Starting /dee2/code/volunteer_pipeline.sh SRR7172106 current disk space = 3111434600448 free memory = 1486580744 SRR7172106 SRAfilesize 78c4f2e4449e474ddfedeb5a0eb4a08a SRR7172106.sra SRR7172106.sra file validated SRR7172106 is paired end SRR7172106 is conventional basespace SRR7172106 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172106_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17075 33.0 33.0 34.0 30.0 34.0 2 32.744 33.0 33.0 34.0 31.0 34.0 3 32.89925 34.0 33.0 34.0 31.0 34.0 4 32.64625 33.0 33.0 33.0 32.0 34.0 5 32.797 33.0 33.0 34.0 32.0 34.0 6 36.80875 38.0 37.0 38.0 34.0 38.0 7 37.22025 38.0 38.0 38.0 36.0 38.0 8 37.503 38.0 38.0 38.0 37.0 38.0 9 37.64425 38.0 38.0 38.0 38.0 38.0 10-14 37.64535 38.0 38.0 38.0 38.0 38.0 15-19 37.64265 38.0 38.0 38.0 38.0 38.0 20-24 37.603100000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.5595 38.0 38.0 38.0 38.0 38.0 30-34 37.5052 38.0 38.0 38.0 37.6 38.0 35-39 37.48755 38.0 38.0 38.0 37.6 38.0 40-44 37.48195 38.0 38.0 38.0 37.0 38.0 45-49 37.43065 38.0 38.0 38.0 37.2 38.0 50-54 37.314249999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.253699999999995 38.0 38.0 38.0 36.4 38.0 60-64 37.1535 38.0 38.0 38.0 36.0 38.0 65-69 37.0728 38.0 38.0 38.0 36.0 38.0 70-74 36.98965 38.0 38.0 38.0 36.0 38.0 75-79 36.9546 38.0 38.0 38.0 35.6 38.0 80-84 36.848850000000006 38.0 38.0 38.0 35.2 38.0 85-89 36.73375 38.0 38.0 38.0 34.8 38.0 90-94 36.626999999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.550599999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.38095 38.0 37.6 38.0 34.0 38.0 105-109 36.22465 38.0 37.0 38.0 33.8 38.0 110-114 36.0084 38.0 37.0 38.0 33.0 38.0 115-119 35.91175 38.0 37.0 38.0 32.6 38.0 120-124 35.66475 38.0 36.4 38.0 31.0 38.0 125-129 35.3607 38.0 36.0 38.0 30.2 38.0 130-134 35.0972 38.0 35.6 38.0 28.2 38.0 135-139 34.7763 38.0 35.0 38.0 27.8 38.0 140-144 34.07505 38.0 34.2 38.0 24.0 38.0 145-149 33.561049999999994 38.0 34.0 38.0 20.8 38.0 150-151 30.122374999999998 36.5 28.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 5.0 22 5.0 23 8.0 24 8.0 25 10.0 26 12.0 27 15.0 28 18.0 29 17.0 30 41.0 31 42.0 32 72.0 33 85.0 34 139.0 35 328.0 36 963.0 37 2217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.709762532981532 16.6754617414248 14.300791556728232 39.31398416886543 2 17.079269817454364 27.656914228557138 37.184296074018505 18.079519879969993 3 17.4 31.025000000000002 26.875 24.7 4 20.075000000000003 37.0 21.65 21.275 5 19.525000000000002 37.3 24.05 19.125 6 15.525 37.525 26.775 20.175 7 11.25 21.475 46.625 20.65 8 18.575 20.95 28.749999999999996 31.724999999999998 9 17.25 21.65 31.900000000000002 29.2 10-14 19.17 30.28 25.990000000000002 24.560000000000002 15-19 19.785 29.865000000000002 27.185 23.165 20-24 19.545 29.080000000000002 27.815 23.56 25-29 19.245 29.685 27.750000000000004 23.32 30-34 19.515 28.735 27.88 23.87 35-39 19.744999999999997 29.175 27.685 23.395 40-44 19.67 29.599999999999998 27.175 23.555 45-49 19.535 29.14 27.76 23.565 50-54 19.725 28.810000000000002 28.325 23.14 55-59 19.75 29.335 27.605 23.31 60-64 19.855 29.17 27.43 23.544999999999998 65-69 19.925 29.285 27.375 23.415 70-74 20.13 28.24 27.834999999999997 23.794999999999998 75-79 20.395 28.634999999999998 27.71 23.26 80-84 20.355 29.29 27.685 22.67 85-89 19.945 28.595 28.044999999999998 23.415 90-94 20.630000000000003 28.65 27.38 23.34 95-99 20.185 29.13 27.715 22.97 100-104 19.96 29.32 28.025 22.695 105-109 20.485 29.24 27.395000000000003 22.88 110-114 20.315 29.349999999999998 27.63 22.705000000000002 115-119 20.685000000000002 28.875 27.800000000000004 22.64 120-124 20.27 28.410000000000004 27.985 23.335 125-129 20.375 27.950000000000003 28.395 23.28 130-134 20.775 