Starting /dee2/code/volunteer_pipeline.sh SRR7172109 current disk space = 3086267191296 free memory = 1017848820 SRR7172109 SRAfilesize d897e8fa71238d6a31eafad8dac11eac SRR7172109.sra SRR7172109.sra file validated SRR7172109 is paired end SRR7172109 is conventional basespace SRR7172109 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172109_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.107 33.0 32.0 33.0 28.0 34.0 2 31.582 33.0 32.0 33.0 27.0 34.0 3 31.4665 33.0 31.0 33.0 28.0 34.0 4 31.526 33.0 31.0 33.0 29.0 33.0 5 32.3265 33.0 33.0 33.0 31.0 34.0 6 36.1635 37.0 36.0 38.0 33.0 38.0 7 37.22375 38.0 38.0 38.0 36.0 38.0 8 37.28025 38.0 38.0 38.0 36.0 38.0 9 37.4325 38.0 38.0 38.0 37.0 38.0 10-14 37.480650000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.469 38.0 38.0 38.0 37.0 38.0 20-24 37.49745 38.0 38.0 38.0 37.0 38.0 25-29 37.4748 38.0 38.0 38.0 37.0 38.0 30-34 37.44545 38.0 38.0 38.0 37.0 38.0 35-39 37.440250000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.3998 38.0 38.0 38.0 37.0 38.0 45-49 37.3286 38.0 38.0 38.0 37.0 38.0 50-54 37.20285 38.0 38.0 38.0 36.0 38.0 55-59 37.1223 38.0 38.0 38.0 36.0 38.0 60-64 37.0582 38.0 38.0 38.0 36.0 38.0 65-69 37.0007 38.0 38.0 38.0 36.0 38.0 70-74 36.9356 38.0 38.0 38.0 35.2 38.0 75-79 36.8598 38.0 38.0 38.0 35.0 38.0 80-84 36.78045 38.0 38.0 38.0 34.6 38.0 85-89 36.595000000000006 38.0 37.8 38.0 34.0 38.0 90-94 36.56415 38.0 37.6 38.0 34.0 38.0 95-99 36.401149999999994 38.0 37.0 38.0 34.0 38.0 100-104 36.141149999999996 38.0 37.0 38.0 33.2 38.0 105-109 35.9371 38.0 37.0 38.0 31.8 38.0 110-114 35.7395 38.0 36.0 38.0 31.0 38.0 115-119 35.67225 38.0 36.0 38.0 31.0 38.0 120-124 35.4119 38.0 35.8 38.0 30.0 38.0 125-129 35.05415 38.0 35.0 38.0 28.2 38.0 130-134 34.8599 38.0 35.0 38.0 28.0 38.0 135-139 34.4292 38.0 34.8 38.0 26.0 38.0 140-144 33.6956 38.0 34.0 38.0 21.8 38.0 145-149 32.97085 38.0 33.6 38.0 18.2 38.0 150-151 29.200875 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 4.0 21 0.0 22 4.0 23 3.0 24 3.0 25 8.0 26 18.0 27 13.0 28 23.0 29 26.0 30 37.0 31 62.0 32 85.0 33 134.0 34 209.0 35 445.0 36 1153.0 37 1766.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.54251744636857 17.265443266994055 13.4660118893771 39.726027397260275 2 17.479369842460617 26.331582895723933 38.70967741935484 17.479369842460617 3 17.75 28.975 27.575 25.7 4 22.0 36.15 21.6 20.25 5 19.950000000000003 37.05 24.275 18.725 6 16.45 36.725 25.624999999999996 21.2 7 11.95 20.8 47.0 20.25 8 18.475 21.75 29.425 30.349999999999998 9 17.349999999999998 22.075 31.2 29.375 10-14 19.400000000000002 30.375000000000004 26.52 23.705000000000002 15-19 19.395 29.68 27.32 23.605 20-24 19.365 29.56 27.79 23.285 25-29 19.885 29.909999999999997 27.560000000000002 22.645 30-34 19.895 28.92 28.33 22.855 35-39 19.55 29.17 28.015 23.265 40-44 19.935 29.39 27.82 22.855 45-49 19.98 29.220000000000002 27.810000000000002 22.99 50-54 19.875 29.57 27.6 22.955000000000002 55-59 19.605 29.085 28.26 23.05 60-64 19.744999999999997 29.21 27.794999999999998 23.25 65-69 20.515 28.95 27.560000000000002 22.975 70-74 20.43 28.875 27.339999999999996 23.355 75-79 19.475 28.955 27.46 24.11 80-84 19.66 28.715000000000003 27.57 24.055 85-89 20.200000000000003 28.21 27.905 23.685000000000002 90-94 20.135 28.88 28.025 22.96 95-99 20.055 28.565 27.76 23.62 100-104 19.935 28.765 27.625 23.674999999999997 105-109 20.424999999999997 28.715000000000003 27.560000000000002 23.3 110-114 20.07 29.005 27.87 23.055 115-119 20.68 28.689999999999998 27.655 22.975 120-124 20.285 28.475 27.965 23.275000000000002 125-129 20.14 29.104999999999997 27.455000000000002 23.3 130-134 20.435 