Starting /dee2/code/volunteer_pipeline.sh SRR7172115 current disk space = 3085697159168 free memory = 1486966416 SRR7172115 SRAfilesize 29a79a3d5685fd021e38127621efa14e SRR7172115.sra SRR7172115.sra file validated SRR7172115 is paired end SRR7172115 is conventional basespace SRR7172115 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172115_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1345 34.0 33.0 34.0 32.0 34.0 2 33.3535 34.0 33.0 34.0 33.0 34.0 3 33.208 34.0 33.0 34.0 32.0 34.0 4 33.2315 34.0 33.0 34.0 33.0 34.0 5 33.32775 34.0 33.0 34.0 33.0 34.0 6 37.07125 38.0 38.0 38.0 36.0 38.0 7 37.48475 38.0 38.0 38.0 37.0 38.0 8 37.50675 38.0 38.0 38.0 37.0 38.0 9 37.37675 38.0 38.0 38.0 38.0 38.0 10-14 37.49675 38.0 38.0 38.0 37.8 38.0 15-19 37.5345 38.0 38.0 38.0 37.6 38.0 20-24 37.451800000000006 38.0 38.0 38.0 37.2 38.0 25-29 37.39655 38.0 38.0 38.0 37.2 38.0 30-34 37.3076 38.0 38.0 38.0 37.0 38.0 35-39 37.215399999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.2436 38.0 38.0 38.0 36.8 38.0 45-49 37.1514 38.0 38.0 38.0 36.8 38.0 50-54 37.25905 38.0 38.0 38.0 37.0 38.0 55-59 37.284000000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.15415 38.0 38.0 38.0 36.2 38.0 65-69 37.20195 38.0 38.0 38.0 36.8 38.0 70-74 37.14874999999999 38.0 38.0 38.0 36.2 38.0 75-79 36.956599999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.92545 38.0 38.0 38.0 36.0 38.0 85-89 36.86505 38.0 38.0 38.0 35.6 38.0 90-94 36.690099999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.66289999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.47235 38.0 38.0 38.0 34.0 38.0 105-109 36.4525 38.0 38.0 38.0 34.0 38.0 110-114 36.1249 38.0 37.8 38.0 33.6 38.0 115-119 36.0608 38.0 37.2 38.0 33.0 38.0 120-124 35.773649999999996 38.0 37.0 38.0 32.2 38.0 125-129 35.41645 38.0 36.0 38.0 31.0 38.0 130-134 35.3842 38.0 36.0 38.0 31.0 38.0 135-139 34.9353 38.0 36.0 38.0 28.6 38.0 140-144 34.4899 38.0 35.0 38.0 27.4 38.0 145-149 33.887 38.0 34.6 38.0 24.4 38.0 150-151 28.566375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 1.0 17 2.0 18 1.0 19 6.0 20 3.0 21 4.0 22 5.0 23 4.0 24 7.0 25 20.0 26 13.0 27 22.0 28 22.0 29 26.0 30 39.0 31 55.0 32 79.0 33 104.0 34 155.0 35 252.0 36 595.0 37 2576.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.375000000000004 17.349999999999998 14.924999999999999 37.35 2 19.05 24.6 38.375 17.974999999999998 3 17.2 30.925000000000004 29.4 22.475 4 21.780445111277817 36.134033508377094 22.18054513628407 19.904976244061015 5 20.275000000000002 37.625 22.625 19.475 6 17.675 36.0 25.374999999999996 20.95 7 12.325 19.950000000000003 47.375 20.349999999999998 8 18.3 20.875 29.375 31.45 9 16.90954773869347 22.311557788944725 32.462311557788944 28.316582914572862 10-14 19.4379156873531 29.94949242386358 26.428964344651696 24.18362754413162 15-19 19.86 28.560000000000002 27.794999999999998 23.785 20-24 19.564999999999998 28.505000000000003 28.22 23.71 25-29 19.28096404820241 28.991449572478622 28.146407320366016 23.581179058952948 30-34 19.985 29.395 26.96 23.66 35-39 20.05 29.205 27.77 22.975 40-44 20.119023804760953 29.36087217443489 27.015403080616124 23.504700940188037 45-49 19.953990798159634 29.170834166833366 27.525505101020205 23.349669933986796 50-54 20.095 29.025000000000002 27.060000000000002 23.82 55-59 19.645000000000003 29.435 27.76 23.16 60-64 20.505000000000003 28.625 27.37 23.5 65-69 19.665 28.985 27.715 23.635 70-74 20.41102055102755 28.551427571378568 27.77638881944097 23.26116305815291 75-79 20.191009550477524 28.89644482224111 27.83639181959098 23.076153807690382 80-84 20.150000000000002 28.410000000000004 27.505000000000003 23.935000000000002 85-89 20.067006700670067 28.517851785178514 28.012801280128013 