Starting /dee2/code/volunteer_pipeline.sh SRR7172108 current disk space = 3086349074432 free memory = 1449528348 SRR7172108 SRAfilesize fc1e6456fc2f9ff08193361c516d658e SRR7172108.sra SRR7172108.sra file validated SRR7172108 is paired end SRR7172108 is conventional basespace SRR7172108 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172108_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.92975 18.0 18.0 27.0 18.0 32.0 2 28.73775 27.0 27.0 32.0 25.0 32.0 3 30.63975 32.0 31.0 33.0 27.0 33.0 4 32.00475 33.0 32.0 33.0 32.0 33.0 5 32.46125 33.0 33.0 33.0 32.0 33.0 6 36.94975 38.0 37.0 38.0 35.0 38.0 7 37.3045 38.0 38.0 38.0 37.0 38.0 8 37.5435 38.0 38.0 38.0 37.0 38.0 9 37.436 38.0 38.0 38.0 38.0 38.0 10-14 37.54404999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.50750000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.46900000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.45725 38.0 38.0 38.0 37.4 38.0 30-34 37.319 38.0 38.0 38.0 37.0 38.0 35-39 37.28315 38.0 38.0 38.0 37.0 38.0 40-44 37.24465 38.0 38.0 38.0 36.8 38.0 45-49 37.20085 38.0 38.0 38.0 36.8 38.0 50-54 37.39215 38.0 38.0 38.0 37.0 38.0 55-59 37.3359 38.0 38.0 38.0 37.0 38.0 60-64 37.2121 38.0 38.0 38.0 36.6 38.0 65-69 37.27284999999999 38.0 38.0 38.0 36.8 38.0 70-74 37.2024 38.0 38.0 38.0 36.4 38.0 75-79 37.00555 38.0 38.0 38.0 36.0 38.0 80-84 36.9472 38.0 38.0 38.0 36.0 38.0 85-89 36.87925 38.0 38.0 38.0 35.4 38.0 90-94 36.76825 38.0 38.0 38.0 35.0 38.0 95-99 36.626999999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.48415 38.0 38.0 38.0 34.0 38.0 105-109 36.44405 38.0 38.0 38.0 34.0 38.0 110-114 36.1485 38.0 37.4 38.0 33.4 38.0 115-119 36.068650000000005 38.0 37.0 38.0 33.2 38.0 120-124 35.77735 38.0 36.8 38.0 31.8 38.0 125-129 35.3793 38.0 36.0 38.0 31.0 38.0 130-134 35.33055 38.0 36.0 38.0 30.6 38.0 135-139 34.984700000000004 38.0 35.8 38.0 28.8 38.0 140-144 34.28635 38.0 34.0 38.0 25.4 38.0 145-149 33.661849999999994 38.0 33.2 38.0 22.0 38.0 150-151 28.372999999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 1.0 20 4.0 21 1.0 22 5.0 23 1.0 24 10.0 25 14.0 26 16.0 27 11.0 28 23.0 29 34.0 30 31.0 31 79.0 32 92.0 33 117.0 34 192.0 35 300.0 36 698.0 37 2361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.775 17.299999999999997 11.15 36.775000000000006 2 18.35 24.325 39.475 17.849999999999998 3 18.9 30.3 26.35 24.45 4 21.75 35.375 22.125 20.75 5 20.45 35.6 24.45 19.5 6 16.475 36.225 25.85 21.45 7 12.925 20.05 45.925 21.099999999999998 8 18.325 20.9 28.275 32.5 9 17.110552763819094 22.135678391959797 32.311557788944725 28.442211055276385 10-14 19.465 29.955 26.8 23.78 15-19 19.689999999999998 28.494999999999997 27.805000000000003 24.01 20-24 19.38 28.605000000000004 28.485 23.53 25-29 19.53 29.409999999999997 27.195000000000004 23.865 30-34 19.775000000000002 28.355000000000004 28.34 23.53 35-39 19.53 28.825 27.689999999999998 23.955000000000002 40-44 20.235 28.205000000000002 27.83 23.73 45-49 19.7 29.34 27.705000000000002 23.255 50-54 19.53 28.88 28.03 23.56 55-59 20.155 28.765 27.689999999999998 23.39 60-64 19.63 28.185 28.235 23.95 65-69 19.325 28.57 28.310000000000002 23.794999999999998 70-74 19.994999999999997 28.305000000000003 28.005000000000003 23.695 75-79 19.575 28.115000000000002 28.23 24.08 80-84 19.97 28.32 27.68 24.03 