Starting /dee2/code/volunteer_pipeline.sh SRR7172107 current disk space = 3086029565952 free memory = 1485899692 SRR7172107 SRAfilesize d83bc5b3a2fec4360379a7e80fe32513 SRR7172107.sra SRR7172107.sra file validated SRR7172107 is paired end SRR7172107 is conventional basespace SRR7172107 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172107_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.55675 33.0 32.0 33.0 27.0 34.0 2 32.55475 33.0 33.0 34.0 30.0 34.0 3 31.17225 33.0 31.0 33.0 27.0 33.0 4 31.4115 33.0 32.0 33.0 28.0 33.0 5 31.939 33.0 32.0 33.0 31.0 33.0 6 35.6635 37.0 35.0 38.0 31.0 38.0 7 36.4425 38.0 37.0 38.0 34.0 38.0 8 36.88475 38.0 37.0 38.0 35.0 38.0 9 37.26175 38.0 38.0 38.0 36.0 38.0 10-14 37.3591 38.0 38.0 38.0 36.6 38.0 15-19 37.375750000000004 38.0 38.0 38.0 36.6 38.0 20-24 37.45784999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.52605 38.0 38.0 38.0 37.6 38.0 30-34 37.44735 38.0 38.0 38.0 37.0 38.0 35-39 37.48435 38.0 38.0 38.0 37.0 38.0 40-44 37.4679 38.0 38.0 38.0 37.0 38.0 45-49 37.42705 38.0 38.0 38.0 37.0 38.0 50-54 37.3266 38.0 38.0 38.0 37.0 38.0 55-59 37.2183 38.0 38.0 38.0 36.2 38.0 60-64 37.06725 38.0 38.0 38.0 36.0 38.0 65-69 37.05155 38.0 38.0 38.0 36.0 38.0 70-74 36.9927 38.0 38.0 38.0 35.8 38.0 75-79 36.93045 38.0 38.0 38.0 35.2 38.0 80-84 36.8597 38.0 38.0 38.0 35.0 38.0 85-89 36.71105 38.0 38.0 38.0 34.4 38.0 90-94 36.557 38.0 38.0 38.0 34.0 38.0 95-99 36.52105 38.0 38.0 38.0 34.0 38.0 100-104 36.33585000000001 38.0 37.2 38.0 34.0 38.0 105-109 36.071850000000005 38.0 37.0 38.0 33.2 38.0 110-114 35.9148 38.0 37.0 38.0 31.8 38.0 115-119 35.70285 38.0 36.6 38.0 31.0 38.0 120-124 35.5728 38.0 36.0 38.0 30.4 38.0 125-129 35.22095 38.0 35.8 38.0 29.0 38.0 130-134 35.01915 38.0 35.6 38.0 28.0 38.0 135-139 34.5184 38.0 35.0 38.0 27.0 38.0 140-144 33.87310000000001 38.0 34.0 38.0 23.0 38.0 145-149 33.255100000000006 38.0 34.0 38.0 18.8 38.0 150-151 29.5855 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 3.0 16 1.0 17 3.0 18 5.0 19 6.0 20 3.0 21 4.0 22 2.0 23 3.0 24 5.0 25 10.0 26 6.0 27 17.0 28 16.0 29 22.0 30 43.0 31 62.0 32 82.0 33 87.0 34 203.0 35 400.0 36 1037.0 37 1977.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.835956255001335 18.591624433182183 12.616697786076287 33.955721525740195 2 19.759879939969984 26.313156578289142 34.892446223111556 19.034517258629315 3 17.675 30.925000000000004 27.950000000000003 23.45 4 20.25 36.875 23.3 19.575 5 20.125 38.0 23.275000000000002 18.6 6 16.425 35.975 24.95 22.650000000000002 7 12.925 19.225 47.449999999999996 20.4 8 17.625 20.974999999999998 28.625 32.775 9 16.7 23.125 31.55 28.625 10-14 19.384999999999998 29.995 26.55 24.07 15-19 19.42 28.645 27.845 24.09 20-24 19.580000000000002 29.01 28.505000000000003 22.905 25-29 20.5 29.315 27.46 22.725 30-34 19.77 29.360000000000003 27.83 23.04 35-39 19.34 28.549999999999997 28.685 23.425 40-44 20.0 29.39 28.255000000000003 22.355 45-49 19.650000000000002 28.465 28.035 23.849999999999998 50-54 19.725 28.715000000000003 28.225 23.335 55-59 19.64 29.065 28.08 23.215 60-64 20.23 28.205000000000002 28.03 23.535 65-69 19.939999999999998 28.77 28.22 23.07 70-74 20.29 28.544999999999998 27.48 23.685000000000002 75-79 19.765 28.87 27.725 23.64 80-84 20.255000000000003 28.595 27.675 23.474999999999998 85-89 19.91 28.49 28.33 23.27 90-94 20.16 27.76 28.665000000000003 23.415 95-99 19.785 29.15 27.639999999999997 23.425 100-104 20.19 28.605000000000004 27.834999999999997 23.369999999999997 105-109 20.815 28.249999999999996 27.905 23.03 110-114 20.150000000000002 28.68 28.294999999999998 22.875 115-119 20.75 28.675 27.38 23.195 120-124 20.645 28.435 27.639999999999997 23.28 