Starting /dee2/code/volunteer_pipeline.sh SRR7172111 current disk space = 3085423726592 free memory = 1580644156 SRR7172111 SRAfilesize ce0fe93ee9ea0864001bcbdeae3bea22 SRR7172111.sra SRR7172111.sra file validated SRR7172111 is paired end SRR7172111 is conventional basespace SRR7172111 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172111_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.643 33.0 33.0 34.0 32.0 34.0 2 33.015 34.0 33.0 34.0 32.0 34.0 3 32.464 33.0 33.0 34.0 31.0 34.0 4 32.71275 33.0 33.0 34.0 32.0 34.0 5 33.0015 33.0 33.0 34.0 32.0 34.0 6 37.08675 38.0 37.0 38.0 36.0 38.0 7 37.40925 38.0 38.0 38.0 37.0 38.0 8 37.50725 38.0 38.0 38.0 37.0 38.0 9 37.52075 38.0 38.0 38.0 38.0 38.0 10-14 37.30915 38.0 38.0 38.0 37.4 38.0 15-19 37.5042 38.0 38.0 38.0 37.6 38.0 20-24 37.417849999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.369899999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.3842 38.0 38.0 38.0 37.0 38.0 35-39 37.23105 38.0 38.0 38.0 37.0 38.0 40-44 37.211850000000005 38.0 38.0 38.0 36.8 38.0 45-49 36.9288 38.0 38.0 38.0 35.6 38.0 50-54 37.1727 38.0 38.0 38.0 36.2 38.0 55-59 37.27745 38.0 38.0 38.0 37.0 38.0 60-64 37.316700000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.2491 38.0 38.0 38.0 37.0 38.0 70-74 37.1452 38.0 38.0 38.0 36.2 38.0 75-79 37.017900000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.0078 38.0 38.0 38.0 36.0 38.0 85-89 36.8327 38.0 38.0 38.0 35.6 38.0 90-94 36.7962 38.0 38.0 38.0 35.2 38.0 95-99 36.667500000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.63955 38.0 38.0 38.0 34.6 38.0 105-109 36.45505 38.0 38.0 38.0 34.0 38.0 110-114 36.375150000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.185 38.0 37.2 38.0 33.4 38.0 120-124 36.02795 38.0 37.0 38.0 33.0 38.0 125-129 35.8615 38.0 37.0 38.0 32.2 38.0 130-134 35.48465 38.0 36.2 38.0 31.0 38.0 135-139 35.19715 38.0 36.0 38.0 31.0 38.0 140-144 34.7413 38.0 35.0 38.0 28.4 38.0 145-149 33.84525 38.0 33.6 38.0 23.6 38.0 150-151 29.286749999999998 35.5 26.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 1.0 18 0.0 19 4.0 20 3.0 21 3.0 22 1.0 23 9.0 24 8.0 25 8.0 26 11.0 27 15.0 28 27.0 29 40.0 30 37.0 31 61.0 32 59.0 33 92.0 34 159.0 35 250.0 36 613.0 37 2591.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.975 16.8 15.85 36.375 2 19.950000000000003 23.7 38.125 18.224999999999998 3 17.0 31.05 27.375 24.575 4 21.224999999999998 36.525 22.650000000000002 19.6 5 21.375 36.575 23.05 19.0 6 16.55 35.75 25.3 22.400000000000002 7 12.325 21.7 45.300000000000004 20.674999999999997 8 17.424999999999997 21.7 28.125 32.75 9 18.5 21.275 31.125000000000004 29.099999999999998 10-14 19.177669561724986 30.583864651839953 26.286460163662834 23.952005622772226 15-19 19.3 28.939999999999998 28.139999999999997 23.62 20-24 19.91 28.749999999999996 27.74 23.599999999999998 25-29 19.73 28.62 28.110000000000003 23.54 30-34 19.875 28.92 27.68 23.525 35-39 19.845 29.145 27.235 23.775 40-44 20.09 29.104999999999997 27.355 23.45 45-49 19.950000000000003 29.265 27.165 23.62 50-54 20.34 29.075 27.37 23.215 55-59 20.055 28.599999999999998 28.12 23.225 60-64 20.015 28.225 27.555000000000003 