23.402340234023402 90-94 20.567056705670566 28.59285928592859 27.412741274127413 23.427342734273427 95-99 20.215 28.505000000000003 27.57 23.71 100-104 20.681034051702586 28.496424821241064 27.38136906845342 23.44117205860293 105-109 20.841042052102605 27.891394569728483 28.016400820041003 23.251162558127906 110-114 20.713498346527707 28.580018037879544 27.542839963924244 23.163643651668504 115-119 20.53 28.87 27.345000000000002 23.255 120-124 21.140368442130555 28.103724469363232 27.172607128554265 23.583299959951944 125-129 20.942119769481334 28.213480330744172 27.526935605111504 23.317464294662994 130-134 20.845 28.51 27.13 23.515 135-139 21.05 29.060000000000002 26.455000000000002 23.435 140-144 20.807080708070806 28.24282428242824 26.752675267526755 24.197419741974198 145-149 20.815 28.29 27.055 23.84 150-151 20.599999999999998 27.950000000000003 26.4125 25.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.5 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 2.0 23 3.0 24 4.0 25 3.5 26 4.0 27 8.0 28 11.0 29 19.0 30 31.0 31 35.5 32 38.0 33 43.5 34 63.5 35 84.5 36 92.5 37 110.0 38 146.0 39 171.0 40 198.5 41 230.5 42 255.5 43 258.5 44 254.0 45 268.0 46 259.0 47 242.5 48 224.0 49 193.5 50 158.0 51 129.0 52 112.5 53 93.0 54 68.5 55 46.0 56 31.5 57 28.0 58 20.5 59 14.0 60 12.5 61 8.0 62 5.0 63 3.0 64 2.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.02 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.005 80-84 0.0 85-89 0.01 90-94 0.01 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.21 115-119 0.0 120-124 0.12 125-129 0.22499999999999998 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.275 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.199999999999999 0.0 0.0 0.0 0.0 124-125 4.55 0.0 0.0 0.0 0.0 126-127 4.949999999999999 0.0 0.0 0.0 0.0 128-129 5.55 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.487500000000001 0.0 0.0 0.0 0.0 134-135 6.949999999999999 0.0 0.0 0.0 0.0 136-137 7.4375 0.0 0.0 0.0 0.0 138-139 8.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172115 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172115_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.901 33.0 33.0 34.0 32.0 34.0 2 33.0405 34.0 33.0 34.0 33.0 34.0 3 33.08575 34.0 33.0 34.0 33.0 34.0 4 33.04025 34.0 33.0 34.0 33.0 34.0 5 33.0655 34.0 33.0 34.0 33.0 34.0 6 37.14375 38.0 38.0 38.0 37.0 38.0 7 37.2765 38.0 38.0 38.0 37.0 38.0 8 37.19225 38.0 38.0 38.0 37.0 38.0 9 37.168 38.0 38.0 38.0 37.0 38.0 10-14 37.188649999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.1832 38.0 38.0 38.0 37.0 38.0 20-24 37.14655 38.0 38.0 38.0 37.0 38.0 25-29 37.173649999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.1577 38.0 38.0 38.0 37.0 38.0 35-39 37.11945 38.0 38.0 38.0 37.0 38.0 40-44 37.03445000000001 38.0 38.0 38.0 36.6 38.0 45-49 37.0592 38.0 38.0 38.0 36.8 38.0 50-54 37.10459999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.045950000000005 38.0 38.0 38.0 36.6 38.0 60-64 37.00135 38.0 38.0 38.0 36.4 38.0 65-69 36.85699999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.8909 38.0 38.0 38.0 36.0 38.0 75-79 36.7603 38.0 38.0 38.0 35.8 38.0 80-84 36.75574999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.635200000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.476549999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.2804 38.0 38.0 38.0 34.0 38.0 100-104 36.24405 38.0 38.0 38.0 34.0 38.0 105-109 36.204899999999995 38.0 38.0 38.0 33.8 38.0 110-114 35.95465 38.0 38.0 38.0 33.2 38.0 115-119 35.891 38.0 37.6 38.0 33.0 38.0 120-124 35.661699999999996 38.0 37.2 38.0 31.4 38.0 125-129 35.272850000000005 38.0 36.6 38.0 30.4 38.0 130-134 34.9029 38.0 36.0 38.0 28.8 38.0 135-139 34.2784 38.0 35.8 38.0 24.8 38.0 140-144 33.66755 38.0 33.6 38.0 21.0 38.0 145-149 33.19475 38.0 33.0 38.0 18.2 38.0 150-151 27.936999999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 1.0 6 0.0 7 2.0 8 1.0 9 3.0 10 2.0 11 2.0 12 0.0 13 1.0 14 6.0 15 2.0 16 3.0 17 2.0 18 4.0 19 12.0 20 4.0 21 11.0 22 9.0 23 7.0 24 8.0 25 8.0 26 19.0 27 23.0 28 33.0 29 33.0 30 45.0 31 53.0 32 69.0 33 108.0 34 137.0 35 264.0 36 539.0 37 2578.