Starting /dee2/code/volunteer_pipeline.sh SRR7172112 current disk space = 3110538784768 free memory = 1573784040 SRR7172112 SRAfilesize c3ff44e08b240401d2bf983b97d467cb SRR7172112.sra SRR7172112.sra file validated SRR7172112 is paired end SRR7172112 is conventional basespace SRR7172112 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172112_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31925 33.0 33.0 34.0 31.0 34.0 2 32.97325 34.0 33.0 34.0 32.0 34.0 3 31.865 33.0 31.0 33.0 28.0 34.0 4 32.9615 33.0 33.0 34.0 32.0 34.0 5 32.945 33.0 33.0 34.0 32.0 34.0 6 36.6865 38.0 37.0 38.0 34.0 38.0 7 37.08025 38.0 37.0 38.0 35.0 38.0 8 37.48825 38.0 38.0 38.0 37.0 38.0 9 37.602 38.0 38.0 38.0 38.0 38.0 10-14 37.591350000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.624 38.0 38.0 38.0 38.0 38.0 20-24 37.5884 38.0 38.0 38.0 38.0 38.0 25-29 37.57895 38.0 38.0 38.0 37.8 38.0 30-34 37.5341 38.0 38.0 38.0 37.6 38.0 35-39 37.5148 38.0 38.0 38.0 37.2 38.0 40-44 37.49735 38.0 38.0 38.0 37.0 38.0 45-49 37.44045 38.0 38.0 38.0 37.0 38.0 50-54 37.333600000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.2529 38.0 38.0 38.0 36.2 38.0 60-64 37.1647 38.0 38.0 38.0 36.0 38.0 65-69 37.11280000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.00345 38.0 38.0 38.0 36.0 38.0 75-79 36.9834 38.0 38.0 38.0 35.6 38.0 80-84 36.87264999999999 38.0 38.0 38.0 35.2 38.0 85-89 36.77745 38.0 38.0 38.0 34.8 38.0 90-94 36.65445 38.0 38.0 38.0 34.2 38.0 95-99 36.55905 38.0 38.0 38.0 34.0 38.0 100-104 36.4005 38.0 37.4 38.0 34.0 38.0 105-109 36.1682 38.0 37.0 38.0 33.4 38.0 110-114 35.98405 38.0 37.0 38.0 33.0 38.0 115-119 35.8178 38.0 36.6 38.0 31.8 38.0 120-124 35.6331 38.0 36.0 38.0 30.6 38.0 125-129 35.3209 38.0 36.0 38.0 29.6 38.0 130-134 35.1467 38.0 35.6 38.0 28.8 38.0 135-139 34.780499999999996 38.0 35.0 38.0 28.0 38.0 140-144 34.10295 38.0 34.6 38.0 24.0 38.0 145-149 33.3986 38.0 34.0 38.0 20.4 38.0 150-151 29.62275 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 0.0 20 6.0 21 5.0 22 3.0 23 4.0 24 5.0 25 9.0 26 12.0 27 17.0 28 23.0 29 15.0 30 31.0 31 45.0 32 68.0 33 88.0 34 171.0 35 362.0 36 1016.0 37 2112.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.8496972887602 17.66254277441432 14.661753092919188 38.82600684390629 2 18.675 26.775 37.075 17.474999999999998 3 17.95 30.675 26.1 25.275 4 21.075 36.5 21.65 20.775 5 19.675 38.125 22.75 19.45 6 16.900000000000002 36.05 25.55 21.5 7 13.625000000000002 19.7 46.050000000000004 20.625 8 18.75 21.05 28.549999999999997 31.65 9 18.224999999999998 21.95 31.75 28.075 10-14 19.77 30.205 25.85 24.175 15-19 19.975 28.865000000000002 27.825 23.335 20-24 19.91 29.175 28.075 22.84 25-29 19.7 29.635 27.38 23.285 30-34 19.555 28.945 27.634999999999998 23.865 35-39 19.675 29.630000000000003 27.67 23.025000000000002 40-44 20.54 28.895 27.200000000000003 23.365 45-49 20.555 28.925 26.82 23.7 50-54 19.405 29.4 27.735 23.46 55-59 19.765 28.849999999999998 27.675 23.71 60-64 19.735 29.049999999999997 27.625 23.59 65-69 19.71 29.45 27.150000000000002 23.69 70-74 19.575 29.085 27.889999999999997 23.45 75-79 19.875 28.765 27.584999999999997 23.775 80-84 19.950000000000003 28.810000000000002 28.044999999999998 23.195 85-89 20.849999999999998 28.485 27.575 23.09 90-94 20.51 28.585 27.685 23.22 95-99 19.98 28.660000000000004 28.04 23.32 100-104 20.14 29.255 27.389999999999997 23.215 105-109 19.86 28.465 28.134999999999998 23.54 110-114 20.525 28.754999999999995 27.765 22.955000000000002 115-119 20.424999999999997 29.145 27.425 23.005 120-124 21.11 28.32 27.145000000000003 23.425 125-129 20.445 29.43 26.845000000000002 23.28 130-134 20.8 29.185 26.419999999999998 23.595 135-139 21.11 28.634999999999998 26.834999999999997 23.419999999999998 140-144 20.97 