28.605000000000004 27.415 23.205000000000002 135-139 20.405 28.110000000000003 27.595 23.89 140-144 20.845 28.799999999999997 27.089999999999996 23.265 145-149 20.665 28.825 26.724999999999998 23.785 150-151 20.6625 29.125 26.450000000000003 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 2.0 22 3.5 23 4.0 24 4.5 25 4.0 26 3.0 27 5.5 28 13.5 29 19.0 30 23.5 31 28.5 32 36.5 33 51.0 34 67.5 35 85.0 36 106.0 37 139.0 38 148.0 39 170.5 40 210.5 41 243.5 42 262.0 43 264.5 44 270.0 45 265.0 46 277.5 47 248.0 48 194.0 49 180.0 50 150.0 51 115.5 52 96.5 53 64.5 54 54.5 55 59.0 56 39.5 57 22.0 58 18.0 59 13.5 60 9.5 61 7.0 62 4.0 63 2.5 64 2.0 65 1.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.25 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.6000000000000001 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.7875 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.4 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACTT 10 0.0060887975 150.61038 1 >>END_MODULE SRR7172106 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172106_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.191 34.0 33.0 34.0 33.0 34.0 2 33.25 34.0 33.0 34.0 33.0 34.0 3 33.3125 34.0 33.0 34.0 33.0 34.0 4 33.293 34.0 33.0 34.0 33.0 34.0 5 33.32825 34.0 33.0 34.0 33.0 34.0 6 37.441 38.0 38.0 38.0 38.0 38.0 7 37.5295 38.0 38.0 38.0 38.0 38.0 8 37.53125 38.0 38.0 38.0 38.0 38.0 9 37.493 38.0 38.0 38.0 38.0 38.0 10-14 37.4723 38.0 38.0 38.0 37.8 38.0 15-19 37.443650000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.4334 38.0 38.0 38.0 37.4 38.0 25-29 37.41045 38.0 38.0 38.0 37.0 38.0 30-34 37.36805 38.0 38.0 38.0 37.0 38.0 35-39 37.30625 38.0 38.0 38.0 37.0 38.0 40-44 37.28765 38.0 38.0 38.0 37.0 38.0 45-49 37.208 38.0 38.0 38.0 36.8 38.0 50-54 37.20815 38.0 38.0 38.0 36.8 38.0 55-59 37.133500000000005 38.0 38.0 38.0 36.2 38.0 60-64 37.051249999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.0301 38.0 38.0 38.0 36.0 38.0 70-74 36.87505 38.0 38.0 38.0 35.4 38.0 75-79 36.834 38.0 38.0 38.0 35.4 38.0 80-84 36.724599999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.66095 38.0 38.0 38.0 34.8 38.0 90-94 36.54345 38.0 38.0 38.0 34.4 38.0 95-99 36.36925 38.0 38.0 38.0 34.0 38.0 100-104 36.170249999999996 38.0 37.4 38.0 33.4 38.0 105-109 36.05965 38.0 37.0 38.0 33.0 38.0 110-114 35.8678 38.0 37.0 38.0 32.2 38.0 115-119 35.72 38.0 36.8 38.0 31.0 38.0 120-124 35.3822 38.0 36.0 38.0 29.8 38.0 125-129 35.06615000000001 38.0 35.4 38.0 28.6 38.0 130-134 34.73715 38.0 35.0 38.0 27.6 38.0 135-139 34.44295 38.0 35.0 38.0 25.8 38.0 140-144 34.04540000000001 38.0 34.6 38.0 23.4 38.0 145-149 33.298199999999994 38.0 34.0 38.0 18.8 38.0 150-151 28.819125 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 3.0 17 1.0 18 3.0 19 4.0 20 4.0 21 7.0 22 5.0 23 5.0 24 16.0 25 16.0 26 19.0 27 20.0 28 32.0 29 35.0 30 40.0 31 60.0 32 72.0 33 86.0 34 157.0 35 293.0 36 778.0 37 2336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.699999999999996 14.625 16.125 33.550000000000004 2 22.675 23.325000000000003 38.0 16.0 3 20.45 25.8 30.075000000000003 23.674999999999997 4 24.55 34.25 20.875 20.325 5 23.05 38.025 22.1 16.825000000000003 6 17.224999999999998 36.625 26.075 20.075000000000003 7 16.8 16.5 44.25 22.45 8 19.900000000000002 20.5 29.175 30.425 9 21.099999999999998 22.55 30.049999999999997 26.3 10-14 23.265 28.34 26.195 22.2 15-19 22.795 28.02 28.08 21.105 20-24 23.05 27.76 27.91 21.279999999999998 25-29 22.48 28.199999999999996 27.925 21.395 30-34 22.43 27.800000000000004 27.944999999999997 21.825 35-39 22.775000000000002 28.08 28.15 20.995 40-44 22.685 27.884999999999998 28.605000000000004 20.825 45-49 22.56 27.575 28.4 21.465 50-54 22.865 27.935 28.310000000000002 