Starting /dee2/code/volunteer_pipeline.sh SRR7172110 current disk space = 3086132744192 free memory = 1446533668 SRR7172110 SRAfilesize 87d7ef6d154370a43315a2cd1144e3f9 SRR7172110.sra SRR7172110.sra file validated SRR7172110 is paired end SRR7172110 is conventional basespace SRR7172110 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172110_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.87775 28.0 18.0 33.0 18.0 33.0 2 27.08025 29.0 25.0 31.0 18.0 33.0 3 30.684 31.0 29.0 33.0 27.0 33.0 4 32.0495 33.0 33.0 33.0 29.0 33.0 5 32.755 33.0 33.0 33.0 32.0 34.0 6 36.68775 38.0 37.0 38.0 34.0 38.0 7 37.23 38.0 38.0 38.0 36.0 38.0 8 37.5225 38.0 38.0 38.0 37.0 38.0 9 37.54425 38.0 38.0 38.0 38.0 38.0 10-14 37.51975 38.0 38.0 38.0 37.8 38.0 15-19 37.55355 38.0 38.0 38.0 38.0 38.0 20-24 37.54455 38.0 38.0 38.0 38.0 38.0 25-29 37.4551 38.0 38.0 38.0 37.6 38.0 30-34 37.506299999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.4361 38.0 38.0 38.0 37.8 38.0 40-44 37.271100000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3398 38.0 38.0 38.0 37.0 38.0 50-54 37.34525 38.0 38.0 38.0 37.0 38.0 55-59 37.352599999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.34005 38.0 38.0 38.0 37.0 38.0 65-69 37.28655 38.0 38.0 38.0 37.0 38.0 70-74 37.2611 38.0 38.0 38.0 36.8 38.0 75-79 37.1543 38.0 38.0 38.0 36.8 38.0 80-84 37.0689 38.0 38.0 38.0 36.0 38.0 85-89 36.918899999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.890299999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.820949999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.63195 38.0 38.0 38.0 34.6 38.0 105-109 36.6182 38.0 38.0 38.0 34.6 38.0 110-114 36.28455 38.0 38.0 38.0 34.0 38.0 115-119 35.8572 38.0 37.2 38.0 32.2 38.0 120-124 36.220600000000005 38.0 37.6 38.0 34.0 38.0 125-129 35.81479999999999 38.0 37.0 38.0 32.0 38.0 130-134 35.723400000000005 38.0 36.6 38.0 31.8 38.0 135-139 35.462650000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.92705 38.0 36.0 38.0 29.4 38.0 145-149 34.321349999999995 38.0 35.4 38.0 27.0 38.0 150-151 30.072375 35.5 27.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 1.0 15 0.0 16 1.0 17 3.0 18 4.0 19 0.0 20 1.0 21 3.0 22 3.0 23 4.0 24 7.0 25 6.0 26 13.0 27 12.0 28 25.0 29 35.0 30 34.0 31 36.0 32 64.0 33 107.0 34 141.0 35 257.0 36 682.0 37 2554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.975 15.475 14.975 38.574999999999996 2 19.650000000000002 24.725 38.4 17.224999999999998 3 17.75 30.075000000000003 26.474999999999998 25.7 4 20.45 38.75 20.175 20.625 5 19.55 38.1 23.35 19.0 6 16.275000000000002 38.4 25.374999999999996 19.950000000000003 7 12.45 21.224999999999998 46.275 20.05 8 17.875 22.0 28.625 31.5 9 17.775 21.8 31.874999999999996 28.549999999999997 10-14 19.503652556789753 29.53067147002902 26.94886420494346 24.016811768237766 15-19 19.275000000000002 28.804999999999996 27.91 24.01 20-24 19.265 28.799999999999997 28.084999999999997 23.849999999999998 25-29 19.50695069506951 28.717871787178716 28.20782078207821 23.567356735673567 30-34 19.816981698169815 28.81288128812881 27.622762276227625 23.74737473747375 35-39 19.259814953738434 29.587396849212304 27.506876719179797 23.645911477869465 40-44 19.02975743935984 29.517379344836208 27.73693423355839 23.71592898224556 45-49 19.787968195229286 29.14937240586088 27.794169125368807 23.268490273541033 50-54 19.885 28.73 27.605 23.78 55-59 20.0 28.884999999999998 