Starting /dee2/code/volunteer_pipeline.sh SRR7172105 current disk space = 3085573668864 free memory = 1580031516 SRR7172105 SRAfilesize 26d1f6f4a95b8189d1414c08a46f3bbd SRR7172105.sra SRR7172105.sra file validated SRR7172105 is paired end SRR7172105 is conventional basespace SRR7172105 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172105_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5905 33.0 33.0 34.0 32.0 34.0 2 32.99675 34.0 33.0 34.0 31.0 34.0 3 32.7185 33.0 33.0 34.0 32.0 34.0 4 33.2255 33.0 33.0 34.0 32.0 34.0 5 33.304 34.0 33.0 34.0 33.0 34.0 6 36.66975 38.0 37.0 38.0 34.0 38.0 7 37.3475 38.0 38.0 38.0 36.0 38.0 8 37.58275 38.0 38.0 38.0 37.0 38.0 9 37.69325 38.0 38.0 38.0 38.0 38.0 10-14 37.69605 38.0 38.0 38.0 38.0 38.0 15-19 37.70895 38.0 38.0 38.0 38.0 38.0 20-24 37.73725 38.0 38.0 38.0 38.0 38.0 25-29 37.704350000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.651599999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.631899999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.59085 38.0 38.0 38.0 38.0 38.0 45-49 37.566500000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.48675 38.0 38.0 38.0 37.8 38.0 55-59 37.4416 38.0 38.0 38.0 37.0 38.0 60-64 37.3836 38.0 38.0 38.0 37.0 38.0 65-69 37.307050000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.362 38.0 38.0 38.0 37.0 38.0 75-79 37.20805 38.0 38.0 38.0 36.6 38.0 80-84 37.209999999999994 38.0 38.0 38.0 36.2 38.0 85-89 37.160849999999996 38.0 38.0 38.0 36.0 38.0 90-94 37.000800000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.8849 38.0 38.0 38.0 35.4 38.0 100-104 36.776050000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.55875 38.0 38.0 38.0 34.2 38.0 110-114 36.478300000000004 38.0 38.0 38.0 34.2 38.0 115-119 36.307100000000005 38.0 37.6 38.0 33.8 38.0 120-124 36.267399999999995 38.0 37.8 38.0 34.0 38.0 125-129 35.98795 38.0 37.0 38.0 32.6 38.0 130-134 35.77015 38.0 36.4 38.0 32.2 38.0 135-139 35.379200000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.283 38.0 36.0 38.0 30.6 38.0 145-149 34.7433 38.0 35.0 38.0 28.6 38.0 150-151 31.373250000000002 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 3.0 17 2.0 18 1.0 19 1.0 20 4.0 21 3.0 22 4.0 23 3.0 24 6.0 25 8.0 26 7.0 27 8.0 28 11.0 29 14.0 30 27.0 31 32.0 32 57.0 33 67.0 34 110.0 35 183.0 36 702.0 37 2743.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 17.778361344537817 15.283613445378153 38.813025210084035 2 17.733866933466732 25.68784392196098 38.3191595797899 18.25912956478239 3 18.4 28.575 26.224999999999998 26.8 4 21.5 38.2 20.125 20.175 5 18.35 39.925 23.05 18.675 6 15.475 36.35 27.025 21.15 7 12.825000000000001 19.15 47.55 20.474999999999998 8 17.525 22.35 29.049999999999997 31.075000000000003 9 17.974999999999998 22.5 31.874999999999996 27.650000000000002 10-14 19.48 30.680000000000003 26.32 23.52 15-19 19.115 29.455 27.800000000000004 23.630000000000003 20-24 19.41 29.925 27.16 23.505000000000003 25-29 19.095000000000002 29.945 27.655 23.305 30-34 19.275000000000002 29.595 27.43 23.7 35-39 19.395 29.335 28.144999999999996 23.125 40-44 19.72 29.65 26.875 23.755000000000003 45-49 19.505 29.15 27.544999999999998 23.799999999999997 50-54 20.34 29.255 27.555000000000003 22.85 55-59 19.78 28.95 27.375 23.895 60-64 19.905 28.775000000000002 28.035 23.285 65-69 19.735 29.59 27.33 23.345 70-74 19.675 28.73 28.185 23.41 75-79 20.305 29.015 26.924999999999997 23.755000000000003 80-84 19.8 28.915000000000003 27.529999999999998 23.755000000000003 85-89 19.965 28.810000000000002 28.199999999999996 23.025000000000002 90-94 20.255000000000003 28.51 28.110000000000003 23.125 95-99 20.369999999999997 28.34 28.225 23.064999999999998 100-104 20.125 28.689999999999998 28.155 23.03 105-109 20.035 28.48 27.83 23.655 110-114 20.560000000000002 28.42 27.76 23.26 115-119 