28.62 27.82 23.125 135-139 20.62 28.415000000000003 27.279999999999998 23.685000000000002 140-144 21.19 28.64 26.884999999999998 23.285 145-149 20.705000000000002 29.154999999999998 26.974999999999998 23.165 150-151 21.087500000000002 27.900000000000002 26.775 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 1.0 21 3.0 22 2.0 23 1.5 24 5.5 25 5.0 26 3.0 27 6.5 28 14.0 29 19.5 30 23.0 31 30.0 32 42.0 33 51.5 34 63.0 35 87.0 36 97.5 37 113.5 38 148.0 39 183.0 40 227.0 41 251.5 42 259.5 43 274.0 44 290.0 45 276.0 46 251.0 47 238.0 48 213.5 49 186.0 50 148.5 51 116.0 52 96.5 53 75.5 54 55.5 55 37.5 56 24.5 57 18.5 58 14.5 59 11.5 60 9.0 61 5.5 62 4.5 63 4.5 64 3.0 65 1.0 66 1.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.7874999999999996 0.0 0.0 0.0 0.0 134-135 4.15 0.0 0.0 0.0 0.0 136-137 4.4875 0.0 0.0 0.0 0.0 138-139 5.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172109 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172109_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.995 33.0 33.0 34.0 32.0 34.0 2 33.098 33.0 33.0 34.0 32.0 34.0 3 33.14125 34.0 33.0 34.0 33.0 34.0 4 33.1735 34.0 33.0 34.0 33.0 34.0 5 33.2235 34.0 33.0 34.0 33.0 34.0 6 37.42375 38.0 38.0 38.0 37.0 38.0 7 37.4335 38.0 38.0 38.0 37.0 38.0 8 37.48625 38.0 38.0 38.0 37.0 38.0 9 37.42625 38.0 38.0 38.0 37.0 38.0 10-14 37.380700000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.38475 38.0 38.0 38.0 37.0 38.0 20-24 37.3456 38.0 38.0 38.0 37.0 38.0 25-29 37.3046 38.0 38.0 38.0 37.0 38.0 30-34 37.319300000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.170049999999996 38.0 38.0 38.0 36.4 38.0 40-44 37.2362 38.0 38.0 38.0 36.8 38.0 45-49 37.207300000000004 38.0 38.0 38.0 36.4 38.0 50-54 37.146550000000005 38.0 38.0 38.0 36.0 38.0 55-59 37.079 38.0 38.0 38.0 36.0 38.0 60-64 37.0499 38.0 38.0 38.0 36.0 38.0 65-69 36.947 38.0 38.0 38.0 35.8 38.0 70-74 36.8892 38.0 38.0 38.0 35.2 38.0 75-79 36.80275 38.0 38.0 38.0 35.0 38.0 80-84 36.664300000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.577000000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.454150000000006 38.0 37.8 38.0 34.0 38.0 95-99 36.233999999999995 38.0 37.2 38.0 33.4 38.0 100-104 36.06685 38.0 37.0 38.0 33.0 38.0 105-109 35.9199 38.0 37.0 38.0 32.6 38.0 110-114 35.7159 38.0 36.8 38.0 31.2 38.0 115-119 35.47455 38.0 36.2 38.0 30.2 38.0 120-124 35.216 38.0 36.0 38.0 28.4 38.0 125-129 34.783950000000004 38.0 35.0 38.0 27.6 38.0 130-134 34.47115 38.0 34.8 38.0 25.8 38.0 135-139 34.161300000000004 38.0 34.6 38.0 23.8 38.0 140-144 33.42555 38.0 33.6 38.0 20.6 38.0 145-149 32.46915 38.0 32.6 38.0 13.8 38.0 150-151 27.883875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 3.0 15 0.0 16 3.0 17 2.0 18 2.0 19 2.0 20 5.0 21 3.0 22 8.0 23 5.0 24 8.0 25 13.0 26 12.0 27 17.0 28 38.0 29 25.0 30 45.0 31 62.0 32 87.0 33 136.0 34 211.0 35 394.0 36 941.0 37 1972.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.675 14.549999999999999 16.25 34.525 2 23.599999999999998 23.0 37.75 15.65 3 20.625 26.724999999999998 31.424999999999997 21.224999999999998 4 24.2 34.875 21.375 19.55 5 24.099999999999998 37.225 21.325 17.349999999999998 6 16.7 38.9 25.025 19.375 7 16.400000000000002 14.075 47.3 22.225 8 19.7 21.575 29.049999999999997 29.675 9 21.2 24.675 27.85 26.275 10-14 22.935 29.015 26.490000000000002 21.560000000000002 15-19 22.255 27.894999999999996 28.599999999999998 21.25 20-24 23.185 27.779999999999998 28.005000000000003 21.029999999999998 25-29 22.770000000000003 28.83 27.76 20.64 30-34 22.235 28.410000000000004 28.4 20.955 35-39 23.04 28.565 27.87 20.525 40-44 22.775000000000002 28.144999999999996 27.92 