Starting /dee2/code/volunteer_pipeline.sh SRR7172113 current disk space = 3085830356992 free memory = 1017348884 SRR7172113 SRAfilesize 04cae785fb2648e42142b3f5f3eccc4b SRR7172113.sra SRR7172113.sra file validated SRR7172113 is paired end SRR7172113 is conventional basespace SRR7172113 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172113_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.83425 32.0 18.0 33.0 18.0 34.0 2 30.40125 31.0 29.0 33.0 27.0 34.0 3 31.9485 33.0 31.0 33.0 29.0 34.0 4 32.79675 33.0 33.0 34.0 31.0 34.0 5 33.0025 33.0 33.0 34.0 32.0 34.0 6 37.258 38.0 38.0 38.0 36.0 38.0 7 37.477 38.0 38.0 38.0 37.0 38.0 8 37.61375 38.0 38.0 38.0 38.0 38.0 9 37.642 38.0 38.0 38.0 38.0 38.0 10-14 37.56945 38.0 38.0 38.0 38.0 38.0 15-19 37.6217 38.0 38.0 38.0 38.0 38.0 20-24 37.614200000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5116 38.0 38.0 38.0 37.8 38.0 30-34 37.5698 38.0 38.0 38.0 38.0 38.0 35-39 37.481899999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.322950000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.412099999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.3972 38.0 38.0 38.0 37.0 38.0 55-59 37.476749999999996 38.0 38.0 38.0 37.4 38.0 60-64 37.4443 38.0 38.0 38.0 37.0 38.0 65-69 37.396449999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.36370000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.3091 38.0 38.0 38.0 37.0 38.0 80-84 37.2159 38.0 38.0 38.0 36.6 38.0 85-89 37.06895000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.99125 38.0 38.0 38.0 36.0 38.0 95-99 36.88505 38.0 38.0 38.0 35.2 38.0 100-104 36.72474999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.7462 38.0 38.0 38.0 35.0 38.0 110-114 36.34875 38.0 38.0 38.0 34.2 38.0 115-119 35.874700000000004 38.0 37.2 38.0 31.6 38.0 120-124 36.28975 38.0 38.0 38.0 34.0 38.0 125-129 35.90749999999999 38.0 37.2 38.0 32.6 38.0 130-134 35.731899999999996 38.0 37.0 38.0 31.4 38.0 135-139 35.59689999999999 38.0 36.4 38.0 31.0 38.0 140-144 35.2403 38.0 36.0 38.0 31.0 38.0 145-149 34.734750000000005 38.0 35.8 38.0 29.4 38.0 150-151 30.17175 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 0.0 17 0.0 18 2.0 19 1.0 20 5.0 21 4.0 22 3.0 23 8.0 24 6.0 25 5.0 26 6.0 27 12.0 28 16.0 29 25.0 30 33.0 31 50.0 32 63.0 33 79.0 34 125.0 35 229.0 36 662.0 37 2662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.950000000000003 19.5 14.499999999999998 38.05 2 20.05 24.925 38.25 16.775000000000002 3 17.075000000000003 30.4 26.174999999999997 26.35 4 19.775000000000002 37.974999999999994 21.275 20.974999999999998 5 19.05 38.1 23.549999999999997 19.3 6 16.125 37.15 25.55 21.175 7 12.875 19.35 45.9 21.875 8 17.025000000000002 21.525 29.925 31.525 9 16.325 22.650000000000002 32.074999999999996 28.95 10-14 18.570427470217236 29.87286014616078 27.525277805586146 24.03143457803584 15-19 19.255 28.945 27.925 23.875 20-24 18.95 29.425 27.98 23.645 25-29 19.420971048552428 29.04145207260363 27.92139606980349 23.61618080904045 30-34 19.140957047852392 29.206460323016152 28.291414570728534 23.36116805840292 35-39 19.011901190119012 29.742974297429743 27.687768776877686 23.557355735573555 40-44 19.542931439715957 29.14937240586088 27.714157123568533 23.59353903085463 45-49 20.150000000000002 