20.474999999999998 28.76 27.62 23.145 120-124 20.330000000000002 28.175 27.834999999999997 23.66 125-129 21.099999999999998 28.365000000000002 26.99 23.544999999999998 130-134 20.580000000000002 28.249999999999996 28.08 23.09 135-139 20.474999999999998 28.215 27.694999999999997 23.615 140-144 20.985 28.050000000000004 27.224999999999998 23.74 145-149 20.825 28.544999999999998 26.895000000000003 23.735 150-151 19.900000000000002 28.075 27.725 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 2.5 25 3.5 26 8.0 27 11.5 28 11.0 29 22.5 30 32.5 31 36.0 32 39.0 33 52.5 34 62.5 35 79.0 36 108.5 37 133.5 38 163.5 39 181.0 40 195.0 41 222.0 42 250.5 43 273.5 44 287.5 45 291.5 46 272.0 47 235.0 48 202.0 49 175.0 50 149.0 51 119.5 52 94.0 53 74.5 54 54.0 55 35.0 56 24.5 57 19.5 58 16.5 59 11.0 60 9.0 61 9.5 62 5.5 63 1.5 64 3.0 65 5.0 66 3.0 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.725 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.3625 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 5.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCCCT 10 0.0056249425 154.6 1 CTTCAGT 10 0.0068396386 144.9375 7 >>END_MODULE SRR7172105 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172105_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3885 34.0 33.0 34.0 33.0 34.0 2 33.455 34.0 33.0 34.0 33.0 34.0 3 33.459 34.0 33.0 34.0 33.0 34.0 4 33.5025 34.0 33.0 34.0 33.0 34.0 5 33.49025 34.0 33.0 34.0 33.0 34.0 6 37.60725 38.0 38.0 38.0 38.0 38.0 7 37.647 38.0 38.0 38.0 38.0 38.0 8 37.64 38.0 38.0 38.0 38.0 38.0 9 37.64375 38.0 38.0 38.0 38.0 38.0 10-14 37.61635 38.0 38.0 38.0 38.0 38.0 15-19 37.60515 38.0 38.0 38.0 38.0 38.0 20-24 37.587900000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.576649999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.5544 38.0 38.0 38.0 38.0 38.0 35-39 37.4914 38.0 38.0 38.0 38.0 38.0 40-44 37.4841 38.0 38.0 38.0 38.0 38.0 45-49 37.45565 38.0 38.0 38.0 38.0 38.0 50-54 37.43235 38.0 38.0 38.0 37.6 38.0 55-59 37.38075 38.0 38.0 38.0 37.2 38.0 60-64 37.327749999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.2863 38.0 38.0 38.0 37.0 38.0 70-74 37.261900000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.11345 38.0 38.0 38.0 36.4 38.0 80-84 37.104949999999995 38.0 38.0 38.0 36.4 38.0 85-89 37.016200000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.943999999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.84315 38.0 38.0 38.0 35.8 38.0 100-104 36.875150000000005 38.0 38.0 38.0 35.6 38.0 105-109 36.7509 38.0 38.0 38.0 35.2 38.0 110-114 36.6222 38.0 38.0 38.0 34.6 38.0 115-119 36.5089 38.0 38.0 38.0 34.4 38.0 120-124 36.289300000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.031150000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.7782 38.0 36.4 38.0 32.4 38.0 135-139 35.4557 38.0 36.0 38.0 31.0 38.0 140-144 35.123949999999994 38.0 36.0 38.0 30.0 38.0 145-149 34.60065 38.0 35.2 38.0 28.6 38.0 150-151 30.91825 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 4.0 17 2.0 18 0.0 19 0.0 20 1.0 21 8.0 22 1.0 23 6.0 24 6.0 25 15.0 26 8.0 27 15.0 28 20.0 29 23.0 30 22.0 31 40.0 32 44.0 33 53.0 34 81.0 35 205.0 36 537.0 37 2901.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.074999999999996 13.375 18.95 34.599999999999994 2 23.225 22.575 37.775 16.425 3 21.425 25.55 31.65 21.375 4 24.05 34.425 21.175 20.349999999999998 5 23.549999999999997 37.325 21.65 17.474999999999998 6 16.875 38.725 25.474999999999998 18.925 7 17.4 15.375 45.95 21.275 8 20.65 22.225 28.349999999999998 28.775000000000002 9 22.95 23.3 28.199999999999996 25.55 10-14 23.04 28.005000000000003 26.674999999999997 22.28 15-19 22.825 28.23 28.395 20.549999999999997 20-24 23.765 27.99 27.834999999999997 20.41 25-29 22.725 27.950000000000003 28.470000000000002 20.855 30-34 22.875 28.925 27.55 20.65 35-39 22.74 