85-89 19.675 28.449999999999996 28.139999999999997 23.735 90-94 20.349999999999998 28.375 27.744999999999997 23.53 95-99 20.455000000000002 28.23 28.194999999999997 23.119999999999997 100-104 19.950000000000003 28.299999999999997 27.950000000000003 23.799999999999997 105-109 20.16 28.315 27.35 24.175 110-114 20.21644370960469 28.623678541009067 27.807004358935817 23.352873390450423 115-119 20.355 29.25 26.985 23.41 120-124 20.967015366134444 28.524951198758696 27.814204915160918 22.693828519945942 125-129 20.99198396793587 28.602204408817634 27.324649298597194 23.0811623246493 130-134 20.810000000000002 28.515 27.015 23.66 135-139 20.655 28.505000000000003 27.284999999999997 23.555 140-144 21.091054552727638 28.70143507175359 26.451322566128304 23.756187809390468 145-149 20.745 28.975 26.924999999999997 23.355 150-151 21.25 28.050000000000004 26.437500000000004 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.5 22 1.5 23 3.0 24 5.0 25 5.5 26 7.0 27 8.0 28 10.0 29 12.0 30 15.0 31 26.0 32 39.5 33 50.5 34 55.5 35 77.5 36 110.0 37 143.5 38 162.5 39 174.5 40 206.5 41 224.0 42 244.5 43 254.5 44 257.5 45 271.0 46 249.5 47 233.0 48 216.5 49 170.0 50 152.0 51 134.0 52 109.5 53 96.0 54 64.5 55 44.5 56 36.5 57 28.5 58 23.0 59 17.0 60 13.5 61 8.0 62 5.5 63 6.0 64 5.5 65 5.0 66 3.5 67 2.0 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.20500000000000002 115-119 0.0 120-124 0.105 125-129 0.2 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.699999999999999 0.0 0.0 0.0 0.0 136-137 5.125 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTAGC 10 0.006633489 146.40506 6 CATGCTT 10 0.006633489 146.40506 5 >>END_MODULE SRR7172108 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172108_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.873 33.0 33.0 34.0 32.0 34.0 2 32.991 34.0 33.0 34.0 32.0 34.0 3 33.12225 34.0 33.0 34.0 33.0 34.0 4 33.0285 34.0 33.0 34.0 33.0 34.0 5 33.06875 34.0 33.0 34.0 33.0 34.0 6 37.15475 38.0 38.0 38.0 37.0 38.0 7 37.18975 38.0 38.0 38.0 37.0 38.0 8 37.15825 38.0 38.0 38.0 37.0 38.0 9 37.1855 38.0 38.0 38.0 37.0 38.0 10-14 37.15455 38.0 38.0 38.0 37.0 38.0 15-19 37.1502 38.0 38.0 38.0 37.0 38.0 20-24 37.06555 38.0 38.0 38.0 36.8 38.0 25-29 37.00945 38.0 38.0 38.0 36.6 38.0 30-34 37.01795 38.0 38.0 38.0 36.8 38.0 35-39 36.956900000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.81505 38.0 38.0 38.0 35.8 38.0 45-49 36.88090000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.946749999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.88475 38.0 38.0 38.0 36.0 38.0 60-64 36.82705 38.0 38.0 38.0 36.0 38.0 65-69 36.66275 38.0 38.0 38.0 35.0 38.0 70-74 36.643499999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.5197 38.0 38.0 38.0 34.6 38.0 80-84 36.57 38.0 38.0 38.0 34.8 38.0 85-89 36.35755 38.0 38.0 38.0 34.0 38.0 90-94 36.236900000000006 38.0 38.0 38.0 33.8 38.0 95-99 36.06945 38.0 37.8 38.0 33.2 38.0 100-104 36.023849999999996 38.0 37.6 38.0 33.0 38.0 105-109 35.888999999999996 38.0 37.2 38.0 32.2 38.0 110-114 35.654349999999994 38.0 37.0 38.0 31.0 38.0 115-119 35.5416 38.0 37.0 38.0 30.6 38.0 120-124 35.271699999999996 38.0 36.6 38.0 30.0 38.0 125-129 34.96055 38.0 36.0 38.0 28.2 38.0 130-134 34.56635 38.0 35.4 38.0 26.6 38.0 135-139 33.94065 38.0 33.8 38.0 22.4 38.0 140-144 33.178200000000004 