29.060000000000002 27.055 22.915 145-149 21.6 28.785 25.96 23.655 150-151 21.575 28.425 25.9875 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 2.0 22 2.5 23 3.0 24 4.0 25 5.0 26 5.0 27 8.0 28 9.0 29 12.0 30 29.0 31 44.5 32 50.0 33 54.5 34 60.5 35 76.5 36 101.5 37 126.5 38 145.5 39 170.0 40 198.5 41 222.0 42 245.0 43 265.5 44 277.5 45 247.5 46 245.5 47 259.5 48 227.5 49 189.0 50 151.0 51 121.0 52 106.0 53 95.5 54 67.0 55 45.5 56 38.5 57 24.5 58 15.0 59 15.0 60 11.0 61 5.0 62 2.5 63 2.5 64 2.0 65 2.0 66 1.5 67 1.5 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.525 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.4124999999999996 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 7.237500000000001 0.0 0.0 0.0 0.0 138-139 7.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172112 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172112_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28 34.0 33.0 34.0 33.0 34.0 2 33.38075 34.0 33.0 34.0 33.0 34.0 3 33.39325 34.0 33.0 34.0 33.0 34.0 4 33.36375 34.0 33.0 34.0 33.0 34.0 5 33.38275 34.0 33.0 34.0 33.0 34.0 6 37.4335 38.0 38.0 38.0 38.0 38.0 7 37.56525 38.0 38.0 38.0 38.0 38.0 8 37.5415 38.0 38.0 38.0 38.0 38.0 9 37.4995 38.0 38.0 38.0 38.0 38.0 10-14 37.52685 38.0 38.0 38.0 38.0 38.0 15-19 37.543000000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.51425 38.0 38.0 38.0 38.0 38.0 25-29 37.5083 38.0 38.0 38.0 38.0 38.0 30-34 37.50395 38.0 38.0 38.0 38.0 38.0 35-39 37.444050000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.41005 38.0 38.0 38.0 37.4 38.0 45-49 37.388400000000004 38.0 38.0 38.0 37.2 38.0 50-54 37.3302 38.0 38.0 38.0 37.0 38.0 55-59 37.2418 38.0 38.0 38.0 37.0 38.0 60-64 37.234249999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.194100000000006 38.0 38.0 38.0 36.8 38.0 70-74 37.0287 38.0 38.0 38.0 36.0 38.0 75-79 36.9981 38.0 38.0 38.0 36.0 38.0 80-84 36.91435 38.0 38.0 38.0 36.0 38.0 85-89 36.815749999999994 38.0 38.0 38.0 35.6 38.0 90-94 36.7029 38.0 38.0 38.0 35.0 38.0 95-99 36.60405 38.0 38.0 38.0 34.6 38.0 100-104 36.45205 38.0 38.0 38.0 34.0 38.0 105-109 36.30905 38.0 37.8 38.0 34.0 38.0 110-114 36.21135 38.0 37.6 38.0 33.8 38.0 115-119 36.02695 38.0 37.0 38.0 33.4 38.0 120-124 35.6225 38.0 36.8 38.0 31.0 38.0 125-129 35.49785 38.0 36.2 38.0 30.4 38.0 130-134 35.174099999999996 38.0 36.0 38.0 29.0 38.0 135-139 34.852000000000004 38.0 35.2 38.0 27.8 38.0 140-144 34.55114999999999 38.0 34.8 38.0 27.2 38.0 145-149 33.80625 38.0 34.0 38.0 24.4 38.0 150-151 29.39 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 0.0 16 4.0 17 5.0 18 0.0 19 5.0 20 4.0 21 5.0 22 4.0 23 6.0 24 15.0 25 9.0 26 11.0 27 15.0 28 11.0 29 24.0 30 34.0 31 38.0 32 68.0 33 84.0 34 139.0 35 279.0 36 692.0 37 2539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.550000000000004 13.4 17.45 35.6 2 22.225 21.9 38.75 17.125 3 20.45 24.95 31.424999999999997 23.175 4 24.175 33.925 21.25 20.65 5 22.575 37.325 22.875 17.224999999999998 6 17.9 38.0 24.275 19.825 7 17.474999999999998 14.899999999999999 45.5 22.125 8 19.675 21.55 29.9 28.875 9 22.875 22.75 27.900000000000002 26.474999999999998 10-14 22.900000000000002 28.71 26.905 21.485000000000003 15-19 23.1 27.67 28.044999999999998 21.185000000000002 20-24 22.455 27.965 28.689999999999998 20.89 25-29 22.814999999999998 27.77 27.98 21.435000000000002 30-34 22.17 27.474999999999998 29.080000000000002 21.275 35-39 22.634999999999998 28.084999999999997 28.384999999999998 20.895 40-44 23.189999999999998 27.42 28.42 20.97 45-49 22.675 28.005000000000003 28.12 21.2 50-54 23.875 27.215 28.720000000000002 20.19 55-59 23.080000000000002 27.865000000000002 28.485 20.57 60-64 23.39 27.884999999999998 27.735 20.990000000000002 65-69 23.244999999999997 27.55 28.475 20.73 70-74 