58 15.0 59 13.5 60 12.0 61 10.0 62 9.0 63 3.0 64 1.5 65 1.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.6000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0125 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.1 0.025 0.0 0.0 0.0 90-91 0.15 0.025 0.0 0.0 0.0 92-93 0.21250000000000002 0.025 0.0 0.0 0.0 94-95 0.225 0.025 0.0 0.0 0.0 96-97 0.35 0.025 0.0 0.0 0.0 98-99 0.5125 0.025 0.0 0.0 0.0 100-101 0.6 0.025 0.0 0.0 0.0 102-103 0.675 0.025 0.0 0.0 0.0 104-105 0.775 0.025 0.0 0.0 0.0 106-107 0.9 0.025 0.0 0.0 0.0 108-109 1.0625 0.025 0.0 0.0 0.0 110-111 1.2125 0.025 0.0 0.0 0.0 112-113 1.3875000000000002 0.025 0.0 0.0 0.0 114-115 1.6125 0.025 0.0 0.0 0.0 116-117 1.9 0.025 0.0 0.0 0.0 118-119 2.05 0.025 0.0 0.0 0.0 120-121 2.3125 0.025 0.0 0.0 0.0 122-123 2.5625 0.025 0.0 0.0 0.0 124-125 2.8125 0.025 0.0 0.0 0.0 126-127 3.1375 0.025 0.0 0.0 0.0 128-129 3.6 0.025 0.0 0.0 0.0 130-131 3.9875 0.025 0.0 0.0 0.0 132-133 4.4625 0.025 0.0 0.0 0.0 134-135 4.8125 0.025 0.0 0.0 0.0 136-137 5.325 0.025 0.0 0.0 0.0 138-139 5.7875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATGGT 10 0.005853838 152.57895 1 GGGACCC 10 0.0068378756 144.95 7 >>END_MODULE SRR7172104 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172104_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15425 33.0 33.0 34.0 33.0 34.0 2 33.2045 34.0 33.0 34.0 32.0 34.0 3 33.284 34.0 33.0 34.0 33.0 34.0 4 33.2735 34.0 33.0 34.0 33.0 34.0 5 33.287 34.0 33.0 34.0 33.0 34.0 6 37.463 38.0 38.0 38.0 37.0 38.0 7 37.52325 38.0 38.0 38.0 37.0 38.0 8 37.54975 38.0 38.0 38.0 38.0 38.0 9 37.5305 38.0 38.0 38.0 38.0 38.0 10-14 37.487199999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.4808 38.0 38.0 38.0 37.6 38.0 20-24 37.452999999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.403999999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.34395 38.0 38.0 38.0 37.0 38.0 35-39 37.2224 38.0 38.0 38.0 36.8 38.0 40-44 37.306650000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.30265000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.2359 38.0 38.0 38.0 37.0 38.0 55-59 37.21025 38.0 38.0 38.0 36.4 38.0 60-64 37.203649999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.095299999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.018299999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.8926 38.0 38.0 38.0 35.4 38.0 80-84 36.7971 38.0 38.0 38.0 35.0 38.0 85-89 36.747550000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.62910000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.45505 38.0 38.0 38.0 34.0 38.0 100-104 36.412549999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.2993 38.0 37.4 38.0 34.0 38.0 110-114 36.0373 38.0 37.0 38.0 33.0 38.0 115-119 35.853049999999996 38.0 36.8 38.0 32.0 38.0 120-124 35.59845 38.0 36.0 38.0 30.6 38.0 125-129 35.22375 38.0 36.0 38.0 28.8 38.0 130-134 34.98405 38.0 35.2 38.0 28.0 38.0 135-139 34.61685 38.0 35.0 38.0 26.8 38.0 140-144 34.007799999999996 38.0 34.4 38.0 23.2 38.0 145-149 33.05944999999999 38.0 33.4 38.0 18.6 38.0 150-151 28.941499999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 3.0 18 2.0 19 2.0 20 2.0 21 6.0 22 8.0 23 8.0 24 5.0 25 9.0 26 18.0 27 16.0 28 19.0 29 32.0 30 46.0 31 55.0 32 71.0 33 103.0 34 183.0 35 321.0 36 759.0 37 2323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.449999999999996 15.375 16.375 31.8 2 25.074999999999996 22.175 34.175 18.575 3 20.5 25.900000000000002 31.55 22.05 4 23.549999999999997 35.55 20.925 19.975 5 22.900000000000002 37.1 21.7 18.3 6 17.8 38.1 23.925 20.175 7 17.325 14.424999999999999 46.725 21.525 8 19.775000000000002 20.775 28.95 30.5 9 20.724999999999998 22.925 29.799999999999997 26.55 10-14 23.01 28.52 26.590000000000003 21.88 15-19 22.74 28.360000000000003 27.685 21.215 20-24 22.795 28.24 27.63 21.335 25-29 22.91 27.735 28.144999999999996 21.21 30-34 22.07 