27.900000000000002 23.215 60-64 20.0 28.02 28.345 23.635 65-69 20.205000000000002 28.96 27.815 23.02 70-74 20.011000550027504 28.95644782239112 27.456372818640933 23.576178808940448 75-79 19.785 28.975 27.450000000000003 23.79 80-84 19.94498624656164 28.962240560140035 27.516879219804952 23.575893973493372 85-89 19.69181508905343 28.972383430058034 28.056834100460275 23.278967380428256 90-94 20.457160006002102 28.424948732056222 27.224528585004755 23.893362676936928 95-99 19.49 28.955 27.79 23.765 100-104 20.450112528132035 28.612153038259564 27.826956739184794 23.110777694423607 105-109 20.268040206030904 28.804320648097214 27.219082862429367 23.708556283442515 110-114 20.339153120610074 28.637367047963075 27.729279550471603 23.29420028095525 115-119 20.59398006711073 28.2165573195773 27.936094556017427 23.253368057294534 120-124 20.29108732619786 28.65859757927378 27.348204461338398 23.702110633189957 125-129 19.975962742250488 28.824678251289498 28.00340527818118 23.19595372827883 130-134 20.436021801090053 28.991449572478622 27.001350067503378 23.571178558927947 135-139 20.191009550477524 28.436421821091056 27.92139606980349 23.45117255862793 140-144 20.39815926370548 28.15126050420168 27.686074429771907 23.76450580232093 145-149 21.077646587952774 28.652191314788872 27.041224734840902 23.22893736241745 150-151 21.224999999999998 28.15 26.887499999999996 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 4.0 25 4.5 26 5.5 27 5.5 28 9.5 29 13.0 30 20.0 31 32.0 32 40.5 33 52.0 34 65.5 35 78.5 36 94.5 37 121.0 38 159.5 39 192.5 40 207.0 41 235.0 42 262.5 43 269.0 44 265.5 45 275.5 46 277.0 47 253.5 48 217.5 49 168.5 50 146.0 51 123.5 52 93.0 53 83.0 54 63.5 55 39.5 56 32.0 57 23.5 58 16.0 59 11.5 60 5.0 61 4.0 62 5.5 63 5.0 64 3.5 65 2.0 66 2.0 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.06999999999999999 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.01 35-39 0.025 40-44 0.025 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.025 85-89 0.06 90-94 0.034999999999999996 95-99 0.0 100-104 0.025 105-109 0.015 110-114 0.33999999999999997 115-119 0.165 120-124 0.03 125-129 0.155 130-134 0.005 135-139 0.005 140-144 0.04 145-149 0.06 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.3875 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.8624999999999998 0.0 0.0 0.0 0.0 130-131 2.0875000000000004 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGGA 10 0.006830828 145.0 3 ATGGAGC 10 0.006830828 145.0 5 TTGATGG 10 0.006830828 145.0 2 AATTGCA 10 0.006830828 145.0 5 TGTCAAA 20 3.5877043E-4 108.75 6 TTTTTTT 30 0.0014437955 24.166668 65-69 >>END_MODULE SRR7172110 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172110_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.066 34.0 33.0 34.0 32.0 34.0 2 33.0915 34.0 33.0 34.0 33.0 34.0 3 33.15525 34.0 33.0 34.0 33.0 34.0 4 33.0175 34.0 33.0 34.0 33.0 34.0 5 33.019 34.0 33.0 34.0 33.0 34.0 6 37.22375 38.0 38.0 38.0 37.0 38.0 7 37.29925 38.0 38.0 38.0 37.0 38.0 8 37.29275 38.0 38.0 38.0 38.0 38.0 9 37.29025 38.0 38.0 38.0 38.0 38.0 10-14 37.2947 38.0 38.0 38.0 38.0 38.0 15-19 37.268299999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.175700000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.28555 38.0 38.0 38.0 37.4 38.0 30-34 37.2729 38.0 38.0 38.0 37.2 38.0 35-39 37.1981 38.0 38.0 38.0 37.0 38.0 40-44 37.08275 38.0 38.0 38.0 37.0 38.0 45-49 