21.16 45-49 22.98 27.47 28.7 20.849999999999998 50-54 23.005 28.255000000000003 28.09 20.65 55-59 22.375 28.015 28.910000000000004 20.7 60-64 23.015 28.144999999999996 28.395 20.445 65-69 23.165 28.275 28.199999999999996 20.36 70-74 23.035 27.79 28.139999999999997 21.035 75-79 22.64 28.439999999999998 28.15 20.77 80-84 23.235 28.16 28.115000000000002 20.49 85-89 23.385 27.715 28.29 20.61 90-94 23.07 28.155 28.17 20.605 95-99 22.82 28.1 28.555000000000003 20.525 100-104 23.765 27.950000000000003 28.585 19.7 105-109 23.68 27.655 28.52 20.145 110-114 23.175 28.444999999999997 28.095 20.285 115-119 23.25 27.345000000000002 29.075 20.330000000000002 120-124 24.03 27.845 28.199999999999996 19.925 125-129 24.404999999999998 27.450000000000003 27.839999999999996 20.305 130-134 24.215 28.01 27.88 19.895 135-139 24.224999999999998 27.315 28.165000000000003 20.294999999999998 140-144 23.775 28.22 27.975 20.03 145-149 24.39 28.165000000000003 28.055000000000003 19.39 150-151 24.462500000000002 27.575 28.925 19.037499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.5 26 3.0 27 3.5 28 8.5 29 14.0 30 14.0 31 14.5 32 21.0 33 42.5 34 54.0 35 62.5 36 87.5 37 113.5 38 137.5 39 177.5 40 222.5 41 252.5 42 276.0 43 282.0 44 279.5 45 288.0 46 285.5 47 254.5 48 228.0 49 194.5 50 156.5 51 131.5 52 97.5 53 71.0 54 59.0 55 44.0 56 30.5 57 21.5 58 11.5 59 10.0 60 12.5 61 9.5 62 6.0 63 4.5 64 4.0 65 3.5 66 2.5 67 1.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.775 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 5.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCCTC 10 0.006830828 145.0 7 >>END_MODULE Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454081 spots for SRR7172109.sra Written 454081 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra Read 454077 spots for SRR7172109.sra Written 454077 spots for SRR7172109.sra SRR ids: ['SRR7172109.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xzhy0z1y SRR7172109.sra spots: 9081544 blocks: [[1, 454077], [454078, 908154], [908155, 1362231], [1362232, 1816308], [1816309, 2270385], [2270386, 2724462], [2724463, 3178539], [3178540, 3632616], [3632617, 4086693], [4086694, 4540770], [4540771, 4994847], [4994848, 5448924], [5448925, 5903001], [5903002, 6357078], [6357079, 6811155], [6811156, 7265232], [7265233, 7719309], [7719310, 8173386], [8173387, 8627463], [8627464, 9081544]] SRR7172109 file size 3057530 SRR7172109 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172109 SRR7172109_1.fastq SRR7172109_2.fastq Input file: SRR7172109_1.fastq Paired file: SRR7172109_2.fastq trimmed: SRR7172109-trimmed-pair1.fastq, SRR7172109-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:18:25 2025 >> started Fri Feb 14 05:18:36 2025 >> done (11.867s) 9081544 read pairs processed; of these: 2074 ( 0.02%) short read pairs filtered out after trimming by size control 1346 ( 0.01%) empty read pairs filtered out after trimming by size control 9078124 (99.96%) read pairs available; of these: 5724523 (63.06%) trimmed read pairs available after processing 3353601 (36.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 1 0.00% 27 2 0.00% 28 3 0.00% 29 1 0.00% 30 3 0.00% 31 5 0.00% 32 1 0.00% 33 4 0.00% 34 1 0.00% 35 2 0.00% 36 5 0.00% 37 4 0.00% 38 2 0.00% 39 3 0.00% 40 7 0.00% 41 5 0.00% 42 4 0.00% 43 2 0.00% 44 8 0.00% 45 4 0.00% 46 8 0.00% 47 3 0.00% 48 8 0.00% 49 9 0.00% 50 14 0.00% 51 21 0.00% 52 13 0.00% 53 21 0.00% 54 18 0.00% 55 32 0.00% 56 24 0.00% 57 26 0.00% 58 28 0.00% 59 35 0.00% 60 37 0.00% 61 43 0.00% 62 43 0.00% 63 62 0.00% 64 65 0.00% 65 67 0.00% 66 75 0.00% 67 95 0.00% 68 107 0.00% 69 125 0.00% 70 136 0.00% 71 170 0.00% 