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.10230692076229 13.76629889669007 17.778335005015045 34.3530591775326 2 24.173346693386772 20.841683366733466 37.4248496993988 17.560120240480963 3 20.240480961923847 24.248496993987974 33.26653306613226 22.24448897795591 4 23.196392785571142 34.79458917835671 22.294589178356713 19.71442885771543 5 22.870741482965933 37.27454909819639 21.7685370741483 18.086172344689377 6 18.46192384769539 37.85070140280561 23.872745490981963 19.814629258517034 7 17.009018036072142 15.931863727454909 44.48897795591182 22.57014028056112 8 19.514028056112224 22.970941883767534 27.029058116232463 30.485971943887773 9 21.312296518908088 24.292511895817682 29.37640871525169 25.018782870022537 10-14 22.49386303291418 28.07975552327038 27.092831020489953 22.333550423325484 15-19 22.640280561122246 27.725450901803605 28.486973947895795 21.147294589178355 20-24 22.44530115656136 28.698743303459672 27.657337405497422 21.19861813448155 25-29 23.2023202320232 27.277727772777276 28.26282628262826 21.257125712571256 30-34 22.73 27.91 28.375 20.985 35-39 22.830000000000002 28.134999999999998 28.185 20.849999999999998 40-44 22.99 28.275 27.834999999999997 20.9 45-49 22.95 27.765 28.405 20.880000000000003 50-54 23.2161608080404 28.596429821491075 27.241362068103403 20.946047302365116 55-59 22.958035312359325 28.50497674185965 27.709698394438053 20.82728955134297 60-64 23.592077623286986 28.21346403921176 27.558267480244076 20.636190857257176 65-69 22.907180385288967 28.471353515136354 27.485614210657992 21.135851888916687 70-74 23.231615807903953 28.634317158579293 27.968984492246125 20.165082541270635 75-79 23.332165557279417 27.806416095290526 28.321905810519993 20.539512536910067 80-84 23.4352329013859 27.91814679541702 28.403462250462802 20.243158052734277 85-89 23.366683341670836 27.71385692846423 28.339169584792394 20.580290145072535 90-94 23.15968573287294 27.99379472551669 28.078867036981435 20.767652504628934 95-99 23.362521891418563 28.16112084063047 27.66574931198399 20.810607955966976 100-104 23.65854878231735 27.88418262739411 27.699154873230984 20.758113717057558 105-109 23.635 28.065 27.495000000000005 20.805 110-114 23.74 27.66 28.02 20.580000000000002 115-119 24.20984196839368 27.670534106821364 28.070614122824566 20.04900980196039 120-124 23.9407733480066 28.207693462057925 27.84753138912511 20.004001800810364 125-129 24.032016008004 28.18409204602301 27.54377188594297 20.240120060030016 130-134 24.22074348326412 28.143293140541353 27.91814679541702 19.717816580777505 135-139 25.222611305652826 27.63881940970485 27.34367183591796 19.794897448724363 140-144 24.677338669334667 27.913956978489246 27.41370685342671 19.994997498749374 145-149 25.46254625462546 28.302830283028303 27.057705770577055 19.176917691769177 150-151 25.4625 27.9375 26.8 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.5 27 3.5 28 6.0 29 13.0 30 19.0 31 22.0 32 30.0 33 41.5 34 48.5 35 58.0 36 86.0 37 110.5 38 141.0 39 170.0 40 187.5 41 225.5 42 271.5 43 283.0 44 278.5 45 273.0 46 266.0 47 254.0 48 229.5 49 202.0 50 159.0 51 126.0 52 109.5 53 89.0 54 66.5 55 52.0 56 46.0 57 35.0 58 24.0 59 18.5 60 13.5 61 8.5 62 3.5 63 5.5 64 5.0 65 2.5 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.2 3 0.2 4 0.2 5 0.2 6 0.2 7 0.2 8 0.2 9 