28.73 27.57 23.549999999999997 50-54 19.965 28.26 27.905 23.87 55-59 19.55 29.29 27.805000000000003 23.355 60-64 19.650000000000002 29.049999999999997 27.74 23.56 65-69 19.645000000000003 29.14 27.750000000000004 23.465 70-74 20.195 28.405 27.61 23.79 75-79 19.75 29.275000000000002 27.845 23.13 80-84 19.35693569356936 28.50785078507851 27.772777277727773 24.362436243624362 85-89 19.230769230769234 28.998699609882966 27.78333500050015 23.987196158847652 90-94 19.648929785957193 28.185637127425483 28.175635127025405 23.989797959591918 95-99 19.645000000000003 28.54 28.194999999999997 23.62 100-104 19.85694993247637 28.72005201820637 28.09983494222978 23.32316310708748 105-109 19.636963696369637 28.537853785378537 27.81278127812781 24.012401240124014 110-114 19.89652401044806 28.25999598151497 28.486035764516775 23.35744424352019 115-119 20.305611222444888 28.847695390781563 27.26452905811623 23.582164328657313 120-124 20.10703746311209 28.194868203871355 28.33491722102736 23.3631771119892 125-129 20.635079635380148 28.152859861765002 27.611940298507463 23.60012020434739 130-134 21.035 28.575 27.235 23.155 135-139 20.369999999999997 28.51 27.735 23.385 140-144 20.710177544386095 28.307076769192296 27.966991747936987 23.01575393848462 145-149 20.623249299719888 28.631452581032413 27.275910364145656 23.46938775510204 150-151 20.275000000000002 28.7375 27.0 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 1.0 24 3.5 25 7.0 26 7.0 27 9.0 28 15.0 29 18.5 30 21.0 31 26.5 32 40.5 33 55.0 34 67.5 35 83.0 36 112.0 37 136.5 38 153.0 39 182.5 40 197.0 41 234.0 42 265.0 43 267.0 44 280.0 45 286.0 46 263.5 47 236.0 48 212.5 49 167.0 50 139.5 51 126.0 52 105.0 53 73.5 54 47.5 55 43.0 56 34.0 57 22.0 58 15.0 59 10.5 60 8.0 61 6.5 62 5.0 63 2.0 64 1.5 65 2.0 66 2.0 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.11 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.01 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.03 90-94 0.02 95-99 0.0 100-104 0.034999999999999996 105-109 0.01 110-114 0.45999999999999996 115-119 0.2 120-124 0.034999999999999996 125-129 0.16999999999999998 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.04 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.4875 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172113 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172113_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1165 33.0 33.0 34.0 33.0 34.0 2 33.20775 34.0 33.0 34.0 33.0 34.0 3 33.229 34.0 33.0 34.0 33.0 34.0 4 33.14925 34.0 33.0 34.0 33.0 34.0 5 33.0765 34.0 33.0 34.0 33.0 34.0 6 37.27925 38.0 38.0 38.0 37.0 38.0 7 37.3255 38.0 38.0 38.0 38.0 38.0 8 37.3195 38.0 38.0 38.0 38.0 38.0 9 37.33175 38.0 38.0 38.0 38.0 38.0 10-14 37.371449999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.2998 38.0 38.0 38.0 37.8 38.0 20-24 37.2552 38.0 38.0 38.0 37.0 38.0 25-29 37.23185 38.0 38.0 38.0 37.0 38.0 30-34 37.27980000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.29215 38.0 38.0 38.0 37.0 38.0 40-44 37.18985 38.0 38.0 38.0 37.0 38.0 45-49 37.23235 38.0 38.0 38.0 37.0 38.0 50-54 37.23755 38.0 38.0 38.0 37.0 38.0 55-59 37.2162 38.0 38.0 38.0 37.0 38.0 60-64 37.205850000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.127449999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.11305 