Starting /dee2/code/volunteer_pipeline.sh SRR7172114 current disk space = 3085709959168 free memory = 1449557556 SRR7172114 SRAfilesize c3db1537a809ac8f91d1c1f63624a139 SRR7172114.sra SRR7172114.sra file validated SRR7172114 is paired end SRR7172114 is conventional basespace SRR7172114 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172114_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6295 33.0 33.0 34.0 32.0 34.0 2 32.94925 34.0 33.0 34.0 31.0 34.0 3 32.542 33.0 33.0 34.0 31.0 34.0 4 33.001 33.0 33.0 34.0 32.0 34.0 5 32.47225 33.0 33.0 33.0 31.0 34.0 6 36.76975 38.0 37.0 38.0 34.0 38.0 7 37.05125 38.0 37.0 38.0 35.0 38.0 8 37.61425 38.0 38.0 38.0 37.0 38.0 9 37.65375 38.0 38.0 38.0 38.0 38.0 10-14 37.649249999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.6915 38.0 38.0 38.0 38.0 38.0 20-24 37.68124999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.62884999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.60405 38.0 38.0 38.0 38.0 38.0 35-39 37.597300000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.57039999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.56 38.0 38.0 38.0 38.0 38.0 50-54 37.43705 38.0 38.0 38.0 37.2 38.0 55-59 37.37575 38.0 38.0 38.0 37.0 38.0 60-64 37.34765 38.0 38.0 38.0 37.0 38.0 65-69 37.21055 38.0 38.0 38.0 36.2 38.0 70-74 37.2224 38.0 38.0 38.0 36.2 38.0 75-79 37.12065 38.0 38.0 38.0 36.0 38.0 80-84 37.1022 38.0 38.0 38.0 36.0 38.0 85-89 36.9981 38.0 38.0 38.0 35.8 38.0 90-94 36.93205 38.0 38.0 38.0 35.6 38.0 95-99 36.81660000000001 38.0 38.0 38.0 35.2 38.0 100-104 36.65965 38.0 38.0 38.0 34.6 38.0 105-109 36.40675 38.0 38.0 38.0 34.0 38.0 110-114 36.32775 38.0 37.8 38.0 33.8 38.0 115-119 36.082100000000004 38.0 37.0 38.0 33.2 38.0 120-124 35.959450000000004 38.0 37.0 38.0 32.6 38.0 125-129 35.8078 38.0 36.4 38.0 31.8 38.0 130-134 35.454550000000005 38.0 36.0 38.0 30.4 38.0 135-139 35.1553 38.0 35.8 38.0 29.4 38.0 140-144 34.9755 38.0 35.6 38.0 28.6 38.0 145-149 34.34075 38.0 35.0 38.0 26.2 38.0 150-151 30.694375 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 3.0 19 3.0 20 1.0 21 3.0 22 3.0 23 4.0 24 5.0 25 8.0 26 21.0 27 10.0 28 24.0 29 15.0 30 37.0 31 38.0 32 34.0 33 78.0 34 137.0 35 263.0 36 738.0 37 2571.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.46290491118077 15.491118077324975 16.901776384535005 41.14420062695925 2 18.425 24.025 39.300000000000004 18.25 3 18.35 29.325000000000003 25.224999999999998 27.1 4 21.75 36.3 21.05 20.9 5 20.349999999999998 36.275 25.25 18.125 6 16.625 36.5 25.074999999999996 21.8 7 12.5 21.075 45.925 20.5 8 18.55 20.7 28.9 31.85 9 17.375 21.15 32.0 29.475 10-14 19.495 29.849999999999998 26.995 23.66 15-19 19.655 28.904999999999998 27.815 23.625 20-24 19.46 29.165000000000003 28.000000000000004 23.375 25-29 20.395 28.865000000000002 27.63 23.11 30-34 19.975 28.84 27.500000000000004 23.685000000000002 35-39 20.005 28.37 28.110000000000003 23.515 40-44 20.285 28.754999999999995 27.66 23.3 45-49 19.814999999999998 29.104999999999997 26.995 24.085 50-54 20.294999999999998 28.565 27.800000000000004 23.34 55-59 20.294999999999998 28.82 27.515 23.369999999999997 60-64 20.005 28.92 27.36 23.715 65-69 20.25 28.46 27.889999999999997 23.400000000000002 70-74 20.23 29.049999999999997 27.560000000000002 23.16 75-79 19.814999999999998 28.585 27.62 23.98 80-84 20.255000000000003 28.605000000000004 27.389999999999997 23.75 85-89 20.01 29.134999999999998 27.33 23.525 90-94 20.31 28.244999999999997 27.845 23.599999999999998 95-99 20.84 28.255000000000003 27.694999999999997 23.21 100-104 21.099999999999998 28.08 27.275 23.544999999999998 105-109 19.895 28.405 28.265 23.435 110-114 20.46 28.265 27.43 23.845 115-119 20.635 28.27 27.485 23.61 120-124 20.155 29.165000000000003 27.32 23.36 125-129 21.08 28.439999999999998 27.279999999999998 23.200000000000003 130-134 20.605 29.13 26.97 23.294999999999998 135-139 20.68 28.365000000000002 27.295 23.66 140-144 20.89 28.315 27.389999999999997 23.405 145-149 21.060000000000002 28.575 27.029999999999998 23.335 150-151 21.8 28.5625 26.575 23.