28.185 27.415 21.66 40-44 23.64 27.755000000000003 27.79 20.815 45-49 23.665 28.04 28.12 20.175 50-54 23.54 27.85 28.185 20.424999999999997 55-59 23.935000000000002 27.345000000000002 28.53 20.19 60-64 23.68 27.675 28.389999999999997 20.255000000000003 65-69 23.29 28.335 27.560000000000002 20.815 70-74 23.825 27.845 28.07 20.26 75-79 23.685000000000002 28.63 27.189999999999998 20.495 80-84 23.59 28.075 28.18 20.155 85-89 23.89 27.944999999999997 27.96 20.205000000000002 90-94 23.724999999999998 27.700000000000003 28.465 20.11 95-99 23.89 28.095 27.915 20.1 100-104 23.485 28.34 27.785 20.39 105-109 23.93 27.389999999999997 28.07 20.61 110-114 23.43 27.644999999999996 28.42 20.505000000000003 115-119 23.34 28.22 28.044999999999998 20.395 120-124 23.46 27.32 28.435 20.785 125-129 23.95 27.88 28.02 20.150000000000002 130-134 23.95 28.28 28.055000000000003 19.715 135-139 24.525 28.09 28.02 19.365 140-144 24.845 28.255000000000003 27.51 19.39 145-149 24.490000000000002 27.735 28.27 19.505 150-151 24.7 27.925 28.7 18.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 4.5 28 6.5 29 8.5 30 11.5 31 13.5 32 20.0 33 30.5 34 48.0 35 57.5 36 74.0 37 111.0 38 140.0 39 167.5 40 189.5 41 222.5 42 274.0 43 306.0 44 306.0 45 285.5 46 266.0 47 250.0 48 232.5 49 213.5 50 182.0 51 149.5 52 114.5 53 80.5 54 55.0 55 40.0 56 33.5 57 24.5 58 19.0 59 13.5 60 12.0 61 9.0 62 6.0 63 4.5 64 2.0 65 3.5 66 2.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72403411941796 99.375 2 0.2508780732563974 0.5 3 0.0 0.0 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.95 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.65 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5999999999999996 0.0 0.0 0.0 0.0 132-133 3.9000000000000004 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGAA 10 0.006830828 145.0 1 GTGTCAG 10 0.006830828 145.0 6 ACTTGAT 10 0.006830828 145.0 5 ACATCCA 10 0.006830828 145.0 4 >>END_MODULE Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481350 spots for SRR7172105.sra Written 481350 spots for SRR7172105.sra Read 481356 spots for SRR7172105.sra Written 481356 spots for SRR7172105.sra SRR ids: ['SRR7172105.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ih0tge6 SRR7172105.sra spots: 9627006 blocks: [[1, 481350], [481351, 962700], [962701, 1444050], [1444051, 1925400], [1925401, 2406750], [2406751, 2888100], [2888101, 3369450], [3369451, 3850800], [3850801, 4332150], [4332151, 4813500], [4813501, 5294850], [5294851, 5776200], [5776201, 6257550], [6257551, 6738900], [6738901, 7220250], [7220251, 7701600], [7701601, 8182950], [8182951, 8664300], [8664301, 9145650], [9145651, 9627006]] SRR7172105 file size 3241304 SRR7172105 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172105 SRR7172105_1.fastq SRR7172105_2.fastq Input file: SRR7172105_1.fastq Paired file: SRR7172105_2.fastq trimmed: SRR7172105-trimmed-pair1.fastq, SRR7172105-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:57:24 2025 >> started Fri Feb 14 05:57:35 2025 >> done (10.491s) 9627006 read pairs processed; of these: 6039 ( 0.06%) short read pairs filtered out after trimming by size control 5234 ( 0.05%) empty read pairs filtered out after trimming by size control 9615733 (99.88%) read pairs available; of these: 4637360 (48.23%) trimmed read pairs available after processing 4978373 (51.