38.0 33.0 38.0 17.6 38.0 145-149 32.63695 38.0 33.0 38.0 11.8 38.0 150-151 27.1555 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 3.0 5 0.0 6 1.0 7 1.0 8 3.0 9 1.0 10 2.0 11 3.0 12 1.0 13 4.0 14 2.0 15 0.0 16 4.0 17 3.0 18 3.0 19 3.0 20 8.0 21 12.0 22 7.0 23 18.0 24 9.0 25 17.0 26 21.0 27 19.0 28 48.0 29 37.0 30 55.0 31 72.0 32 83.0 33 117.0 34 164.0 35 290.0 36 612.0 37 2366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.00501253132832 14.285714285714285 19.32330827067669 34.385964912280706 2 22.678347934918648 21.8523153942428 39.87484355444305 15.594493116395494 3 20.750938673341675 26.007509386733418 30.563204005006256 22.678347934918648 4 22.453066332916144 34.84355444305381 21.201501877346686 21.501877346683354 5 23.028785982478098 37.87234042553192 22.02753441802253 17.07133917396746 6 16.85871743486974 37.5751503006012 23.897795591182362 21.668336673346694 7 17.48496993987976 15.781563126252504 45.54108216432866 21.19238476953908 8 20.125156445556946 22.102628285356694 28.785982478097623 28.986232790988737 9 21.576971214017522 24.055068836045056 28.085106382978726 26.282853566958696 10-14 23.091173083662945 28.198067390977823 26.826215390777552 21.884544134581684 15-19 22.917814393749687 27.86097060149246 28.126408574147344 21.094806430610507 20-24 22.881016711698187 28.389872911037727 27.83448413889723 20.894626238366858 25-29 22.53 27.615000000000002 28.37 21.485000000000003 30-34 22.46 27.905 28.09 21.545 35-39 22.56 28.044999999999998 28.475 20.919999999999998 40-44 23.43 27.389999999999997 28.1 21.08 45-49 22.14 28.68 28.165000000000003 21.015 50-54 22.900000000000002 28.675 27.6 20.825 55-59 22.895 27.88 28.57 20.655 60-64 22.905 27.750000000000004 28.375 20.97 65-69 24.081020255063766 28.032008002000502 27.541885471367845 20.34508627156789 70-74 23.139627925585117 28.125625125025007 28.42068413682737 20.31406281256251 75-79 23.669467787114844 27.961184473789512 27.66606642657063 20.70328131252501 80-84 23.201960588176455 28.433530059017702 27.98839651895569 20.376112833850154 85-89 23.5008752188047 28.312078019504877 27.631907976994246 20.555138784696176 90-94 23.414365746298518 27.866146458583437 27.881152460984392 20.838335334133653 95-99 23.732119635890765 28.04341302390717 28.08342502750825 20.14104231269381 100-104 23.45 27.6 28.410000000000004 20.54 105-109 23.91 27.889999999999997 27.79 20.41 110-114 23.955000000000002 27.495000000000005 28.735 19.814999999999998 115-119 23.185 28.384999999999998 28.425 20.005 120-124 23.94739473947395 28.377837783778375 27.827782778277825 19.846984698469846 125-129 24.018602790418562 28.234235135270293 27.72415862379357 20.023003450517578 130-134 23.928374931225928 28.600010003501225 27.59465813034562 19.876956934927225 135-139 24.299859971994398 28.370674134826967 27.600520104020802 19.72894578915783 140-144 24.233635045256786 28.164224633695056 27.489123368505275 20.113016952542882 145-149 24.38 27.994999999999997 27.875 19.75 150-151 24.712500000000002 27.962500000000002 27.212500000000002 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 3.0 25 2.5 26 3.5 27 5.5 28 5.0 29 8.0 30 14.0 31 24.0 32 30.5 33 39.5 34 59.0 35 77.5 36 92.0 37 104.5 38 141.0 39 180.0 40 196.5 41 216.5 42 255.5 43 284.0 44 275.5 45 266.0 46 267.5 47 250.5 48 215.0 49 193.5 50 165.5 51 130.5 52 107.5 53 87.0 54 65.5 55 52.5 56 49.5 57 35.0 58 22.5 59 17.5 60 13.5 61 9.0 62 8.0 63 7.0 64 3.5 65 3.0 66 2.0 67 1.5 68 1.0 69 0.