20.89 55-59 22.6 28.22 28.139999999999997 21.04 60-64 22.615 28.595 27.544999999999998 21.245 65-69 23.23 28.07 28.01 20.69 70-74 23.46 27.875 27.85 20.815 75-79 23.115 28.305000000000003 28.000000000000004 20.580000000000002 80-84 23.435 27.900000000000002 27.92 20.745 85-89 23.155 28.115000000000002 28.485 20.244999999999997 90-94 23.185 27.694999999999997 28.54 20.580000000000002 95-99 23.52 28.060000000000002 28.52 19.900000000000002 100-104 23.73 27.584999999999997 28.575 20.11 105-109 23.669999999999998 27.750000000000004 28.349999999999998 20.23 110-114 23.195 28.634999999999998 28.299999999999997 19.869999999999997 115-119 23.919999999999998 27.665 28.505000000000003 19.91 120-124 24.125 27.815 27.79 20.27 125-129 23.52 27.82 28.345 20.315 130-134 23.990000000000002 28.095 28.01 19.905 135-139 23.96 28.48 27.975 19.585 140-144 24.18 27.900000000000002 27.744999999999997 20.175 145-149 24.529999999999998 28.265 27.0 20.205000000000002 150-151 24.9875 27.3375 28.299999999999997 19.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 2.0 20 2.0 21 1.5 22 1.5 23 1.0 24 0.5 25 0.0 26 2.0 27 4.0 28 6.0 29 9.5 30 15.0 31 23.0 32 31.5 33 40.0 34 50.0 35 61.0 36 79.5 37 102.0 38 132.0 39 169.5 40 199.5 41 232.5 42 260.5 43 267.5 44 275.5 45 293.0 46 283.0 47 250.5 48 224.0 49 201.5 50 168.0 51 136.5 52 109.5 53 90.0 54 75.5 55 52.5 56 37.0 57 26.0 58 20.5 59 16.0 60 11.5 61 8.0 62 6.5 63 6.5 64 4.0 65 2.0 66 0.5 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.6499999999999999 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.85 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.475 0.0 0.0 0.0 0.0 134-135 3.7750000000000004 0.0 0.0 0.0 0.0 136-137 4.237500000000001 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525415 spots for SRR7172106.sra Written 525415 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra Read 525404 spots for SRR7172106.sra Written 525404 spots for SRR7172106.sra SRR ids: ['SRR7172106.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dmnoq3ph SRR7172106.sra spots: 10508091 blocks: [[1, 525404], [525405, 1050808], [1050809, 1576212], [1576213, 2101616], [2101617, 2627020], [2627021, 3152424], [3152425, 3677828], [3677829, 4203232], [4203233, 4728636], [4728637, 5254040], [5254041, 5779444], [5779445, 6304848], [6304849, 6830252], [6830253, 7355656], [7355657, 7881060], [7881061, 8406464], [8406465, 8931868], [8931869, 9457272], [9457273, 9982676], [9982677, 10508091]] SRR7172106 file size 3539146 SRR7172106 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172106 SRR7172106_1.fastq SRR7172106_2.fastq Input file: SRR7172106_1.fastq Paired file: SRR7172106_2.fastq trimmed: SRR7172106-trimmed-pair1.fastq, SRR7172106-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:08:49 2025 >> started Fri Feb 14 17:09:02 2025 >> done (13.639s) 10508091 read pairs processed; of these: 3788 ( 0.04%) short read pairs filtered out after trimming by size control 2901 ( 0.03%) empty read pairs filtered out after trimming by size control 10501402 (99.94%) read pairs available; of these: 6128427 (58.36%) trimmed read pairs available after processing 4372975 (41.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 2 0.00% 24 5 0.00% 25 4 0.00% 26 0 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 2 0.00% 31 3 0.00% 32 0 0.00% 33 2 0.00% 34 2 0.00% 35 3 0.00% 36 5 0.00% 37 2 0.00% 38 8 0.00% 39 8 0.00% 40 8 0.00% 41 4 0.00% 42 7 0.00% 43 7 0.00% 44 6 0.00% 45 9 0.00% 46 17 0.00% 47 8 0.00% 48 18 0.00% 49 10 0.00% 50 8 0.00% 51 20 0.00% 52 19 0.00% 53 20 0.00% 54 29 0.00% 55 36 0.00% 56 35 0.00% 57 36 0.00% 58 31 0.00% 59 52 0.00% 60 49 0.00% 61 59 0.00% 62 69 0.00% 63 86 0.00% 64 96 0.00% 65 98 0.00% 66 116 0.00% 67 143 