28.384999999999998 28.705000000000002 20.84 35-39 23.145 27.805000000000003 28.189999999999998 20.86 40-44 23.335 28.105000000000004 27.905 20.655 45-49 22.395 28.705000000000002 27.735 21.165 50-54 23.085 27.894999999999996 28.275 20.745 55-59 22.935 27.860000000000003 28.63 20.575 60-64 23.09 28.199999999999996 27.800000000000004 20.91 65-69 23.075000000000003 28.065 28.015 20.845 70-74 23.04 27.839999999999996 27.76 21.36 75-79 23.330000000000002 27.82 28.15 20.7 80-84 22.99 27.839999999999996 28.634999999999998 20.535 85-89 23.445 27.92 28.705000000000002 19.93 90-94 23.255 27.76 28.384999999999998 20.599999999999998 95-99 23.625 28.12 27.435 20.82 100-104 23.625 28.549999999999997 27.435 20.39 105-109 23.04 28.65 27.800000000000004 20.51 110-114 22.74 28.655 28.349999999999998 20.255000000000003 115-119 24.08 27.93 27.800000000000004 20.19 120-124 23.549999999999997 27.884999999999998 28.37 20.195 125-129 23.635 27.644999999999996 28.205000000000002 20.515 130-134 23.62 27.42 28.439999999999998 20.52 135-139 23.935000000000002 27.915 27.57 20.580000000000002 140-144 24.83 27.815 27.834999999999997 19.52 145-149 24.705 27.389999999999997 27.91 19.994999999999997 150-151 25.2 27.2625 26.987499999999997 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 2.0 26 2.5 27 3.5 28 6.5 29 9.5 30 11.0 31 15.0 32 26.0 33 40.5 34 52.0 35 58.0 36 77.5 37 115.0 38 141.0 39 156.5 40 195.5 41 228.5 42 252.0 43 277.5 44 289.0 45 294.5 46 266.5 47 249.5 48 247.0 49 224.5 50 183.5 51 134.0 52 107.5 53 85.5 54 62.5 55 44.0 56 35.0 57 28.5 58 18.0 59 13.0 60 11.0 61 8.5 62 6.0 63 3.5 64 3.0 65 2.5 66 1.0 67 1.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4524886877828055 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.3625 0.0 0.0 0.0 0.0 138-139 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCAG 10 0.006830828 145.0 8 CCATATT 10 0.006830828 145.0 2 >>END_MODULE Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586579 spots for SRR7172104.sra Written 586579 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra Read 586566 spots for SRR7172104.sra Written 586566 spots for SRR7172104.sra SRR ids: ['SRR7172104.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pigrk9x6 SRR7172104.sra spots: 11731333 blocks: [[1, 586566], [586567, 1173132], [1173133, 1759698], [1759699, 2346264], [2346265, 2932830], [2932831, 3519396], [3519397, 4105962], [4105963, 4692528], [4692529, 5279094], [5279095, 5865660], [5865661, 6452226], [6452227, 7038792], [7038793, 7625358], [7625359, 8211924], [8211925, 8798490], [8798491, 9385056], [9385057, 9971622], [9971623, 10558188], [10558189, 11144754], [11144755, 11731333]] SRR7172104 file size 3953663 SRR7172104 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172104 SRR7172104_1.fastq SRR7172104_2.fastq Input file: SRR7172104_1.fastq Paired file: SRR7172104_2.fastq trimmed: SRR7172104-trimmed-pair1.fastq, SRR7172104-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:19:35 2025 >> started Fri Feb 14 05:19:49 2025 >> done (14.121s) 11731333 read pairs processed; of these: 5067 ( 0.04%) short read pairs filtered out after trimming by size control 3619 ( 0.03%) empty read pairs filtered out after trimming by size control 11722647 (99.93%) read pairs available; of these: 7538583 (64.31%) trimmed read pairs available after processing 4184064 (35.