23.674999999999997 28.194999999999997 27.965 20.165 75-79 23.57 27.54 28.17 20.72 80-84 23.52 28.08 28.305000000000003 20.095 85-89 23.46 27.675 28.525 20.34 90-94 23.175 28.345 27.944999999999997 20.535 95-99 23.47 27.265 28.785 20.48 100-104 23.575 27.589999999999996 28.634999999999998 20.200000000000003 105-109 23.64 27.534999999999997 28.405 20.419999999999998 110-114 23.45 27.875 28.275 20.4 115-119 23.97 27.36 28.49 20.18 120-124 23.935000000000002 27.900000000000002 28.49 19.675 125-129 24.665 28.355000000000004 27.51 19.470000000000002 130-134 24.610000000000003 27.67 27.775 19.945 135-139 23.965 27.775 28.29 19.97 140-144 24.57 27.85 27.839999999999996 19.74 145-149 24.775 28.305000000000003 27.325 19.595000000000002 150-151 26.200000000000003 27.400000000000002 26.9125 19.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.5 24 3.5 25 3.5 26 3.5 27 5.5 28 6.5 29 8.0 30 13.5 31 21.5 32 24.0 33 31.5 34 50.0 35 73.0 36 93.0 37 101.0 38 128.5 39 167.5 40 191.5 41 235.5 42 261.0 43 278.5 44 291.0 45 264.0 46 266.5 47 268.0 48 221.0 49 193.5 50 183.0 51 148.5 52 112.5 53 85.5 54 65.5 55 48.5 56 36.0 57 28.0 58 20.0 59 12.0 60 9.0 61 9.5 62 8.0 63 5.0 64 3.5 65 2.0 66 2.0 67 4.0 68 3.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 3.1 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.225 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 5.199999999999999 0.0 0.0 0.0 0.0 130-131 5.675000000000001 0.0 0.0 0.0 0.0 132-133 6.0125 0.0 0.0 0.0 0.0 134-135 6.487500000000001 0.0 0.0 0.0 0.0 136-137 7.262499999999999 0.0 0.0 0.0 0.0 138-139 7.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGAAC 10 0.006830828 145.0 8 AGATCGG 45 0.008957279 48.333332 145 AAAAAAA 35 0.0035366106 20.714287 70-74 >>END_MODULE Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580089 spots for SRR7172112.sra Written 580089 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra Read 580081 spots for SRR7172112.sra Written 580081 spots for SRR7172112.sra SRR ids: ['SRR7172112.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lrhb8ge2 SRR7172112.sra spots: 11601628 blocks: [[1, 580081], [580082, 1160162], [1160163, 1740243], [1740244, 2320324], [2320325, 2900405], [2900406, 3480486], [3480487, 4060567], [4060568, 4640648], [4640649, 5220729], [5220730, 5800810], [5800811, 6380891], [6380892, 6960972], [6960973, 7541053], [7541054, 8121134], [8121135, 8701215], [8701216, 9281296], [9281297, 9861377], [9861378, 10441458], [10441459, 11021539], [11021540, 11601628]] SRR7172112 file size 3909710 SRR7172112 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172112 SRR7172112_1.fastq SRR7172112_2.fastq Input file: SRR7172112_1.fastq Paired file: SRR7172112_2.fastq trimmed: SRR7172112-trimmed-pair1.fastq, SRR7172112-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:46:03 2025 >> started Fri Feb 14 18:46:22 2025 >> done (18.554s) 11601628 read pairs processed; of these: 4101 ( 0.04%) short read pairs filtered out after trimming by size control 3549 ( 0.03%) empty read pairs filtered out after trimming by size control 11593978 (99.93%) read pairs available; of these: 6881972 (59.36%) trimmed read pairs available after processing 4712006 (40.