38.0 38.0 38.0 36.8 38.0 75-79 37.107 38.0 38.0 38.0 36.6 38.0 80-84 37.0027 38.0 38.0 38.0 36.2 38.0 85-89 36.8212 38.0 38.0 38.0 35.8 38.0 90-94 36.64540000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.5218 38.0 38.0 38.0 34.8 38.0 100-104 36.516000000000005 38.0 38.0 38.0 34.4 38.0 105-109 36.573449999999994 38.0 38.0 38.0 34.6 38.0 110-114 36.31425 38.0 38.0 38.0 34.0 38.0 115-119 36.22885 38.0 38.0 38.0 34.0 38.0 120-124 36.0964 38.0 38.0 38.0 33.2 38.0 125-129 35.762800000000006 38.0 37.0 38.0 31.2 38.0 130-134 35.37925 38.0 36.6 38.0 29.8 38.0 135-139 35.0101 38.0 36.0 38.0 28.6 38.0 140-144 34.54415 38.0 36.0 38.0 27.4 38.0 145-149 33.699799999999996 38.0 34.0 38.0 22.6 38.0 150-151 28.2695 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 2.0 12 0.0 13 0.0 14 0.0 15 2.0 16 3.0 17 3.0 18 5.0 19 2.0 20 6.0 21 7.0 22 7.0 23 3.0 24 11.0 25 1.0 26 11.0 27 15.0 28 27.0 29 37.0 30 36.0 31 49.0 32 60.0 33 80.0 34 149.0 35 228.0 36 559.0 37 2683.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.050000000000004 14.95 18.125 33.875 2 22.73068267066767 23.43085771442861 37.23430857714429 16.60415103775944 3 19.779944986246562 25.831457864466117 32.358089522380595 22.030507626906726 4 24.537268634317158 34.567283641820914 20.38519259629815 20.51025512756378 5 23.34834834834835 37.83783783783784 22.02202202202202 16.79179179179179 6 16.892230576441104 37.719298245614034 25.213032581453632 20.175438596491226 7 15.73934837092732 16.015037593984964 47.192982456140356 21.052631578947366 8 20.696567276371837 22.199949887246305 28.589325983462793 28.514156852919072 9 23.527937860185418 23.552994237033325 28.73966424455024 24.17940365823102 10-14 22.565618112602685 28.791825285513927 26.748146663995193 21.8944099378882 15-19 22.70313595832081 28.308786694719966 28.118425007514276 20.869652339444944 20-24 22.756410256410255 28.46053685897436 27.82952724358974 20.953525641025642 25-29 22.819563912782556 28.29565913182637 28.42068413682737 20.46409281856371 30-34 22.555 28.1 28.4 20.945 35-39 23.23 28.34 27.994999999999997 20.435 40-44 22.345000000000002 27.474999999999998 29.275000000000002 20.905 45-49 22.734546909381876 28.310662132426483 28.305661132226444 20.649129825965193 50-54 23.150000000000002 27.965 27.935 20.95 55-59 23.369999999999997 28.194999999999997 27.560000000000002 20.875 60-64 23.205000000000002 27.560000000000002 28.939999999999998 20.294999999999998 65-69 22.994999999999997 28.475 28.15 20.380000000000003 70-74 23.815 28.12 27.685 20.380000000000003 75-79 23.175 28.465 27.985 20.375 80-84 23.48 27.735 28.71 20.075000000000003 85-89 23.22 28.32 28.299999999999997 20.16 90-94 22.805 28.21 28.33 20.655 95-99 23.62 27.744999999999997 28.575 20.06 100-104 23.645 28.134999999999998 27.975 20.244999999999997 105-109 23.425 28.095 28.29 20.19 110-114 23.235 27.935 28.395 20.435 115-119 24.12 27.71 28.185 19.985 120-124 23.665 28.335 27.92 20.080000000000002 125-129 23.494999999999997 27.83 28.499999999999996 20.175 130-134 23.94 27.925 28.055000000000003 20.080000000000002 135-139 24.265 28.025 28.465 19.245 140-144 24.865000000000002 27.975 27.52 19.64 145-149 25.365 27.860000000000003 27.67 19.105 150-151 24.4125 28.487499999999997 28.125 18.