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 2.0 22 2.5 23 2.0 24 3.0 25 5.0 26 7.5 27 10.0 28 8.5 29 10.0 30 14.5 31 18.0 32 27.5 33 42.5 34 57.5 35 86.5 36 113.5 37 127.5 38 147.5 39 171.0 40 202.0 41 236.0 42 262.5 43 263.5 44 268.0 45 273.5 46 253.5 47 231.0 48 211.5 49 193.5 50 159.5 51 126.0 52 111.5 53 89.5 54 66.0 55 48.0 56 34.5 57 28.0 58 23.5 59 17.5 60 9.5 61 6.0 62 4.5 63 3.0 64 3.0 65 4.0 66 4.0 67 2.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.9750000000000001 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4875 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.6625 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.0875000000000004 0.0 0.0 0.0 0.0 138-139 3.6500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTGG 10 0.006841402 144.925 3 CTCCCAG 10 0.006841402 144.925 145 >>END_MODULE SRR7172114 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172114_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33125 34.0 33.0 34.0 33.0 34.0 2 33.43925 34.0 33.0 34.0 33.0 34.0 3 33.44025 34.0 33.0 34.0 33.0 34.0 4 33.40025 34.0 33.0 34.0 33.0 34.0 5 33.4175 34.0 33.0 34.0 33.0 34.0 6 37.5765 38.0 38.0 38.0 38.0 38.0 7 37.601 38.0 38.0 38.0 38.0 38.0 8 37.618 38.0 38.0 38.0 38.0 38.0 9 37.57875 38.0 38.0 38.0 38.0 38.0 10-14 37.616749999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.5625 38.0 38.0 38.0 38.0 38.0 20-24 37.5472 38.0 38.0 38.0 38.0 38.0 25-29 37.5111 38.0 38.0 38.0 38.0 38.0 30-34 37.480650000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.449 38.0 38.0 38.0 38.0 38.0 40-44 37.44225 38.0 38.0 38.0 38.0 38.0 45-49 37.413599999999995 38.0 38.0 38.0 37.6 38.0 50-54 37.381299999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.35735 38.0 38.0 38.0 37.0 38.0 60-64 37.22835 38.0 38.0 38.0 37.0 38.0 65-69 37.20694999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.18115 38.0 38.0 38.0 36.8 38.0 75-79 37.042449999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.0036 38.0 38.0 38.0 36.0 38.0 85-89 36.893550000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.87445 38.0 38.0 38.0 35.8 38.0 95-99 36.76065 38.0 38.0 38.0 35.0 38.0 100-104 36.7481 38.0 38.0 38.0 35.0 38.0 105-109 36.6139 38.0 38.0 38.0 34.6 38.0 110-114 36.432599999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.2389 38.0 37.6 38.0 33.6 38.0 120-124 35.99035 38.0 37.0 38.0 33.0 38.0 125-129 35.6721 38.0 36.6 38.0 31.0 38.0 130-134 35.3073 38.0 36.0 38.0 30.0 38.0 135-139 34.99745 38.0 35.6 38.0 28.2 38.0 140-144 34.629599999999996 38.0 35.0 38.0 27.4 38.0 145-149 33.9745 38.0 34.2 38.0 25.6 38.0 150-151 30.252125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 0.0 19 2.0 20 5.0 21 4.0 22 3.0 23 8.0 24 9.0 25 10.0 26 10.0 27 19.0 28 27.0 29 19.0 30 30.0 31 48.0 32 63.0 33 60.0 34 138.0 35 223.0 36 612.0 37 2700.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.25 12.725 20.849999999999998 36.175000000000004 2 22.5 21.349999999999998 39.475 16.675 3 20.225 25.174999999999997 31.15 23.45 4 23.974999999999998 33.875 21.3 20.849999999999998 5 22.875 37.225 22.425 17.474999999999998 6 16.85 37.3 24.95 20.9 7 16.45 14.85 46.7 22.0 8 21.05 21.175 27.250000000000004 30.525000000000002 9 21.175 23.474999999999998 30.3 25.05 10-14 22.634999999999998 28.835 26.834999999999997 21.695 15-19 22.945 28.244999999999997 27.694999999999997 21.115000000000002 20-24 23.035 28.475 28.050000000000004 20.44 25-29 22.655 28.134999999999998 28.139999999999997 