37.21015 38.0 38.0 38.0 37.0 38.0 50-54 37.2038 38.0 38.0 38.0 37.0 38.0 55-59 37.141 38.0 38.0 38.0 37.0 38.0 60-64 37.11325000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.0619 38.0 38.0 38.0 36.8 38.0 70-74 37.0649 38.0 38.0 38.0 37.0 38.0 75-79 37.0028 38.0 38.0 38.0 36.2 38.0 80-84 36.8831 38.0 38.0 38.0 36.0 38.0 85-89 36.74565 38.0 38.0 38.0 35.8 38.0 90-94 36.5844 38.0 38.0 38.0 34.8 38.0 95-99 36.480050000000006 38.0 38.0 38.0 34.4 38.0 100-104 36.378550000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.4146 38.0 38.0 38.0 34.0 38.0 110-114 36.162349999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.09689999999999 38.0 38.0 38.0 33.8 38.0 120-124 35.8852 38.0 37.8 38.0 32.6 38.0 125-129 35.67565 38.0 37.2 38.0 31.2 38.0 130-134 35.24569999999999 38.0 36.4 38.0 29.8 38.0 135-139 34.899649999999994 38.0 36.0 38.0 28.6 38.0 140-144 34.51305 38.0 36.0 38.0 27.2 38.0 145-149 33.43545 38.0 33.8 38.0 18.8 38.0 150-151 28.051000000000002 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 3.0 13 1.0 14 3.0 15 0.0 16 3.0 17 2.0 18 1.0 19 5.0 20 5.0 21 4.0 22 5.0 23 10.0 24 9.0 25 16.0 26 15.0 27 17.0 28 35.0 29 28.0 30 39.0 31 54.0 32 56.0 33 82.0 34 149.0 35 210.0 36 580.0 37 2652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.11655827913957 12.481240620310155 17.883941970985493 36.51825912956478 2 22.311155577788895 22.586293146573286 38.019009504752376 17.083541770885443 3 20.610305152576288 26.088044022011005 30.340170085042523 22.961480740370185 4 23.46760070052539 34.250688016012006 21.691268451338505 20.590442832124094 5 25.01251877816725 35.82874311467201 22.283425137706562 16.875312969454182 6 17.694235588972433 37.26817042606516 24.235588972431078 20.80200501253133 7 16.478555304740404 15.701028342111863 46.200150489089545 21.62026586405819 8 20.090180360721444 21.117234468937877 29.80961923847695 28.98296593186373 9 21.899273365071412 23.878727136056128 29.416186419443747 24.805813079428717 10-14 23.15937093058199 28.32815786837624 26.535109686466996 21.977361514574778 15-19 22.841825742772684 28.262939025001256 27.756901648379177 21.138333583846887 20-24 22.395833333333336 28.62079326923077 27.423878205128204 21.559495192307693 25-29 22.878007302555893 28.039813934877206 28.32491371980193 20.75726504276497 30-34 23.13 28.07 27.939999999999998 20.86 35-39 22.675 28.410000000000004 28.355000000000004 20.560000000000002 40-44 23.064999999999998 28.68 28.01 20.244999999999997 45-49 23.26197859357807 27.853356006802038 28.203461038311495 20.681204361308392 50-54 22.585 28.275 28.294999999999998 20.845 55-59 23.21 28.415000000000003 28.275 20.1 60-64 23.645 27.63 28.49 20.235 65-69 22.805 28.62 28.17 20.405 70-74 23.175 28.13 27.935 20.76 75-79 23.200000000000003 28.165000000000003 28.43 20.205000000000002 80-84 23.405 28.035 28.29 20.27 85-89 23.825 27.195000000000004 28.215 20.765 90-94 22.78 27.485 29.09 20.645 95-99 23.095 27.52 29.054999999999996 20.330000000000002 100-104 23.549999999999997 27.810000000000002 28.185 20.455000000000002 105-109 23.14 27.655 28.73 20.474999999999998 110-114 23.01 28.26 28.115000000000002 20.615 115-119 23.66 27.575 28.73 20.035 120-124 23.66 27.57 28.565 20.205000000000002 125-129 23.535 28.384999999999998 28.175 19.905 130-134 23.630000000000003 28.255000000000003 28.005000000000003 20.11 135-139 23.96 27.800000000000004 28.03 20.21 140-144 23.62 28.055000000000003 