24.205 65-69 20.315 28.305000000000003 27.639999999999997 23.74 70-74 20.255000000000003 28.64 27.445000000000004 23.66 75-79 20.23 29.445 27.025 23.3 80-84 19.994999999999997 28.49 27.51 24.005000000000003 85-89 20.7 28.294999999999998 27.650000000000002 23.355 90-94 20.035 28.415000000000003 27.98 23.57 95-99 20.605 28.125 27.83 23.44 100-104 21.015 28.43 27.33 23.225 105-109 21.11055527763882 28.06903451725863 26.878439219609806 23.94197098549275 110-114 20.636190857257176 27.858357507252173 27.403220966289886 24.10223066920076 115-119 20.962096209620963 27.642764276427645 27.97779777977798 23.417341734173416 120-124 20.579260667300286 27.84753138912511 27.482367065179332 24.090840878395277 125-129 21.23836219841826 27.505255781359494 27.820602662929222 23.435779357293022 130-134 20.855 28.265 26.99 23.89 135-139 20.794999999999998 28.470000000000002 26.974999999999998 23.76 140-144 21.89 28.185 26.779999999999998 23.145 145-149 20.765 28.32 27.005000000000003 23.91 150-151 21.3875 28.825 26.487500000000004 23.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 2.0 20 1.5 21 1.5 22 1.5 23 1.0 24 1.0 25 3.5 26 8.5 27 9.0 28 9.5 29 16.5 30 21.5 31 27.5 32 40.0 33 49.5 34 58.5 35 76.5 36 107.5 37 132.0 38 155.0 39 181.5 40 202.5 41 212.0 42 230.5 43 254.0 44 262.0 45 262.0 46 243.5 47 230.0 48 211.0 49 193.5 50 166.0 51 127.5 52 114.0 53 92.5 54 69.5 55 59.0 56 44.0 57 30.5 58 21.0 59 14.5 60 11.5 61 8.0 62 6.0 63 4.5 64 4.5 65 5.5 66 2.5 67 1.5 68 3.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.40499999999999997 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.05 110-114 0.03 115-119 0.01 120-124 0.045 125-129 0.11 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.5374999999999996 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.300000000000001 0.0125 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAAA 10 0.0068555363 144.825 1 >>END_MODULE SRR7172111 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172111_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.957 33.0 33.0 34.0 32.0 34.0 2 32.90175 34.0 33.0 34.0 32.0 34.0 3 33.0365 34.0 33.0 34.0 32.0 34.0 4 32.9355 34.0 33.0 34.0 32.0 34.0 5 33.0015 34.0 33.0 34.0 33.0 34.0 6 37.12825 38.0 38.0 38.0 37.0 38.0 7 37.13825 38.0 38.0 38.0 37.0 38.0 8 37.2005 38.0 38.0 38.0 37.0 38.0 9 37.145 38.0 38.0 38.0 37.0 38.0 10-14 37.235850000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.158849999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.084199999999996 38.0 38.0 38.0 36.8 38.0 25-29 37.029199999999996 38.0 38.0 38.0 36.6 38.0 30-34 37.0104 38.0 38.0 38.0 36.6 38.0 35-39 36.98040000000001 38.0 38.0 38.0 36.4 38.0 40-44 36.95445 38.0 38.0 38.0 36.2 38.0 45-49 36.95399999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.95845 38.0 38.0 38.0 36.4 38.0 55-59 36.912400000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.930099999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.79115 38.0 38.0 38.0 36.0 38.0 70-74 36.74595 38.0 38.0 38.0 35.6 38.0 75-79 36.73155 38.0 38.0 38.0 36.0 38.0 80-84 36.59905 38.0 38.0 38.0 34.8 38.0 85-89 36.51185 38.0 38.0 38.0 34.6 38.0 90-94 36.3322 38.0 38.0 38.0 34.0 