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 4 0.00% 31 0 0.00% 32 4 0.00% 33 3 0.00% 34 2 0.00% 35 2 0.00% 36 3 0.00% 37 4 0.00% 38 3 0.00% 39 7 0.00% 40 4 0.00% 41 9 0.00% 42 4 0.00% 43 6 0.00% 44 3 0.00% 45 5 0.00% 46 7 0.00% 47 7 0.00% 48 6 0.00% 49 9 0.00% 50 10 0.00% 51 15 0.00% 52 11 0.00% 53 23 0.00% 54 12 0.00% 55 25 0.00% 56 26 0.00% 57 25 0.00% 58 21 0.00% 59 38 0.00% 60 41 0.00% 61 53 0.00% 62 57 0.00% 63 54 0.00% 64 66 0.00% 65 71 0.00% 66 93 0.00% 67 98 0.00% 68 114 0.00% 69 130 0.00% 70 146 0.00% 71 190 0.00% 72 211 0.00% 73 218 0.00% 74 259 0.00% 75 323 0.00% 76 456 0.00% 77 488 0.01% 78 373 0.00% 79 507 0.01% 80 552 0.01% 81 632 0.01% 82 722 0.01% 83 959 0.01% 84 1193 0.01% 85 1526 0.02% 86 1664 0.02% 87 1879 0.02% 88 2135 0.02% 89 2190 0.02% 90 2338 0.02% 91 2542 0.03% 92 2756 0.03% 93 2939 0.03% 94 3364 0.03% 95 3657 0.04% 96 3968 0.04% 97 4316 0.04% 98 4540 0.05% 99 4956 0.05% 100 5325 0.06% 101 5675 0.06% 102 6343 0.07% 103 6676 0.07% 104 7288 0.08% 105 7949 0.08% 106 8406 0.09% 107 8982 0.09% 108 9428 0.10% 109 10160 0.11% 110 10785 0.11% 111 11226 0.12% 112 11854 0.12% 113 12324 0.13% 114 13193 0.14% 115 13935 0.14% 116 14874 0.15% 117 15811 0.16% 118 16295 0.17% 119 17009 0.18% 120 17748 0.18% 121 18325 0.19% 122 19383 0.20% 123 20356 0.21% 124 20922 0.22% 125 22349 0.23% 126 23429 0.24% 127 24880 0.26% 128 25734 0.27% 129 26906 0.28% 130 27917 0.29% 131 29516 0.31% 132 31226 0.32% 133 32947 0.34% 134 34350 0.36% 135 36169 0.38% 136 37655 0.39% 137 40261 0.42% 138 43003 0.45% 139 45741 0.48% 140 49503 0.51% 141 53575 0.56% 142 58826 0.61% 143 65483 0.68% 144 76135 0.79% 145 90898 0.95% 146 114801 1.19% 147 160492 1.67% 148 257240 2.68% 149 538972 5.61% 150 2325986 24.19% 151 4978373 51.77% 9615733 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=29 prefix-density=0.87 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=12 fanout-score=28.78 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=9.5 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGT criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=30 prefix-density=0.85 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=97.46 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.2 sequence=TTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGATC SRR7172105 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:58:23 Started mapping on | Feb 14 05:58:24 Finished on | Feb 14 05:59:40 Mapping speed, Million of reads per hour | 455.48 Number of input reads | 9615733 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9030231 Uniquely mapped reads % | 93.91% Average mapped length | 294.83 Number of splices: Total | 8294933 Number of splices: Annotated (sjdb) | 8110284 Number of splices: GT/AG | 8156220 Number of splices: GC/AG | 104528 Number of splices: AT/AC | 6935 Number of splices: Non-canonical | 27250 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260444 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 32345 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 331060 331060 331060 N_multimapping 260444 260444 260444 N_noFeature 273142 8930158 310818 N_ambiguous 107724 615 45128 UnstrandedReadsAssigned:8649365 PositiveStrandReadsAssigned:99458 NegativeStrandReadsAssigned:8674285 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172105 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172105-trimmed-pair1.fastq SRR7172105-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,615,733 reads, 8,584,029 reads pseudoaligned [quant] estimated average fragment length: 238.477 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7172105.ke.tsv 34699 SRR7172105.se.tsv 87100 total ==> SRR7172105.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.52 915 50.4129 Potri.005G024800.1.v4.1 1035 797.523 199 24.4781 Potri.004G059700.1.v4.1 961 723.528 8 1.08468 Potri.007G009000.2.v4.1 1416 1178.52 0 0 Potri.003G141000.2.v4.1 2943 2705.52 385.274 13.9697 Potri.016G087400.1.v4.1 270 79.1366 582.541 722.133 Potri.015G069301.1.v4.1 564 330.08 0 0 Potri.010G195200.1.v4.1 1773 1535.52 567.911 36.2821 Potri.012G127500.1.v4.1 977 739.528 8729 1157.92 ==> SRR7172105.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 611 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 379 SRR7172105 completed mapping pipeline successfully