0.17500000000000002 10-14 0.19499999999999998 15-19 0.2 20-24 0.135 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.034999999999999996 60-64 0.03 65-69 0.075 70-74 0.05 75-79 0.095 80-84 0.065 85-89 0.05 90-94 0.08499999999999999 95-99 0.075 100-104 0.015 105-109 0.0 110-114 0.0 115-119 0.02 120-124 0.045 125-129 0.05 130-134 0.065 135-139 0.05 140-144 0.05 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0125 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0125 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.0625 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.16249999999999998 0.0 0.0 0.025 0.0 88-89 0.25 0.0 0.0 0.025 0.0 90-91 0.3125 0.0 0.0 0.025 0.0 92-93 0.4125 0.0 0.0 0.025 0.0 94-95 0.55 0.0 0.0 0.025 0.0 96-97 0.575 0.0 0.0 0.025 0.0 98-99 0.6 0.0 0.0 0.025 0.0 100-101 0.75 0.0 0.0 0.025 0.0 102-103 0.9375 0.0 0.0 0.025 0.0 104-105 1.1625 0.0 0.0 0.025 0.0 106-107 1.3624999999999998 0.0 0.0 0.025 0.0 108-109 1.65 0.0 0.0 0.025 0.0 110-111 1.9375 0.0 0.0 0.025 0.0 112-113 2.225 0.0 0.0 0.025 0.0 114-115 2.5 0.0 0.0 0.025 0.0 116-117 2.9 0.0 0.0 0.025 0.0 118-119 3.2875 0.0 0.0 0.025 0.0 120-121 3.65 0.0 0.0 0.025 0.0 122-123 4.15 0.0 0.0 0.025 0.0 124-125 4.5 0.0 0.0 0.025 0.0 126-127 4.875 0.0 0.0 0.025 0.0 128-129 5.475 0.0 0.0 0.025 0.0 130-131 5.9375 0.0 0.0 0.025 0.0 132-133 6.4125 0.0 0.0 0.025 0.0 134-135 6.875 0.0 0.0 0.025 0.0 136-137 7.362500000000001 0.0 0.0 0.025 0.0 138-139 7.9375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCAAC 10 0.006692141 145.97469 6 >>END_MODULE Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823558 spots for SRR7172115.sra Written 823558 spots for SRR7172115.sra Read 823564 spots for SRR7172115.sra Written 823564 spots for SRR7172115.sra SRR ids: ['SRR7172115.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o_y_u1ym SRR7172115.sra spots: 16471166 blocks: [[1, 823558], [823559, 1647116], [1647117, 2470674], [2470675, 3294232], [3294233, 4117790], [4117791, 4941348], [4941349, 5764906], [5764907, 6588464], [6588465, 7412022], [7412023, 8235580], [8235581, 9059138], [9059139, 9882696], [9882697, 10706254], [10706255, 11529812], [11529813, 12353370], [12353371, 13176928], [13176929, 14000486], [14000487, 14824044], [14824045, 15647602], [15647603, 16471166]] SRR7172115 file size 5559837 SRR7172115 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172115 SRR7172115_1.fastq SRR7172115_2.fastq Input file: SRR7172115_1.fastq Paired file: SRR7172115_2.fastq trimmed: SRR7172115-trimmed-pair1.fastq, SRR7172115-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:51:39 2025 >> started Fri Feb 14 05:51:57 2025 >> done (17.953s) 16471166 read pairs processed; of these: 14284 ( 0.09%) short read pairs filtered out after trimming by size control 11515 ( 0.07%) empty read pairs filtered out after trimming by size control 16445367 (99.84%) read pairs available; of these: 9530332 (57.95%) trimmed read pairs available after processing 6915035 (42.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 6 0.00% 21 2 0.00% 22 11 0.00% 23 10 0.00% 24 8 0.00% 25 10 0.00% 26 10 0.00% 27 9 0.00% 28 7 0.00% 29 10 0.00% 30 10 0.00% 31 8 0.00% 32 5 0.00% 33 9 0.00% 34 4 0.00% 35 18 0.00% 36 13 0.00% 37 14 0.00% 38 7 0.00% 39 15 0.00% 40 20 0.00% 41 13 0.00% 42 14 0.00% 43 17 0.00% 44 18 0.00% 45 18 0.00% 46 28 0.00% 47 17 0.00% 48 19 0.00% 49 25 0.00% 50 37 0.00% 51 30 0.00% 52 46 0.00% 53 54 0.00% 54 62 0.00% 55 69 0.00% 56 87 0.00% 57 104 0.00% 58 222 0.00% 59 371 0.00% 60 290 0.00% 61 206 0.00% 62 168 0.00% 63 190 0.00% 64 228 0.00% 65 269 0.00% 66 294 0.00% 67 309 0.00% 68 409 0.00% 69 497 0.00% 70 506 0.00% 71 640 0.00% 72 661 0.00% 73 855 0.01% 74 912 0.01% 75 1121 0.01% 76 1348 0.01% 