125-129 20.435 28.12 28.09 23.355 130-134 20.575 28.485 27.750000000000004 23.189999999999998 135-139 20.48 28.435 27.355 23.73 140-144 20.794999999999998 28.265 27.325 23.615 145-149 20.53 28.38 27.195000000000004 23.895 150-151 20.724999999999998 28.199999999999996 26.85 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 3.5 26 9.0 27 14.0 28 14.0 29 18.5 30 27.0 31 32.0 32 38.0 33 46.0 34 64.5 35 89.5 36 109.0 37 131.5 38 161.5 39 183.5 40 207.5 41 239.5 42 249.5 43 259.0 44 271.5 45 258.0 46 250.5 47 246.0 48 207.5 49 164.0 50 150.5 51 141.0 52 108.5 53 75.5 54 62.5 55 47.0 56 28.5 57 20.5 58 18.0 59 12.5 60 6.5 61 5.5 62 5.0 63 4.0 64 1.5 65 1.5 66 2.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.275 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.3499999999999996 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCAG 10 0.006841402 144.925 9 TCAAGGC 10 0.006841402 144.925 2 ATCCACA 10 0.006841402 144.925 6 TTCCTCA 10 0.006841402 144.925 8 ACGGCGA 10 0.006841402 144.925 7 >>END_MODULE SRR7172107 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172107_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23925 34.0 33.0 34.0 33.0 34.0 2 33.32825 34.0 33.0 34.0 33.0 34.0 3 33.31225 34.0 33.0 34.0 33.0 34.0 4 33.34525 34.0 33.0 34.0 33.0 34.0 5 33.33375 34.0 33.0 34.0 33.0 34.0 6 37.4585 38.0 38.0 38.0 38.0 38.0 7 37.54475 38.0 38.0 38.0 38.0 38.0 8 37.576 38.0 38.0 38.0 38.0 38.0 9 37.527 38.0 38.0 38.0 38.0 38.0 10-14 37.48735 38.0 38.0 38.0 38.0 38.0 15-19 37.49405 38.0 38.0 38.0 38.0 38.0 20-24 37.498949999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.462 38.0 38.0 38.0 37.4 38.0 30-34 37.43175 38.0 38.0 38.0 37.8 38.0 35-39 37.35565 38.0 38.0 38.0 37.0 38.0 40-44 37.3756 38.0 38.0 38.0 37.2 38.0 45-49 37.3374 38.0 38.0 38.0 37.2 38.0 50-54 37.34035 38.0 38.0 38.0 37.0 38.0 55-59 37.25195 38.0 38.0 38.0 37.0 38.0 60-64 37.2394 38.0 38.0 38.0 37.0 38.0 65-69 37.183249999999994 38.0 38.0 38.0 36.6 38.0 70-74 37.074799999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.04205 38.0 38.0 38.0 36.0 38.0 80-84 36.9385 38.0 38.0 38.0 36.0 38.0 85-89 36.878249999999994 38.0 38.0 38.0 35.6 38.0 90-94 36.829750000000004 38.0 38.0 38.0 35.2 38.0 95-99 36.6395 38.0 38.0 38.0 34.6 38.0 100-104 36.5149 38.0 38.0 38.0 34.0 38.0 105-109 36.34035 38.0 37.8 38.0 34.0 38.0 110-114 36.21660000000001 38.0 38.0 38.0 33.4 38.0 115-119 36.043400000000005 38.0 37.2 38.0 33.0 38.0 120-124 35.75985 38.0 36.8 38.0 31.8 38.0 125-129 35.57215 38.0 36.0 38.0 31.0 38.0 130-134 35.1717 38.0 36.0 38.0 29.4 38.0 135-139 34.9246 38.0 35.0 38.0 28.0 38.0 140-144 34.5596 38.0 35.0 38.0 27.0 38.0 145-149 33.78005 38.0 34.2 38.0 23.4 38.0 150-151 29.7955 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 3.0 19 2.0 20 5.0 21 6.0 22 8.0 23 8.0 24 4.0 25 13.0 26 14.0 27 23.0 28 21.0 29 28.0 30 27.0 31 46.0 32 51.0 33 95.0 34 143.0 35 267.0 36 687.0 37 2541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.925 15.1 16.525000000000002 29.45 2 24.875 23.025000000000002 34.35 17.75 3 20.849999999999998 26.724999999999998 31.55 20.875 4 23.974999999999998 36.75 20.625 18.65 5 22.475 37.6 22.15 17.775 6 18.475 36.775000000000006 24.474999999999998 20.275000000000002 7 16.05 15.725 45.5 22.725 8 20.3 21.775 27.725 30.2 9 21.925 22.925 28.275 26.875 10-14 22.935 27.794999999999998 26.985 22.285 15-19 22.66 27.96 28.34 21.04 20-24 22.400000000000002 28.49 27.894999999999996 21.215 25-29 23.635 28.13 28.015 20.22 30-34 23.015 27.925 27.950000000000003 21.11 35-39 22.38 28.194999999999997 28.03 21.395 40-44 23.015 28.315 27.88 20.79 45-49 22.78 28.125 27.68 21.415 50-54 23.03 28.255000000000003 27.875 20.84 55-59 