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 7 0.00% 23 2 0.00% 24 3 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 1 0.00% 30 2 0.00% 31 6 0.00% 32 3 0.00% 33 3 0.00% 34 2 0.00% 35 6 0.00% 36 2 0.00% 37 5 0.00% 38 4 0.00% 39 9 0.00% 40 3 0.00% 41 5 0.00% 42 7 0.00% 43 9 0.00% 44 7 0.00% 45 10 0.00% 46 11 0.00% 47 9 0.00% 48 14 0.00% 49 14 0.00% 50 20 0.00% 51 21 0.00% 52 33 0.00% 53 30 0.00% 54 39 0.00% 55 42 0.00% 56 34 0.00% 57 53 0.00% 58 54 0.00% 59 66 0.00% 60 70 0.00% 61 83 0.00% 62 85 0.00% 63 109 0.00% 64 113 0.00% 65 125 0.00% 66 135 0.00% 67 155 0.00% 68 211 0.00% 69 222 0.00% 70 239 0.00% 71 280 0.00% 72 326 0.00% 73 390 0.00% 74 452 0.00% 75 572 0.00% 76 592 0.01% 77 683 0.01% 78 729 0.01% 79 816 0.01% 80 927 0.01% 81 1191 0.01% 82 1372 0.01% 83 1479 0.01% 84 1886 0.02% 85 2283 0.02% 86 2454 0.02% 87 2903 0.02% 88 3216 0.03% 89 3354 0.03% 90 3538 0.03% 91 3909 0.03% 92 4366 0.04% 93 4728 0.04% 94 5100 0.04% 95 5789 0.05% 96 6044 0.05% 97 6619 0.06% 98 6958 0.06% 99 7499 0.06% 100 8240 0.07% 101 8768 0.07% 102 9562 0.08% 103 10195 0.09% 104 10931 0.09% 105 11743 0.10% 106 12545 0.11% 107 13190 0.11% 108 13893 0.12% 109 14618 0.12% 110 15604 0.13% 111 16187 0.14% 112 16930 0.14% 113 18561 0.16% 114 19462 0.17% 115 20792 0.18% 116 21312 0.18% 117 23009 0.20% 118 23347 0.20% 119 24519 0.21% 120 25340 0.22% 121 27391 0.23% 122 28411 0.24% 123 30113 0.26% 124 31247 0.27% 125 33768 0.29% 126 35443 0.30% 127 37172 0.32% 128 39415 0.34% 129 41960 0.36% 130 44845 0.38% 131 47650 0.41% 132 50566 0.43% 133 55043 0.47% 134 58745 0.50% 135 63554 0.54% 136 68946 0.59% 137 75199 0.64% 138 82809 0.71% 139 91745 0.78% 140 102155 0.87% 141 115582 0.99% 142 134405 1.15% 143 157112 1.34% 144 189664 1.62% 145 235725 2.01% 146 306057 2.61% 147 418006 3.57% 148 625554 5.34% 149 1071446 9.14% 150 2817552 24.04% 151 4184064 35.69% 11722647 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=6.41 fanout-score-rank=13 prefix-density=0.52 prefix-fanout=3.5 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=49.32 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.9 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=36 prefix-density=0.37 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=34.11 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.5 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172104 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:20:41 Started mapping on | Feb 14 05:20:42 Finished on | Feb 14 05:22:24 Mapping speed, Million of reads per hour | 413.74 Number of input reads | 11722647 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10920459 Uniquely mapped reads % | 93.16% Average mapped length | 292.31 Number of splices: Total | 10604824 Number of splices: Annotated (sjdb) | 10423691 Number of splices: GT/AG | 10436004 Number of splices: GC/AG | 134589 Number of splices: AT/AC | 7833 Number of splices: Non-canonical | 26398 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305994 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 38383 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502312 502312 502312 N_multimapping 305994 305994 305994 N_noFeature 295205 10814813 344577 N_ambiguous 110476 567 53968 UnstrandedReadsAssigned:10514778 PositiveStrandReadsAssigned:105079 NegativeStrandReadsAssigned:10521914 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172104 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172104-trimmed-pair1.fastq SRR7172104-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,722,647 reads, 10,438,705 reads pseudoaligned [quant] estimated average fragment length: 235.611 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 990 rounds 52401 SRR7172104.ke.tsv 34699 SRR7172104.se.tsv 87100 total ==> SRR7172104.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.39 505 26.3443 Potri.005G024800.1.v4.1 1035 800.389 129 14.9944 Potri.004G059700.1.v4.1 961 726.394 13 1.665 Potri.007G009000.2.v4.1 1416 1181.39 0 0 Potri.003G141000.2.v4.1 2943 2708.39 326.12 11.2023 Potri.016G087400.1.v4.1 270 80.6282 736.488 849.807 Potri.015G069301.1.v4.1 564 332.539 0 0 Potri.010G195200.1.v4.1 1773 1538.39 166.503 10.0693 Potri.012G127500.1.v4.1 977 742.389 3532 442.62 ==> SRR7172104.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1190 Potri.001G452600.v4.1 119 SRR7172104 completed mapping pipeline successfully