38.0 95-99 36.101699999999994 38.0 38.0 38.0 33.4 38.0 100-104 36.07225 38.0 38.0 38.0 33.6 38.0 105-109 36.102199999999996 38.0 38.0 38.0 33.6 38.0 110-114 36.03195 38.0 38.0 38.0 33.4 38.0 115-119 35.857150000000004 38.0 37.4 38.0 32.4 38.0 120-124 35.5555 38.0 37.0 38.0 31.0 38.0 125-129 35.4453 38.0 37.0 38.0 31.0 38.0 130-134 35.035000000000004 38.0 36.0 38.0 29.6 38.0 135-139 34.670449999999995 38.0 36.0 38.0 27.8 38.0 140-144 34.080200000000005 38.0 34.0 38.0 25.0 38.0 145-149 33.37455 38.0 33.2 38.0 19.2 38.0 150-151 28.885375000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 2.0 5 1.0 6 4.0 7 2.0 8 1.0 9 0.0 10 1.0 11 2.0 12 2.0 13 3.0 14 2.0 15 2.0 16 2.0 17 1.0 18 6.0 19 6.0 20 6.0 21 3.0 22 9.0 23 14.0 24 11.0 25 12.0 26 25.0 27 21.0 28 38.0 29 27.0 30 38.0 31 63.0 32 72.0 33 104.0 34 148.0 35 257.0 36 547.0 37 2559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.72408612919379 13.770655983975963 19.45418127190786 34.05107661492238 2 23.34669338677355 22.645290581162325 36.62324649298597 17.384769539078157 3 20.816633266533067 25.701402805611224 31.763527054108216 21.718436873747496 4 24.242424242424242 34.710743801652896 21.136989732031054 19.90984222389181 5 23.635453179769655 37.180771156735105 22.058087130696045 17.1256885327992 6 18.3 35.975 24.375 21.349999999999998 7 16.6 14.7 45.75 22.95 8 20.599999999999998 21.875 27.750000000000004 29.775000000000002 9 21.875 22.925 29.099999999999998 26.1 10-14 23.026151307565378 28.07140357017851 26.356317815890794 22.546127306365317 15-19 23.03 27.54 27.950000000000003 21.48 20-24 22.82 28.33 27.315 21.535 25-29 23.080000000000002 27.750000000000004 28.1 21.07 30-34 23.185 27.525 27.485 21.805 35-39 23.49 28.235 27.01 21.265 40-44 23.015 27.415 27.85 21.72 45-49 23.285 27.994999999999997 27.365000000000002 21.355 50-54 23.335 27.900000000000002 27.97 20.794999999999998 55-59 23.674999999999997 27.605 27.88 20.84 60-64 23.175 27.615000000000002 28.365000000000002 20.845 65-69 23.474999999999998 27.675 27.905 20.945 70-74 23.855 27.794999999999998 27.284999999999997 21.065 75-79 23.185 27.994999999999997 27.634999999999998 21.185000000000002 80-84 23.44 27.605 27.79 21.165 85-89 23.400000000000002 27.245 28.185 21.17 90-94 23.405 27.415 28.21 20.97 95-99 23.200000000000003 28.005000000000003 27.625 21.17 100-104 23.44 27.134999999999998 27.975 21.45 105-109 23.715 27.575 27.71 21.0 110-114 23.585 28.21 27.62 20.585 115-119 24.08 27.73 27.834999999999997 20.355 120-124 23.494999999999997 28.035 27.500000000000004 20.97 125-129 23.73 27.565 28.09 20.615 130-134 24.185000000000002 27.785 27.455000000000002 20.575 135-139 24.235 27.875 27.47 20.419999999999998 140-144 24.84 27.68 27.339999999999996 20.14 145-149 25.264999999999997 27.900000000000002 27.215 19.62 150-151 24.462500000000002 27.05 27.775 20.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.0 24 1.0 25 1.0 26 2.0 27 1.5 28 2.5 29 5.5 30 8.5 31 10.5 32 19.0 33 31.5 34 40.0 35 54.0 36 76.5 37 97.5 38 123.5 39 155.5 40 194.0 41 228.0 42 242.5 43 271.0 44 286.0 45 287.5 46 289.5 47 251.0 48 228.5 49 217.0 50 180.0 51 143.0 52 123.5 53 103.5 54 81.0 55 61.0 56 37.5 57 33.0 58 26.5 59 16.5 60 15.0 61 11.5 62 8.5 63 7.5 64 5.5 65 4.0 66 2.5 67 2.0 68 1.5 69 1.0 70 1.5 71 1.