21.07 30-34 22.43 28.165000000000003 28.52 20.885 35-39 22.81 27.865000000000002 27.98 21.345 40-44 22.650000000000002 28.189999999999998 28.244999999999997 20.915 45-49 22.634999999999998 28.27 28.565 20.53 50-54 23.205000000000002 27.215 28.15 21.43 55-59 22.655 28.244999999999997 28.15 20.95 60-64 22.99 28.37 27.82 20.82 65-69 23.705000000000002 27.71 27.715 20.87 70-74 23.565 27.41 27.750000000000004 21.275 75-79 23.035 27.91 28.494999999999997 20.560000000000002 80-84 23.345 27.634999999999998 27.994999999999997 21.025 85-89 23.580000000000002 27.63 28.055000000000003 20.735 90-94 23.965 27.98 27.584999999999997 20.47 95-99 23.369999999999997 27.925 27.87 20.835 100-104 23.474999999999998 27.425 28.68 20.419999999999998 105-109 23.09 28.33 27.85 20.73 110-114 23.69 28.285 27.560000000000002 20.465 115-119 23.885 27.82 27.985 20.31 120-124 23.49 28.335 28.249999999999996 19.925 125-129 23.064999999999998 28.595 27.515 20.825 130-134 24.279999999999998 27.650000000000002 27.755000000000003 20.315 135-139 24.465 27.62 28.134999999999998 19.78 140-144 24.34 28.134999999999998 27.634999999999998 19.89 145-149 24.51 28.044999999999998 27.845 19.6 150-151 25.074999999999996 26.7625 27.6625 20.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 1.0 23 0.5 24 1.0 25 0.5 26 1.5 27 4.5 28 5.0 29 6.5 30 11.5 31 13.5 32 19.5 33 39.0 34 57.5 35 65.5 36 78.5 37 107.5 38 142.5 39 165.0 40 195.5 41 237.0 42 258.5 43 287.5 44 299.0 45 284.0 46 263.5 47 258.5 48 246.5 49 199.0 50 154.5 51 128.5 52 104.0 53 74.5 54 56.5 55 51.0 56 46.0 57 36.0 58 32.5 59 20.5 60 8.5 61 6.0 62 3.5 63 4.0 64 5.0 65 5.0 66 4.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.9750000000000001 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.8125 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.5999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCACA 10 0.006830828 145.0 4 >>END_MODULE Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443872 spots for SRR7172114.sra Written 443872 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra Read 443868 spots for SRR7172114.sra Written 443868 spots for SRR7172114.sra SRR ids: ['SRR7172114.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nc86tcrq SRR7172114.sra spots: 8877364 blocks: [[1, 443868], [443869, 887736], [887737, 1331604], [1331605, 1775472], [1775473, 2219340], [2219341, 2663208], [2663209, 3107076], [3107077, 3550944], [3550945, 3994812], [3994813, 4438680], [4438681, 4882548], [4882549, 5326416], [5326417, 5770284], [5770285, 6214152], [6214153, 6658020], [6658021, 7101888], [7101889, 7545756], [7545757, 7989624], [7989625, 8433492], [8433493, 8877364]] SRR7172114 file size 2988739 SRR7172114 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172114 SRR7172114_1.fastq SRR7172114_2.fastq Input file: SRR7172114_1.fastq Paired file: SRR7172114_2.fastq trimmed: SRR7172114-trimmed-pair1.fastq, SRR7172114-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:50:36 2025 >> started Fri Feb 14 05:50:45 2025 >> done (9.537s) 8877364 read pairs processed; of these: 1969 ( 0.02%) short read pairs filtered out after trimming by size control 1750 ( 0.02%) empty read pairs filtered out after trimming by size control 8873645 (99.96%) read pairs available; of these: 4267228 (48.09%) trimmed read pairs available after processing 4606417 (51.