27.834999999999997 20.49 145-149 24.265 27.779999999999998 27.994999999999997 19.96 150-151 24.375 27.750000000000004 28.050000000000004 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 3.0 24 4.5 25 2.5 26 4.0 27 7.5 28 8.0 29 7.0 30 16.0 31 22.5 32 25.5 33 35.0 34 49.0 35 69.0 36 91.5 37 114.5 38 142.0 39 166.0 40 200.0 41 241.0 42 262.0 43 268.0 44 271.5 45 277.5 46 265.5 47 269.5 48 250.0 49 194.0 50 153.0 51 125.5 52 117.0 53 98.0 54 69.0 55 54.0 56 39.0 57 19.5 58 11.5 59 10.0 60 10.0 61 7.5 62 3.5 63 3.5 64 4.0 65 2.0 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.075 5 0.15 6 0.25 7 0.325 8 0.2 9 0.22499999999999998 10-14 0.16999999999999998 15-19 0.20500000000000002 20-24 0.16 25-29 0.034999999999999996 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.675 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCAGC 10 0.006830828 145.0 6 >>END_MODULE Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675388 spots for SRR7172110.sra Written 675388 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra Read 675372 spots for SRR7172110.sra Written 675372 spots for SRR7172110.sra SRR ids: ['SRR7172110.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__kas7k23 SRR7172110.sra spots: 13507456 blocks: [[1, 675372], [675373, 1350744], [1350745, 2026116], [2026117, 2701488], [2701489, 3376860], [3376861, 4052232], [4052233, 4727604], [4727605, 5402976], [5402977, 6078348], [6078349, 6753720], [6753721, 7429092], [7429093, 8104464], [8104465, 8779836], [8779837, 9455208], [9455209, 10130580], [10130581, 10805952], [10805953, 11481324], [11481325, 12156696], [12156697, 12832068], [12832069, 13507456]] SRR7172110 file size 4555533 SRR7172110 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172110 SRR7172110_1.fastq SRR7172110_2.fastq Input file: SRR7172110_1.fastq Paired file: SRR7172110_2.fastq trimmed: SRR7172110-trimmed-pair1.fastq, SRR7172110-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:25:06 2025 >> started Fri Feb 14 05:25:28 2025 >> done (22.718s) 13507456 read pairs processed; of these: 6348 ( 0.05%) short read pairs filtered out after trimming by size control 6490 ( 0.05%) empty read pairs filtered out after trimming by size control 13494618 (99.90%) read pairs available; of these: 6847576 (50.74%) trimmed read pairs available after processing 6647042 (49.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 2 0.00% 25 4 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 2 0.00% 33 4 0.00% 34 4 0.00% 35 7 0.00% 36 1 0.00% 37 4 0.00% 38 8 0.00% 39 3 0.00% 40 3 0.00% 41 4 0.00% 42 10 0.00% 43 6 0.00% 44 3 0.00% 45 6 0.00% 46 6 0.00% 47 10 0.00% 48 7 0.00% 49 17 0.00% 50 9 0.00% 51 17 0.00% 52 16 0.00% 53 13 0.00% 54 24 0.00% 55 18 0.00% 56 27 0.00% 57 25 0.00% 58 22 0.00% 59 31 0.00% 60 30 0.00% 61 46 0.00% 62 49 0.00% 63 63 0.00% 64 71 0.00% 65 87 0.00% 66 94 0.00% 67 85 0.00% 68 115 0.00% 69 129 0.00% 70 143 0.00% 71 171 0.00% 72 180 0.00% 73 222 0.00% 74 245 0.00% 75 288 0.00% 76 342 0.00% 77 441 0.00% 78 422 0.00% 79 593 0.00% 80 625 0.00% 81 671 0.00% 82 769 0.01% 83 1042 0.01% 84 1482 0.01% 85 1738 0.01% 86 1991 0.01% 87 2170 0.02% 88 2210 0.02% 89 2446 0.02% 90 2514 0.02% 91 2852 0.02% 92 2966 0.02% 93 3229 0.02% 94 3480 0.03% 95 3808 0.03% 96 4219 0.03% 97 4534 0.03% 98 4806 0.04% 99 5158 0.04% 100 5616 0.04% 101 6328 0.05% 102 6757 0.05% 103 7033 0.05% 104 7472 0.06% 105 8228 0.06% 