22.919999999999998 28.015 28.28 20.785 60-64 23.080000000000002 27.755000000000003 28.549999999999997 20.615 65-69 22.975 28.08 28.060000000000002 20.885 70-74 22.825 28.065 28.294999999999998 20.815 75-79 23.195 28.01 28.54 20.255000000000003 80-84 23.195 27.985 28.17 20.65 85-89 23.07 28.68 27.195000000000004 21.055 90-94 23.45 28.38 27.825 20.345 95-99 23.34 28.21 27.750000000000004 20.7 100-104 23.36 27.76 27.900000000000002 20.979999999999997 105-109 23.39 28.310000000000002 28.005000000000003 20.294999999999998 110-114 23.674999999999997 28.625 27.900000000000002 19.8 115-119 24.035 27.55 28.225 20.19 120-124 23.385 28.07 27.985 20.560000000000002 125-129 23.89 28.26 27.365000000000002 20.485 130-134 23.735 28.605000000000004 27.605 20.055 135-139 24.16 27.860000000000003 27.705000000000002 20.275000000000002 140-144 23.849999999999998 27.815 28.225 20.11 145-149 24.39 27.565 28.055000000000003 19.99 150-151 24.125 28.000000000000004 27.925 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 3.0 26 4.5 27 4.0 28 5.0 29 11.0 30 15.5 31 19.5 32 24.0 33 36.5 34 43.5 35 58.0 36 72.0 37 102.5 38 146.0 39 178.0 40 212.0 41 227.0 42 255.0 43 274.5 44 291.5 45 290.0 46 264.5 47 264.5 48 231.0 49 192.5 50 171.5 51 146.0 52 120.5 53 85.0 54 61.5 55 47.5 56 35.5 57 25.0 58 19.5 59 14.5 60 10.0 61 8.0 62 6.5 63 4.5 64 2.5 65 2.5 66 3.0 67 3.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138-139 4.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCCAT 10 0.006830828 145.0 9 >>END_MODULE Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra Read 549667 spots for SRR7172107.sra Written 549667 spots for SRR7172107.sra Read 549650 spots for SRR7172107.sra Written 549650 spots for SRR7172107.sra SRR ids: ['SRR7172107.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kfc7vor_ SRR7172107.sra spots: 10993017 blocks: [[1, 549650], [549651, 1099300], [1099301, 1648950], [1648951, 2198600], [2198601, 2748250], [2748251, 3297900], [3297901, 3847550], [3847551, 4397200], [4397201, 4946850], [4946851, 5496500], [5496501, 6046150], [6046151, 6595800], [6595801, 7145450], [7145451, 7695100], [7695101, 8244750], [8244751, 8794400], [8794401, 9344050], [9344051, 9893700], [9893701, 10443350], [10443351, 10993017]] SRR7172107 file size 3703472 SRR7172107 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172107 SRR7172107_1.fastq SRR7172107_2.fastq Input file: SRR7172107_1.fastq Paired file: SRR7172107_2.fastq trimmed: SRR7172107-trimmed-pair1.fastq, SRR7172107-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:29:01 2025 >> started Fri Feb 14 05:29:12 2025 >> done (11.483s) 10993017 read pairs processed; of these: 4488 ( 0.04%) short read pairs filtered out after trimming by size control 3061 ( 0.03%) empty read pairs filtered out after trimming by size control 10985468 (99.93%) read pairs available; of these: 6282594 (57.19%) trimmed read pairs available after processing 4702874 (42.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 6 0.00% 21 4 0.00% 22 4 0.00% 23 2 0.00% 24 3 0.00% 25 3 0.00% 26 3 0.00% 27 7 0.00% 28 2 0.00% 29 2 0.00% 30 2 0.00% 31 1 0.00% 32 0 0.00% 33 3 0.00% 34 5 0.00% 35 0 0.00% 36 3 0.00% 37 3 0.00% 38 3 0.00% 39 4 0.00% 40 5 0.00% 41 5 0.00% 42 5 0.00% 43 6 0.00% 44 6 0.00% 45 6 0.00% 46 8 0.00% 47 7 0.00% 48 9 0.00% 49 15 0.00% 50 15 0.00% 51 15 0.00% 52 15 0.00% 53 21 0.00% 54 16 0.00% 55 15 0.00% 56 33 0.00% 57 33 0.00% 58 36 0.00% 59 41 0.00% 60 50 0.00% 61 47 0.00% 62 64 0.00% 63 65 0.00% 64 65 0.00% 65 75 0.00% 66 100 0.00% 67 108 0.00% 68 133 0.00% 69 168 0.00% 70 181 0.00% 71 196 0.00% 72 262 0.00% 73 283 0.00% 74 320 0.00% 75 361 0.00% 76 416 0.00% 77 442 0.00% 78 528 0.00% 79 