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.125 3 0.125 4 0.125 5 0.125 6 0.2 7 0.2 8 0.125 9 0.125 10-14 0.135 15-19 0.165 20-24 0.06999999999999999 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.025 70-74 0.02 75-79 0.04 80-84 0.03 85-89 0.025 90-94 0.04 95-99 0.03 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.015 130-134 0.034999999999999996 135-139 0.02 140-144 0.015 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138-139 5.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095065 spots for SRR7172108.sra Written 1095065 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra Read 1095061 spots for SRR7172108.sra Written 1095061 spots for SRR7172108.sra SRR ids: ['SRR7172108.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_avhqig_5 SRR7172108.sra spots: 21901224 blocks: [[1, 1095061], [1095062, 2190122], [2190123, 3285183], [3285184, 4380244], [4380245, 5475305], [5475306, 6570366], [6570367, 7665427], [7665428, 8760488], [8760489, 9855549], [9855550, 10950610], [10950611, 12045671], [12045672, 13140732], [13140733, 14235793], [14235794, 15330854], [15330855, 16425915], [16425916, 17520976], [17520977, 18616037], [18616038, 19711098], [19711099, 20806159], [20806160, 21901224]] SRR7172108 file size 7399905 SRR7172108 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172108 SRR7172108_1.fastq SRR7172108_2.fastq Input file: SRR7172108_1.fastq Paired file: SRR7172108_2.fastq trimmed: SRR7172108-trimmed-pair1.fastq, SRR7172108-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:16:00 2025 >> started Fri Feb 14 05:16:23 2025 >> done (23.694s) 21901224 read pairs processed; of these: 15454 ( 0.07%) short read pairs filtered out after trimming by size control 15489 ( 0.07%) empty read pairs filtered out after trimming by size control 21870281 (99.86%) read pairs available; of these: 12597941 (57.60%) trimmed read pairs available after processing 9272340 (42.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 6 0.00% 25 8 0.00% 26 9 0.00% 27 7 0.00% 28 7 0.00% 29 11 0.00% 30 0 0.00% 31 7 0.00% 32 5 0.00% 33 5 0.00% 34 5 0.00% 35 14 0.00% 36 9 0.00% 37 16 0.00% 38 11 0.00% 39 13 0.00% 40 12 0.00% 41 21 0.00% 42 15 0.00% 43 10 0.00% 44 13 0.00% 45 13 0.00% 46 18 0.00% 47 25 0.00% 48 34 0.00% 49 24 0.00% 50 46 0.00% 51 54 0.00% 52 36 0.00% 53 54 0.00% 54 55 0.00% 55 55 0.00% 56 70 0.00% 57 118 0.00% 58 198 0.00% 59 294 0.00% 60 235 0.00% 61 214 0.00% 62 174 0.00% 63 209 0.00% 64 202 0.00% 65 254 0.00% 66 303 0.00% 67 335 0.00% 68 338 0.00% 69 376 0.00% 70 462 0.00% 71 543 0.00% 72 613 0.00% 73 744 0.00% 74 810 0.00% 75 989 0.00% 76 1161 0.01% 77 1303 0.01% 78 1448 0.01% 79 1750 0.01% 80 1891 0.01% 81 2120 0.01% 82 2591 0.01% 83 3850 0.02% 84 5433 0.02% 85 5877 0.03% 86 5821 0.03% 87 6308 0.03% 88 6486 0.03% 89 6343 0.03% 90 6450 0.03% 91 7027 0.03% 92 7560 0.03% 93 7936 0.04% 94 8689 0.04% 95 9500 0.04% 96 9855 0.05% 97 10995 0.05% 98 11432 0.05% 99 12634 0.06% 100 14146 0.06% 101 14392 0.07% 102 14935 0.07% 103 15931 0.07% 104 17032 0.08% 105 18436 0.08% 106 19118 0.09% 107 20204 0.09% 108 21529 0.10% 109 22152 0.10% 110 23734 0.11% 111 24940 0.11% 112 26447 