106 8836 0.07% 107 9586 0.07% 108 9780 0.07% 109 10269 0.08% 110 10740 0.08% 111 11350 0.08% 112 12231 0.09% 113 12842 0.10% 114 13494 0.10% 115 14840 0.11% 116 15189 0.11% 117 16186 0.12% 118 17007 0.13% 119 17800 0.13% 120 18839 0.14% 121 19844 0.15% 122 20926 0.16% 123 21963 0.16% 124 23120 0.17% 125 24489 0.18% 126 25527 0.19% 127 27149 0.20% 128 28589 0.21% 129 30376 0.23% 130 32289 0.24% 131 34324 0.25% 132 36401 0.27% 133 39330 0.29% 134 42018 0.31% 135 45728 0.34% 136 51356 0.38% 137 52883 0.39% 138 57439 0.43% 139 62739 0.46% 140 67925 0.50% 141 73600 0.55% 142 82019 0.61% 143 92393 0.68% 144 108894 0.81% 145 130147 0.96% 146 164303 1.22% 147 226610 1.68% 148 351052 2.60% 149 710047 5.26% 150 3866809 28.65% 151 6647042 49.26% 13494618 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=38 prefix-density=0.17 prefix-fanout=2.1 sequence=AGTTCATCTCAGACCTCTCGAAGAACATCTGAACTGGTGCAAAACCTGCAATGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=425.65 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=35.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=26 prefix-density=0.21 prefix-fanout=3.4 sequence=ATGTACCCTGACTTGGGTTTCTCAGAGAGCACCACAACCGAGACAATCATTGCAGGTTTTGCACCAGTTCAGATGTTCTTCGAGAGGTCTGAGATGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=125.81 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=23.4 sequence=GAAGAAGAGAGG SRR7172110 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:26:14 Started mapping on | Feb 14 05:26:14 Finished on | Feb 14 05:27:46 Mapping speed, Million of reads per hour | 528.05 Number of input reads | 13494618 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12849577 Uniquely mapped reads % | 95.22% Average mapped length | 295.92 Number of splices: Total | 13095195 Number of splices: Annotated (sjdb) | 12874017 Number of splices: GT/AG | 12891622 Number of splices: GC/AG | 162468 Number of splices: AT/AC | 9060 Number of splices: Non-canonical | 32045 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376844 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 43062 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.59% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 275788 275788 275788 N_multimapping 376844 376844 376844 N_noFeature 317282 12735255 367942 N_ambiguous 132489 660 68383 UnstrandedReadsAssigned:12399806 PositiveStrandReadsAssigned:113662 NegativeStrandReadsAssigned:12413252 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172110 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172110-trimmed-pair1.fastq SRR7172110-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,494,618 reads, 12,322,133 reads pseudoaligned [quant] estimated average fragment length: 257.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR7172110.ke.tsv 34699 SRR7172110.se.tsv 87100 total ==> SRR7172110.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.62 793 35.0334 Potri.005G024800.1.v4.1 1035 778.625 120 11.9943 Potri.004G059700.1.v4.1 961 704.666 7 0.773103 Potri.007G009000.2.v4.1 1416 1159.62 0 0 Potri.003G141000.2.v4.1 2943 2686.62 401.27 11.6239 Potri.016G087400.1.v4.1 270 74.5161 944.501 986.449 Potri.015G069301.1.v4.1 564 314.412 0 0 Potri.010G195200.1.v4.1 1773 1516.62 274.78 14.1003 Potri.012G127500.1.v4.1 977 720.646 3404 367.612 ==> SRR7172110.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 213 SRR7172110 completed mapping pipeline successfully