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.2 3 0.2 4 0.17500000000000002 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4024144869215292 0.8 3 0.1006036217303823 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.1624999999999996 0.0 0.0 0.0 0.0 134-135 3.5374999999999996 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTGC 10 0.006830828 145.0 7 GCTTGCT 10 0.006830828 145.0 8 CAGGAAG 10 0.006830828 145.0 8 >>END_MODULE Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820424 spots for SRR7172111.sra Written 820424 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra Read 820410 spots for SRR7172111.sra Written 820410 spots for SRR7172111.sra SRR ids: ['SRR7172111.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ojfr_fa SRR7172111.sra spots: 16408214 blocks: [[1, 820410], [820411, 1640820], [1640821, 2461230], [2461231, 3281640], [3281641, 4102050], [4102051, 4922460], [4922461, 5742870], [5742871, 6563280], [6563281, 7383690], [7383691, 8204100], [8204101, 9024510], [9024511, 9844920], [9844921, 10665330], [10665331, 11485740], [11485741, 12306150], [12306151, 13126560], [13126561, 13946970], [13946971, 14767380], [14767381, 15587790], [15587791, 16408214]] SRR7172111 file size 5538504 SRR7172111 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172111 SRR7172111_1.fastq SRR7172111_2.fastq Input file: SRR7172111_1.fastq Paired file: SRR7172111_2.fastq trimmed: SRR7172111-trimmed-pair1.fastq, SRR7172111-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:22:07 2025 >> started Fri Feb 14 06:22:24 2025 >> done (17.063s) 16408214 read pairs processed; of these: 10876 ( 0.07%) short read pairs filtered out after trimming by size control 10597 ( 0.06%) empty read pairs filtered out after trimming by size control 16386741 (99.87%) read pairs available; of these: 7962863 (48.59%) trimmed read pairs available after processing 8423878 (51.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 5 0.00% 27 4 0.00% 28 2 0.00% 29 6 0.00% 30 7 0.00% 31 8 0.00% 32 3 0.00% 33 9 0.00% 34 3 0.00% 35 11 0.00% 36 3 0.00% 37 7 0.00% 38 6 0.00% 39 6 0.00% 40 4 0.00% 41 7 0.00% 42 14 0.00% 43 7 0.00% 44 12 0.00% 45 12 0.00% 46 9 0.00% 47 10 0.00% 48 17 0.00% 49 20 0.00% 50 15 0.00% 51 22 0.00% 52 22 0.00% 53 30 0.00% 54 48 0.00% 55 35 0.00% 56 39 0.00% 57 56 0.00% 58 64 0.00% 59 96 0.00% 60 72 0.00% 61 74 0.00% 62 102 0.00% 63 104 0.00% 64 123 0.00% 65 128 0.00% 66 190 0.00% 67 191 0.00% 68 195 0.00% 69 191 0.00% 70 250 0.00% 71 294 0.00% 72 318 0.00% 73 363 0.00% 74 474 0.00% 75 460 0.00% 76 595 0.00% 77 599 0.00% 78 724 0.00% 79 893 0.01% 80 929 0.01% 81 1098 0.01% 82 1238 0.01% 83 1584 0.01% 84 2611 0.02% 85 3088 0.02% 86 3265 0.02% 87 3668 0.02% 88 3827 0.02% 89 3988 0.02% 90 3897 0.02% 91 4186 0.03% 92 4700 0.03% 93 4951 0.03% 94 5276 0.03% 95 5676 0.03% 96 6196 0.04% 97 6717 0.04% 98 7462 0.05% 99 8231 0.05% 100 9462 0.06% 101 9243 0.06% 102 9647 0.06% 103 10487 0.06% 104 11010 0.07% 105 11796 0.07% 106 12795 0.08% 107 13557 0.08% 108 14130 0.09% 109 15166 0.09% 110 15780 0.10% 111 