0.00% 68 143 0.00% 69 180 0.00% 70 189 0.00% 71 208 0.00% 72 283 0.00% 73 267 0.00% 74 324 0.00% 75 392 0.00% 76 434 0.00% 77 500 0.00% 78 537 0.01% 79 583 0.01% 80 690 0.01% 81 770 0.01% 82 982 0.01% 83 1118 0.01% 84 1398 0.01% 85 1584 0.02% 86 1759 0.02% 87 2018 0.02% 88 2254 0.02% 89 2379 0.02% 90 2550 0.02% 91 2708 0.03% 92 3162 0.03% 93 3373 0.03% 94 3688 0.04% 95 3992 0.04% 96 4403 0.04% 97 4649 0.04% 98 4958 0.05% 99 5395 0.05% 100 5694 0.05% 101 6256 0.06% 102 6725 0.06% 103 7257 0.07% 104 7835 0.07% 105 8441 0.08% 106 8905 0.08% 107 9504 0.09% 108 9945 0.09% 109 10672 0.10% 110 11231 0.11% 111 11632 0.11% 112 12624 0.12% 113 13275 0.13% 114 14213 0.14% 115 15184 0.14% 116 15961 0.15% 117 16657 0.16% 118 17296 0.16% 119 18099 0.17% 120 19114 0.18% 121 20175 0.19% 122 21276 0.20% 123 22368 0.21% 124 23830 0.23% 125 25227 0.24% 126 26610 0.25% 127 28282 0.27% 128 29868 0.28% 129 31656 0.30% 130 33538 0.32% 131 35929 0.34% 132 38564 0.37% 133 40932 0.39% 134 44056 0.42% 135 46975 0.45% 136 50869 0.48% 137 54975 0.52% 138 59578 0.57% 139 64476 0.61% 140 71481 0.68% 141 79638 0.76% 142 91359 0.87% 143 106595 1.02% 144 127293 1.21% 145 159156 1.52% 146 208430 1.98% 147 295494 2.81% 148 466291 4.44% 149 865374 8.24% 150 2652577 25.26% 151 4372975 41.64% 10501402 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=19 prefix-density=0.33 prefix-fanout=2.5 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=65.03 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.7 sequence=GAAAATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=25 prefix-density=0.31 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=114.22 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.5 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATT SRR7172106 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:09:55 Started mapping on | Feb 14 17:09:55 Finished on | Feb 14 17:11:35 Mapping speed, Million of reads per hour | 378.05 Number of input reads | 10501402 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9719333 Uniquely mapped reads % | 92.55% Average mapped length | 293.93 Number of splices: Total | 9641732 Number of splices: Annotated (sjdb) | 9477046 Number of splices: GT/AG | 9480733 Number of splices: GC/AG | 127300 Number of splices: AT/AC | 6613 Number of splices: Non-canonical | 27086 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319486 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 29938 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 467304 467304 467304 N_multimapping 319486 319486 319486 N_noFeature 278074 9619774 330850 N_ambiguous 100096 634 52911 UnstrandedReadsAssigned:9341163 PositiveStrandReadsAssigned:98925 NegativeStrandReadsAssigned:9335572 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172106 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172106-trimmed-pair1.fastq SRR7172106-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,501,402 reads, 9,277,748 reads pseudoaligned [quant] estimated average fragment length: 246.788 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7172106.ke.tsv 34699 SRR7172106.se.tsv 87100 total ==> SRR7172106.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.21 635 36.3348 Potri.005G024800.1.v4.1 1035 789.212 189 24.2847 Potri.004G059700.1.v4.1 961 715.247 20 2.83556 Potri.007G009000.2.v4.1 1416 1170.21 0 0 Potri.003G141000.2.v4.1 2943 2697.21 366.168 13.7667 Potri.016G087400.1.v4.1 270 76.6818 769 1016.95 Potri.015G069301.1.v4.1 564 322.684 0 0 Potri.010G195200.1.v4.1 1773 1527.21 251.869 16.724 Potri.012G127500.1.v4.1 977 731.227 3044 422.14 ==> SRR7172106.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 155 SRR7172106 completed mapping pipeline successfully