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 7 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 4 0.00% 28 3 0.00% 29 2 0.00% 30 6 0.00% 31 3 0.00% 32 4 0.00% 33 2 0.00% 34 3 0.00% 35 4 0.00% 36 6 0.00% 37 4 0.00% 38 3 0.00% 39 10 0.00% 40 6 0.00% 41 4 0.00% 42 17 0.00% 43 9 0.00% 44 6 0.00% 45 9 0.00% 46 12 0.00% 47 13 0.00% 48 18 0.00% 49 17 0.00% 50 18 0.00% 51 28 0.00% 52 28 0.00% 53 36 0.00% 54 31 0.00% 55 41 0.00% 56 45 0.00% 57 49 0.00% 58 63 0.00% 59 74 0.00% 60 94 0.00% 61 98 0.00% 62 114 0.00% 63 142 0.00% 64 145 0.00% 65 183 0.00% 66 181 0.00% 67 181 0.00% 68 243 0.00% 69 227 0.00% 70 332 0.00% 71 353 0.00% 72 460 0.00% 73 510 0.00% 74 599 0.01% 75 697 0.01% 76 822 0.01% 77 887 0.01% 78 984 0.01% 79 1066 0.01% 80 1224 0.01% 81 1410 0.01% 82 1690 0.01% 83 1929 0.02% 84 2265 0.02% 85 2736 0.02% 86 2916 0.03% 87 3276 0.03% 88 3567 0.03% 89 3997 0.03% 90 4371 0.04% 91 4782 0.04% 92 5217 0.04% 93 5816 0.05% 94 6244 0.05% 95 7064 0.06% 96 7387 0.06% 97 8133 0.07% 98 8435 0.07% 99 9152 0.08% 100 10079 0.09% 101 10678 0.09% 102 11667 0.10% 103 12308 0.11% 104 13126 0.11% 105 14190 0.12% 106 15000 0.13% 107 15858 0.14% 108 16737 0.14% 109 17557 0.15% 110 18489 0.16% 111 19156 0.17% 112 20125 0.17% 113 21354 0.18% 114 22370 0.19% 115 23776 0.21% 116 25194 0.22% 117 25829 0.22% 118 26700 0.23% 119 27852 0.24% 120 28774 0.25% 121 30161 0.26% 122 31417 0.27% 123 32999 0.28% 124 34289 0.30% 125 35759 0.31% 126 37603 0.32% 127 39711 0.34% 128 40980 0.35% 129 42999 0.37% 130 44804 0.39% 131 47164 0.41% 132 49246 0.42% 133 52360 0.45% 134 54772 0.47% 135 58093 0.50% 136 62330 0.54% 137 65636 0.57% 138 70393 0.61% 139 75620 0.65% 140 83186 0.72% 141 91332 0.79% 142 103661 0.89% 143 118005 1.02% 144 140964 1.22% 145 173428 1.50% 146 224357 1.94% 147 314644 2.71% 148 494196 4.26% 149 910663 7.85% 150 2823854 24.36% 151 4712006 40.64% 11593978 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.43 fanout-score-rank=12 prefix-density=0.42 prefix-fanout=3.5 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=368.21 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=32.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=26 prefix-density=0.34 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=129.50 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=16.6 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172112 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:48:17 Started mapping on | Feb 14 18:48:18 Finished on | Feb 14 18:49:52 Mapping speed, Million of reads per hour | 444.02 Number of input reads | 11593978 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10891337 Uniquely mapped reads % | 93.94% Average mapped length | 292.26 Number of splices: Total | 10645800 Number of splices: Annotated (sjdb) | 10453755 Number of splices: GT/AG | 10471185 Number of splices: GC/AG | 135989 Number of splices: AT/AC | 7192 Number of splices: Non-canonical | 31434 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310075 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 41390 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397021 397021 397021 N_multimapping 310075 310075 310075 N_noFeature 335007 10776027 398553 N_ambiguous 110908 639 58757 UnstrandedReadsAssigned:10445422 PositiveStrandReadsAssigned:114671 NegativeStrandReadsAssigned:10434027 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172112 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172112-trimmed-pair1.fastq SRR7172112-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,593,978 reads, 10,368,698 reads pseudoaligned [quant] estimated average fragment length: 229.653 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7172112.ke.tsv 34699 SRR7172112.se.tsv 87100 total ==> SRR7172112.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.35 678 36.277 Potri.005G024800.1.v4.1 1035 806.347 92 10.9235 Potri.004G059700.1.v4.1 961 732.352 13 1.69949 Potri.007G009000.2.v4.1 1416 1187.35 0 0 Potri.003G141000.2.v4.1 2943 2714.35 294 10.37 Potri.016G087400.1.v4.1 270 85.7374 713 796.187 Potri.015G069301.1.v4.1 564 338.917 0 0 Potri.010G195200.1.v4.1 1773 1544.35 169 10.477 Potri.012G127500.1.v4.1 977 748.347 10679 1366.23 ==> SRR7172112.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 115 SRR7172112 completed mapping pipeline successfully