77 1390 0.01% 78 1746 0.01% 79 1917 0.01% 80 2200 0.01% 81 2318 0.01% 82 2948 0.02% 83 4168 0.03% 84 5798 0.04% 85 6230 0.04% 86 6374 0.04% 87 7196 0.04% 88 7352 0.04% 89 7399 0.04% 90 7694 0.05% 91 8218 0.05% 92 8935 0.05% 93 9666 0.06% 94 10402 0.06% 95 11018 0.07% 96 11809 0.07% 97 12679 0.08% 98 13406 0.08% 99 14534 0.09% 100 16134 0.10% 101 16674 0.10% 102 17356 0.11% 103 18455 0.11% 104 19609 0.12% 105 20889 0.13% 106 21719 0.13% 107 23147 0.14% 108 24090 0.15% 109 25090 0.15% 110 26312 0.16% 111 27632 0.17% 112 29291 0.18% 113 30564 0.19% 114 32222 0.20% 115 33568 0.20% 116 35121 0.21% 117 37083 0.23% 118 38224 0.23% 119 39682 0.24% 120 41559 0.25% 121 43062 0.26% 122 44694 0.27% 123 46741 0.28% 124 49301 0.30% 125 51762 0.31% 126 54439 0.33% 127 56971 0.35% 128 59009 0.36% 129 61575 0.37% 130 64040 0.39% 131 66262 0.40% 132 70186 0.43% 133 72150 0.44% 134 76046 0.46% 135 80036 0.49% 136 84787 0.52% 137 88385 0.54% 138 94100 0.57% 139 99913 0.61% 140 110426 0.67% 141 118514 0.72% 142 131607 0.80% 143 147915 0.90% 144 171838 1.04% 145 200071 1.22% 146 253372 1.54% 147 343299 2.09% 148 498604 3.03% 149 992229 6.03% 150 4548813 27.66% 151 6915035 42.05% 16445367 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=28 prefix-density=0.31 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=381.80 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=35.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=28 prefix-density=0.30 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=185.40 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=11.7 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATT SRR7172115 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:52:49 Started mapping on | Feb 14 05:52:50 Finished on | Feb 14 05:55:09 Mapping speed, Million of reads per hour | 425.92 Number of input reads | 16445367 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15070015 Uniquely mapped reads % | 91.64% Average mapped length | 292.14 Number of splices: Total | 14705403 Number of splices: Annotated (sjdb) | 14448377 Number of splices: GT/AG | 14466819 Number of splices: GC/AG | 188165 Number of splices: AT/AC | 10241 Number of splices: Non-canonical | 40178 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501515 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 47337 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.92% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891656 891656 891656 N_multimapping 501515 501515 501515 N_noFeature 383138 14940882 437837 N_ambiguous 159375 679 84617 UnstrandedReadsAssigned:14527502 PositiveStrandReadsAssigned:128454 NegativeStrandReadsAssigned:14547561 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172115 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172115-trimmed-pair1.fastq SRR7172115-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,445,367 reads, 14,463,605 reads pseudoaligned [quant] estimated average fragment length: 233.363 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7172115.ke.tsv 34699 SRR7172115.se.tsv 87100 total ==> SRR7172115.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.64 1188 44.2502 Potri.005G024800.1.v4.1 1035 802.637 317 26.2683 Potri.004G059700.1.v4.1 961 728.652 30 2.73838 Potri.007G009000.2.v4.1 1416 1183.64 0 0 Potri.003G141000.2.v4.1 2943 2710.64 414.403 10.1682 Potri.016G087400.1.v4.1 270 84.9551 981 768.019 Potri.015G069301.1.v4.1 564 335.658 0 0 Potri.010G195200.1.v4.1 1773 1540.64 550 23.7441 Potri.012G127500.1.v4.1 977 744.647 5254 469.28 ==> SRR7172115.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 474 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 127 SRR7172115 completed mapping pipeline successfully