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 3.0 26 5.0 27 7.0 28 9.5 29 12.0 30 15.0 31 16.5 32 20.5 33 37.0 34 63.0 35 74.5 36 90.0 37 117.5 38 149.5 39 182.0 40 207.0 41 244.5 42 274.0 43 277.5 44 276.0 45 280.0 46 273.5 47 249.0 48 217.0 49 186.0 50 165.5 51 136.0 52 102.5 53 75.5 54 62.0 55 49.5 56 27.0 57 20.0 58 15.0 59 13.0 60 13.0 61 10.5 62 6.0 63 2.5 64 2.0 65 0.5 66 2.0 67 2.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.05 5 0.1 6 0.25 7 0.25 8 0.22499999999999998 9 0.22499999999999998 10-14 0.18 15-19 0.19 20-24 0.16 25-29 0.02 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.9625000000000004 0.0 0.0 0.0 0.0 138-139 4.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769587 spots for SRR7172113.sra Written 769587 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra Read 769573 spots for SRR7172113.sra Written 769573 spots for SRR7172113.sra SRR ids: ['SRR7172113.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6hnorz_h SRR7172113.sra spots: 15391474 blocks: [[1, 769573], [769574, 1539146], [1539147, 2308719], [2308720, 3078292], [3078293, 3847865], [3847866, 4617438], [4617439, 5387011], [5387012, 6156584], [6156585, 6926157], [6926158, 7695730], [7695731, 8465303], [8465304, 9234876], [9234877, 10004449], [10004450, 10774022], [10774023, 11543595], [11543596, 12313168], [12313169, 13082741], [13082742, 13852314], [13852315, 14621887], [14621888, 15391474]] SRR7172113 file size 5193965 SRR7172113 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172113 SRR7172113_1.fastq SRR7172113_2.fastq Input file: SRR7172113_1.fastq Paired file: SRR7172113_2.fastq trimmed: SRR7172113-trimmed-pair1.fastq, SRR7172113-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:44:27 2025 >> started Fri Feb 14 05:44:46 2025 >> done (19.368s) 15391474 read pairs processed; of these: 7654 ( 0.05%) short read pairs filtered out after trimming by size control 7118 ( 0.05%) empty read pairs filtered out after trimming by size control 15376702 (99.90%) read pairs available; of these: 7872644 (51.20%) trimmed read pairs available after processing 7504058 (48.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 2 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 4 0.00% 31 5 0.00% 32 5 0.00% 33 3 0.00% 34 3 0.00% 35 2 0.00% 36 6 0.00% 37 4 0.00% 38 7 0.00% 39 3 0.00% 40 8 0.00% 41 7 0.00% 42 11 0.00% 43 5 0.00% 44 8 0.00% 45 6 0.00% 46 9 0.00% 47 7 0.00% 48 11 0.00% 49 12 0.00% 50 17 0.00% 51 13 0.00% 52 12 0.00% 53 30 0.00% 54 21 0.00% 55 21 0.00% 56 31 0.00% 57 33 0.00% 58 39 0.00% 59 42 0.00% 60 48 0.00% 61 60 0.00% 62 75 0.00% 63 78 0.00% 64 77 0.00% 65 102 0.00% 66 120 0.00% 67 117 0.00% 68 131 0.00% 69 149 0.00% 70 189 0.00% 71 221 0.00% 72 228 0.00% 73 310 0.00% 74 312 0.00% 75 408 0.00% 76 432 0.00% 77 460 0.00% 78 577 0.00% 79 648 0.00% 80 821 0.01% 81 864 0.01% 82 1048 0.01% 83 1263 0.01% 84 1816 0.01% 85 2155 0.01% 86 2423 0.02% 87 2422 0.02% 88 2723 0.02% 89 3054 0.02% 90 3097 0.02% 91 3513 0.02% 92 3676 0.02% 93 3934 0.03% 94 4339 0.03% 95 4675 0.03% 96 5232 0.03% 97 5685 0.04% 98 6141 0.04% 99 6279 0.04% 100 7129 0.05% 101 7784 0.05% 102 8179 0.05% 103 8871 0.06% 104 9357 0.06% 105 10290 0.07% 106 11045 0.07% 107 11460 0.07% 108 12147 0.08% 109 