0.12% 113 28192 0.13% 114 29425 0.13% 115 31215 0.14% 116 32921 0.15% 117 34603 0.16% 118 36909 0.17% 119 38533 0.18% 120 40680 0.19% 121 42750 0.20% 122 44657 0.20% 123 47739 0.22% 124 50627 0.23% 125 53409 0.24% 126 56466 0.26% 127 60033 0.27% 128 63464 0.29% 129 66663 0.30% 130 70042 0.32% 131 74015 0.34% 132 78671 0.36% 133 82117 0.38% 134 86953 0.40% 135 92653 0.42% 136 100310 0.46% 137 105183 0.48% 138 113469 0.52% 139 124914 0.57% 140 140426 0.64% 141 152133 0.70% 142 172282 0.79% 143 198302 0.91% 144 233994 1.07% 145 276346 1.26% 146 357837 1.64% 147 493540 2.26% 148 725936 3.32% 149 1437783 6.57% 150 6317169 28.88% 151 9272340 42.40% 21870281 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=25 prefix-density=0.51 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=27.39 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=TTTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=26 prefix-density=0.53 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=149.16 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=17.4 sequence=TTGATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGG SRR7172108 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:17:13 Started mapping on | Feb 14 05:17:13 Finished on | Feb 14 05:21:09 Mapping speed, Million of reads per hour | 333.61 Number of input reads | 21870281 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19873036 Uniquely mapped reads % | 90.87% Average mapped length | 293.95 Number of splices: Total | 18700862 Number of splices: Annotated (sjdb) | 18324853 Number of splices: GT/AG | 18372299 Number of splices: GC/AG | 254772 Number of splices: AT/AC | 16638 Number of splices: Non-canonical | 57153 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.20 Insertion rate per base | 0.03% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 584891 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 59946 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.07% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1428879 1428879 1428879 N_multimapping 584891 584891 584891 N_noFeature 718688 19683280 810177 N_ambiguous 211617 1610 112268 UnstrandedReadsAssigned:18942731 PositiveStrandReadsAssigned:188146 NegativeStrandReadsAssigned:18950591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172108 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172108-trimmed-pair1.fastq SRR7172108-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,870,281 reads, 18,772,837 reads pseudoaligned [quant] estimated average fragment length: 248.938 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7172108.ke.tsv 34699 SRR7172108.se.tsv 87100 total ==> SRR7172108.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.06 2290 69.7013 Potri.005G024800.1.v4.1 1035 787.062 450 30.8033 Potri.004G059700.1.v4.1 961 713.093 35 2.64433 Potri.007G009000.2.v4.1 1416 1168.06 0 0 Potri.003G141000.2.v4.1 2943 2695.06 721.458 14.4223 Potri.016G087400.1.v4.1 270 76.8596 883 618.951 Potri.015G069301.1.v4.1 564 321.543 0 0 Potri.010G195200.1.v4.1 1773 1525.06 778.851 27.5144 Potri.012G127500.1.v4.1 977 729.073 11659 861.557 ==> SRR7172108.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 560 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 674 SRR7172108 completed mapping pipeline successfully