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 5 0.00% 25 1 0.00% 26 2 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 1 0.00% 36 1 0.00% 37 2 0.00% 38 4 0.00% 39 4 0.00% 40 2 0.00% 41 7 0.00% 42 2 0.00% 43 4 0.00% 44 3 0.00% 45 5 0.00% 46 9 0.00% 47 4 0.00% 48 0 0.00% 49 7 0.00% 50 5 0.00% 51 8 0.00% 52 5 0.00% 53 11 0.00% 54 15 0.00% 55 6 0.00% 56 11 0.00% 57 20 0.00% 58 17 0.00% 59 19 0.00% 60 20 0.00% 61 28 0.00% 62 45 0.00% 63 39 0.00% 64 48 0.00% 65 56 0.00% 66 50 0.00% 67 53 0.00% 68 66 0.00% 69 88 0.00% 70 99 0.00% 71 95 0.00% 72 131 0.00% 73 148 0.00% 74 171 0.00% 75 218 0.00% 76 266 0.00% 77 302 0.00% 78 274 0.00% 79 297 0.00% 80 372 0.00% 81 399 0.00% 82 524 0.01% 83 572 0.01% 84 731 0.01% 85 915 0.01% 86 1016 0.01% 87 1217 0.01% 88 1269 0.01% 89 1424 0.02% 90 1469 0.02% 91 1637 0.02% 92 1816 0.02% 93 1923 0.02% 94 2109 0.02% 95 2290 0.03% 96 2457 0.03% 97 2781 0.03% 98 2896 0.03% 99 3185 0.04% 100 3472 0.04% 101 3552 0.04% 102 3889 0.04% 103 4234 0.05% 104 4407 0.05% 105 4921 0.06% 106 5299 0.06% 107 5520 0.06% 108 6017 0.07% 109 6279 0.07% 110 6702 0.08% 111 7101 0.08% 112 7563 0.09% 113 8088 0.09% 114 8486 0.10% 115 9094 0.10% 116 9687 0.11% 117 10126 0.11% 118 10497 0.12% 119 10957 0.12% 120 11413 0.13% 121 12172 0.14% 122 12641 0.14% 123 13444 0.15% 124 14534 0.16% 125 15248 0.17% 126 16092 0.18% 127 17067 0.19% 128 17848 0.20% 129 19522 0.22% 130 20543 0.23% 131 21600 0.24% 132 22910 0.26% 133 24486 0.28% 134 26287 0.30% 135 27620 0.31% 136 29972 0.34% 137 31950 0.36% 138 34918 0.39% 139 37125 0.42% 140 40687 0.46% 141 45184 0.51% 142 50848 0.57% 143 58420 0.66% 144 69367 0.78% 145 85544 0.96% 146 111908 1.26% 147 159355 1.80% 148 260914 2.94% 149 546545 6.16% 150 2241483 25.26% 151 4606417 51.91% 8873645 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=28 prefix-density=0.27 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=25.20 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=6.8 sequence=CACCATCATTGTAAAGGAACAACTGAG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=3.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=74.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.6 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7172114 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:51:33 Started mapping on | Feb 14 05:51:34 Finished on | Feb 14 05:53:05 Mapping speed, Million of reads per hour | 351.05 Number of input reads | 8873645 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 8244636 Uniquely mapped reads % | 92.91% Average mapped length | 296.19 Number of splices: Total | 8117791 Number of splices: Annotated (sjdb) | 7971468 Number of splices: GT/AG | 7990496 Number of splices: GC/AG | 99913 Number of splices: AT/AC | 5937 Number of splices: Non-canonical | 21445 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232584 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 25740 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399486 399486 399486 N_multimapping 232584 232584 232584 N_noFeature 217393 8165123 250500 N_ambiguous 87912 462 41220 UnstrandedReadsAssigned:7939331 PositiveStrandReadsAssigned:79051 NegativeStrandReadsAssigned:7952916 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172114 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172114-trimmed-pair1.fastq SRR7172114-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,873,645 reads, 7,897,675 reads pseudoaligned [quant] estimated average fragment length: 260.596 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR7172114.ke.tsv 34699 SRR7172114.se.tsv 87100 total ==> SRR7172114.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.4 712 49.2917 Potri.005G024800.1.v4.1 1035 775.404 173 27.1601 Potri.004G059700.1.v4.1 961 701.459 8 1.38835 Potri.007G009000.2.v4.1 1416 1156.4 0 0 Potri.003G141000.2.v4.1 2943 2683.4 282 12.7931 Potri.016G087400.1.v4.1 270 72.3071 711 1197.02 Potri.015G069301.1.v4.1 564 310.938 0 0 Potri.010G195200.1.v4.1 1773 1513.4 148 11.9047 Potri.012G127500.1.v4.1 977 717.429 3223 546.882 ==> SRR7172114.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 115 SRR7172114 completed mapping pipeline successfully