12751 0.08% 110 13608 0.09% 111 14535 0.09% 112 15290 0.10% 113 16074 0.10% 114 16911 0.11% 115 18108 0.12% 116 19053 0.12% 117 20437 0.13% 118 21336 0.14% 119 22200 0.14% 120 23365 0.15% 121 24706 0.16% 122 25896 0.17% 123 26938 0.18% 124 28842 0.19% 125 30227 0.20% 126 31935 0.21% 127 33502 0.22% 128 35100 0.23% 129 37583 0.24% 130 39224 0.26% 131 41426 0.27% 132 44612 0.29% 133 48118 0.31% 134 51513 0.34% 135 55849 0.36% 136 61376 0.40% 137 63854 0.42% 138 68362 0.44% 139 74908 0.49% 140 79681 0.52% 141 86377 0.56% 142 96509 0.63% 143 109066 0.71% 144 127297 0.83% 145 150794 0.98% 146 189762 1.23% 147 259698 1.69% 148 399527 2.60% 149 803512 5.23% 150 4376206 28.46% 151 7504058 48.80% 15376702 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=18 prefix-density=0.35 prefix-fanout=3.4 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=13.05 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=3.0 sequence=TCCTTCTGGATATTGTAGTCTGCCAGGGTGCGCCCAT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=32 prefix-density=0.49 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=26.18 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172113 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:45:41 Started mapping on | Feb 14 05:45:42 Finished on | Feb 14 05:48:31 Mapping speed, Million of reads per hour | 327.55 Number of input reads | 15376702 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14262738 Uniquely mapped reads % | 92.76% Average mapped length | 295.53 Number of splices: Total | 13910724 Number of splices: Annotated (sjdb) | 13627981 Number of splices: GT/AG | 13682699 Number of splices: GC/AG | 179700 Number of splices: AT/AC | 10241 Number of splices: Non-canonical | 38084 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.17 Insertion rate per base | 0.03% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402802 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 58934 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 720123 720123 720123 N_multimapping 402802 402802 402802 N_noFeature 463028 14117387 526779 N_ambiguous 160868 912 78774 UnstrandedReadsAssigned:13638842 PositiveStrandReadsAssigned:144439 NegativeStrandReadsAssigned:13657185 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172113 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172113-trimmed-pair1.fastq SRR7172113-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,376,702 reads, 13,562,430 reads pseudoaligned [quant] estimated average fragment length: 253.262 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7172113.ke.tsv 34699 SRR7172113.se.tsv 87100 total ==> SRR7172113.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.74 1234 49.3649 Potri.005G024800.1.v4.1 1035 782.738 258 23.2827 Potri.004G059700.1.v4.1 961 708.784 20 1.99317 Potri.007G009000.2.v4.1 1416 1163.74 0 0 Potri.003G141000.2.v4.1 2943 2690.74 461 12.102 Potri.016G087400.1.v4.1 270 75.6736 908 847.56 Potri.015G069301.1.v4.1 564 317.409 0 0 Potri.010G195200.1.v4.1 1773 1520.74 477 22.1561 Potri.012G127500.1.v4.1 977 724.774 7105 692.453 ==> SRR7172113.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 58 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 292 SRR7172113 completed mapping pipeline successfully