72 199 0.00% 73 208 0.00% 74 262 0.00% 75 295 0.00% 76 339 0.00% 77 365 0.00% 78 452 0.00% 79 487 0.01% 80 548 0.01% 81 625 0.01% 82 718 0.01% 83 807 0.01% 84 1042 0.01% 85 1211 0.01% 86 1369 0.02% 87 1564 0.02% 88 1637 0.02% 89 1798 0.02% 90 1996 0.02% 91 2244 0.02% 92 2542 0.03% 93 2722 0.03% 94 3011 0.03% 95 3235 0.04% 96 3460 0.04% 97 3799 0.04% 98 4067 0.04% 99 4481 0.05% 100 4799 0.05% 101 5204 0.06% 102 5577 0.06% 103 6047 0.07% 104 6547 0.07% 105 7002 0.08% 106 7650 0.08% 107 8247 0.09% 108 8726 0.10% 109 9374 0.10% 110 9619 0.11% 111 10527 0.12% 112 10746 0.12% 113 11758 0.13% 114 12503 0.14% 115 13546 0.15% 116 14179 0.16% 117 14756 0.16% 118 15367 0.17% 119 16179 0.18% 120 16991 0.19% 121 18034 0.20% 122 19228 0.21% 123 20244 0.22% 124 21483 0.24% 125 22863 0.25% 126 23996 0.26% 127 26038 0.29% 128 27396 0.30% 129 29182 0.32% 130 31179 0.34% 131 33626 0.37% 132 36213 0.40% 133 38888 0.43% 134 41899 0.46% 135 45516 0.50% 136 49891 0.55% 137 54550 0.60% 138 60033 0.66% 139 66038 0.73% 140 73836 0.81% 141 84106 0.93% 142 97843 1.08% 143 114318 1.26% 144 139454 1.54% 145 173674 1.91% 146 227615 2.51% 147 316410 3.49% 148 480118 5.29% 149 838905 9.24% 150 2249764 24.78% 151 3353601 36.94% 9078124 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=60.06 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.7 sequence=CACACACAAGAACCATAACCAGAGTAATAGCATATAAACCAAGACATTATCTTGGACAACATGAACAGCACATCTTAAAAACCACCACGGAGACGAAGGACAAGGTGAAG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=10 prefix-density=0.44 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=21.40 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=7.9 sequence=TGGTGCTGAGAATGGCTGCAAGTG SRR7172109 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:19:25 Started mapping on | Feb 14 05:19:25 Finished on | Feb 14 05:20:35 Mapping speed, Million of reads per hour | 466.87 Number of input reads | 9078124 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8612637 Uniquely mapped reads % | 94.87% Average mapped length | 293.33 Number of splices: Total | 8169665 Number of splices: Annotated (sjdb) | 7998201 Number of splices: GT/AG | 8032997 Number of splices: GC/AG | 105265 Number of splices: AT/AC | 6650 Number of splices: Non-canonical | 24753 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245742 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 24914 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 222823 222823 222823 N_multimapping 245742 245742 245742 N_noFeature 294326 8526606 332654 N_ambiguous 95076 465 47053 UnstrandedReadsAssigned:8223235 PositiveStrandReadsAssigned:85566 NegativeStrandReadsAssigned:8232930 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172109 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172109-trimmed-pair1.fastq SRR7172109-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,078,124 reads, 8,173,914 reads pseudoaligned [quant] estimated average fragment length: 239.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7172109.ke.tsv 34699 SRR7172109.se.tsv 87100 total ==> SRR7172109.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.07 702 49.7409 Potri.005G024800.1.v4.1 1035 796.073 100 15.835 Potri.004G059700.1.v4.1 961 722.083 9 1.57118 Potri.007G009000.2.v4.1 1416 1177.07 0 0 Potri.003G141000.2.v4.1 2943 2704.07 355.183 16.5578 Potri.016G087400.1.v4.1 270 77.1703 427 697.506 Potri.015G069301.1.v4.1 564 327.819 0 0 Potri.010G195200.1.v4.1 1773 1534.07 238.843 19.6262 Potri.012G127500.1.v4.1 977 738.083 3712 633.976 ==> SRR7172109.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 100 SRR7172109 completed mapping pipeline successfully