16488 0.10% 112 17368 0.11% 113 18823 0.11% 114 19623 0.12% 115 20928 0.13% 116 21840 0.13% 117 23015 0.14% 118 24171 0.15% 119 24843 0.15% 120 26079 0.16% 121 27642 0.17% 122 28674 0.17% 123 30072 0.18% 124 31778 0.19% 125 33131 0.20% 126 34835 0.21% 127 35896 0.22% 128 38064 0.23% 129 40091 0.24% 130 42235 0.26% 131 44609 0.27% 132 46974 0.29% 133 50362 0.31% 134 52849 0.32% 135 57176 0.35% 136 60945 0.37% 137 64809 0.40% 138 70012 0.43% 139 77452 0.47% 140 88719 0.54% 141 93034 0.57% 142 103196 0.63% 143 115816 0.71% 144 134531 0.82% 145 160967 0.98% 146 200471 1.22% 147 272677 1.66% 148 412733 2.52% 149 819073 5.00% 150 4258219 25.99% 151 8423878 51.41% 16386741 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=31 prefix-density=0.20 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=337.87 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=34.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.48 fanout-score-rank=20 prefix-density=0.35 prefix-fanout=4.2 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=196.51 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=26.6 sequence=GAGAAGAAGGAT SRR7172111 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:23:13 Started mapping on | Feb 14 06:23:14 Finished on | Feb 14 06:26:02 Mapping speed, Million of reads per hour | 351.14 Number of input reads | 16386741 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14932824 Uniquely mapped reads % | 91.13% Average mapped length | 295.39 Number of splices: Total | 14679418 Number of splices: Annotated (sjdb) | 14448406 Number of splices: GT/AG | 14445750 Number of splices: GC/AG | 180443 Number of splices: AT/AC | 9896 Number of splices: Non-canonical | 43329 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485574 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 44694 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.51% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 980804 980804 980804 N_multimapping 485574 485574 485574 N_noFeature 295951 14800926 342528 N_ambiguous 163265 601 77599 UnstrandedReadsAssigned:14473608 PositiveStrandReadsAssigned:131297 NegativeStrandReadsAssigned:14512697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172111 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172111-trimmed-pair1.fastq SRR7172111-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,386,741 reads, 14,437,928 reads pseudoaligned [quant] estimated average fragment length: 249.48 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52401 SRR7172111.ke.tsv 34699 SRR7172111.se.tsv 87100 total ==> SRR7172111.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.52 840 30.1965 Potri.005G024800.1.v4.1 1035 786.52 264 21.3515 Potri.004G059700.1.v4.1 961 712.555 37 3.30306 Potri.007G009000.2.v4.1 1416 1167.52 0 0 Potri.003G141000.2.v4.1 2943 2694.52 379.103 8.94971 Potri.016G087400.1.v4.1 270 76.2456 1396 1164.67 Potri.015G069301.1.v4.1 564 320.243 0 0 Potri.010G195200.1.v4.1 1773 1524.52 181 7.55229 Potri.012G127500.1.v4.1 977 728.535 2861 249.805 ==> SRR7172111.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 97 SRR7172111 completed mapping pipeline successfully