592 0.01% 80 674 0.01% 81 746 0.01% 82 885 0.01% 83 1086 0.01% 84 1409 0.01% 85 1715 0.02% 86 1808 0.02% 87 2036 0.02% 88 2316 0.02% 89 2508 0.02% 90 2631 0.02% 91 2883 0.03% 92 3194 0.03% 93 3379 0.03% 94 3863 0.04% 95 4131 0.04% 96 4305 0.04% 97 4733 0.04% 98 4914 0.04% 99 5452 0.05% 100 5983 0.05% 101 6358 0.06% 102 6850 0.06% 103 7496 0.07% 104 8032 0.07% 105 8513 0.08% 106 9026 0.08% 107 9750 0.09% 108 10153 0.09% 109 10602 0.10% 110 11167 0.10% 111 12155 0.11% 112 12594 0.11% 113 13523 0.12% 114 14334 0.13% 115 15055 0.14% 116 15896 0.14% 117 16682 0.15% 118 16966 0.15% 119 17761 0.16% 120 19104 0.17% 121 19907 0.18% 122 21085 0.19% 123 21943 0.20% 124 23069 0.21% 125 24674 0.22% 126 26234 0.24% 127 27369 0.25% 128 28971 0.26% 129 30885 0.28% 130 32262 0.29% 131 34471 0.31% 132 36610 0.33% 133 39348 0.36% 134 42393 0.39% 135 45015 0.41% 136 48176 0.44% 137 52266 0.48% 138 56547 0.51% 139 62037 0.56% 140 68328 0.62% 141 77868 0.71% 142 89200 0.81% 143 104283 0.95% 144 127444 1.16% 145 158737 1.44% 146 209762 1.91% 147 300330 2.73% 148 478233 4.35% 149 894104 8.14% 150 2793543 25.43% 151 4702874 42.81% 10985468 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=31 prefix-density=0.28 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=13 fanout-score=13.62 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=3.3 sequence=TTGCAGCCACTGCCGCAC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.13 fanout-score-rank=14 prefix-density=0.44 prefix-fanout=3.2 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=27.37 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.1 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAAC SRR7172107 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:29:57 Started mapping on | Feb 14 05:29:57 Finished on | Feb 14 05:31:17 Mapping speed, Million of reads per hour | 494.35 Number of input reads | 10985468 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10298349 Uniquely mapped reads % | 93.75% Average mapped length | 294.26 Number of splices: Total | 10107199 Number of splices: Annotated (sjdb) | 9912847 Number of splices: GT/AG | 9940469 Number of splices: GC/AG | 129358 Number of splices: AT/AC | 7925 Number of splices: Non-canonical | 29447 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.33 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279360 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 32538 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 413659 413659 413659 N_multimapping 279360 279360 279360 N_noFeature 331078 10188105 386051 N_ambiguous 110438 511 54860 UnstrandedReadsAssigned:9856833 PositiveStrandReadsAssigned:109733 NegativeStrandReadsAssigned:9857438 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172107 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172107-trimmed-pair1.fastq SRR7172107-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,985,468 reads, 9,769,737 reads pseudoaligned [quant] estimated average fragment length: 246.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7172107.ke.tsv 34699 SRR7172107.se.tsv 87100 total ==> SRR7172107.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.34 718 39.049 Potri.005G024800.1.v4.1 1035 789.339 230 28.0864 Potri.004G059700.1.v4.1 961 715.388 15 2.02107 Potri.007G009000.2.v4.1 1416 1170.34 0 0 Potri.003G141000.2.v4.1 2943 2697.34 341.46 12.2022 Potri.016G087400.1.v4.1 270 76.8135 548.966 688.873 Potri.015G069301.1.v4.1 564 322.823 0 0 Potri.010G195200.1.v4.1 1773 1527.34 203.741 12.858 Potri.012G127500.1.v4.1 977 731.359 6370 839.539 ==> SRR7172107.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 167 SRR7172107 completed mapping pipeline successfully