Starting /dee2/code/volunteer_pipeline.sh SRR7172116 current disk space = 3085136044032 free memory = 1579645344 SRR7172116 SRAfilesize 0d9cd52566be5a82f32aa7547c2cae00 SRR7172116.sra SRR7172116.sra file validated SRR7172116 is paired end SRR7172116 is conventional basespace SRR7172116 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172116_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.458 33.0 33.0 33.0 32.0 34.0 2 32.95625 33.0 33.0 34.0 32.0 34.0 3 32.18325 33.0 32.0 33.0 31.0 34.0 4 31.69025 33.0 32.0 33.0 30.0 33.0 5 32.60975 33.0 33.0 33.0 32.0 34.0 6 36.9095 38.0 37.0 38.0 35.0 38.0 7 37.35925 38.0 38.0 38.0 37.0 38.0 8 37.36925 38.0 38.0 38.0 37.0 38.0 9 37.3995 38.0 38.0 38.0 37.0 38.0 10-14 37.253949999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.457049999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.487399999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.37735 38.0 38.0 38.0 37.0 38.0 30-34 37.418699999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.26275 38.0 38.0 38.0 37.0 38.0 40-44 37.2395 38.0 38.0 38.0 36.6 38.0 45-49 36.95825 38.0 38.0 38.0 35.8 38.0 50-54 37.22375 38.0 38.0 38.0 36.8 38.0 55-59 37.3465 38.0 38.0 38.0 37.0 38.0 60-64 37.26175 38.0 38.0 38.0 36.8 38.0 65-69 37.285999999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.18415 38.0 38.0 38.0 36.2 38.0 75-79 37.01485 38.0 38.0 38.0 36.0 38.0 80-84 37.00745 38.0 38.0 38.0 36.0 38.0 85-89 36.89725 38.0 38.0 38.0 35.4 38.0 90-94 36.825700000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.730399999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.700599999999994 38.0 38.0 38.0 34.8 38.0 105-109 36.528150000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.365 38.0 37.8 38.0 34.0 38.0 115-119 36.192299999999996 38.0 37.0 38.0 33.4 38.0 120-124 36.055499999999995 38.0 37.0 38.0 33.0 38.0 125-129 35.738749999999996 38.0 36.6 38.0 31.2 38.0 130-134 35.48285 38.0 36.0 38.0 31.0 38.0 135-139 35.158500000000004 38.0 36.0 38.0 30.2 38.0 140-144 34.5967 38.0 34.6 38.0 28.0 38.0 145-149 33.81075 38.0 33.8 38.0 24.0 38.0 150-151 28.776249999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 4.0 21 4.0 22 2.0 23 5.0 24 10.0 25 5.0 26 15.0 27 14.0 28 25.0 29 37.0 30 39.0 31 54.0 32 68.0 33 115.0 34 165.0 35 281.0 36 620.0 37 2530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.9 16.75 16.0 38.35 2 19.625 24.2 39.375 16.8 3 18.725 29.475 26.950000000000003 24.85 4 21.3 36.25 22.35 20.1 5 19.525000000000002 37.25 24.525 18.7 6 15.575 34.949999999999996 28.075 21.4 7 13.225000000000001 19.625 45.625 21.525 8 19.3 21.025 29.475 30.2 9 17.775 22.05 32.2 27.975 10-14 19.642498493673425 29.45370556336614 26.85780277164089 24.04599317131954 15-19 19.56 28.395 28.945 23.1 20-24 19.255 28.084999999999997 28.439999999999998 24.22 25-29 19.235 29.125 27.96 23.68 30-34 19.865 28.884999999999998 27.76 23.49 35-39 19.805 29.07 27.834999999999997 23.29 40-44 19.615 28.9 27.99 23.494999999999997 45-49 20.02 28.42 28.095 23.465 50-54 19.53 28.810000000000002 28.32 23.34 55-59 19.735 29.154999999999998 27.744999999999997 23.365 60-64 19.650000000000002 28.965000000000003 27.985 23.400000000000002 65-69 20.044999999999998 27.975 28.15 23.830000000000002 70-74 20.465 28.835 27.47 23.23 75-79 20.080000000000002 28.615000000000002 28.055000000000003 23.25 80-84 19.830000000000002 28.59 28.050000000000004 23.53 85-89 20.175 28.275 28.299999999999997 23.25 90-94 19.915 28.865000000000002 27.605 23.615 95-99 19.86 28.78 27.825 23.535 100-104 20.205000000000002 28.310000000000002 28.185 23.3 105-109 20.619123824764955 27.940588117623527 28.045609121824366 23.39467893578716 110-114 20.238035705355802 28.604290643596542 27.519127869180377 23.63854578186728 115-119 20.3 28.389999999999997 27.83 23.48 120-124 20.742259790926823 28.53998899614865 27.484619616865903 23.23313159605862 125-129 20.184128890223157 28.615030521364954 27.644351045732012 23.556489542679877 130-134 20.495 28.71 27.6 23.195 135-139 20.665 28.610000000000003 27.544999999999998 23.18 140-144 20.474999999999998 27.905 27.915 23.705000000000002 145-149 20.415 28.485 27.334999999999997 23.765 150-151 19.8 28.1625 28.349999999999998 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 0.5 21 1.0 22 1.5 23 1.0 24 3.5 25 5.5 26 7.0 27 6.5 28 8.0 29 19.0 30 26.0 31 30.0 32 39.0 33 57.0 34 74.0 35 83.0 36 107.0 37 141.5 38 163.0 39 173.5 40 209.0 41 236.0 42 258.5 43 276.0 44 271.0 45 264.0 46 246.5 47 225.5 48 188.5 49 169.0 50 148.5 51 110.5 52 95.0 53 85.0 54 64.0 55 52.5 56 40.5 57 25.0 58 20.0 59 16.0 60 11.5 61 8.5 62 7.0 63 4.5 64 4.0 65 4.0 66 2.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.42 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.015 115-119 0.0 120-124 0.034999999999999996 125-129 0.06999999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.6375 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.35 0.0 0.0 0.0 0.0 132-133 3.725 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.475 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172116 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172116_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0495 33.0 33.0 34.0 32.0 34.0 2 33.0605 34.0 33.0 34.0 32.0 34.0 3 33.11175 34.0 33.0 34.0 33.0 34.0 4 33.06025 34.0 33.0 34.0 33.0 34.0 5 33.0875 34.0 33.0 34.0 33.0 34.0 6 37.314 38.0 38.0 38.0 37.0 38.0 7 37.40675 38.0 38.0 38.0 37.0 38.0 8 37.30225 38.0 38.0 38.0 37.0 38.0 9 37.38075 38.0 38.0 38.0 37.0 38.0 10-14 37.33985 38.0 38.0 38.0 37.0 38.0 15-19 37.282349999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.2277 38.0 38.0 38.0 37.0 38.0 25-29 37.1334 38.0 38.0 38.0 37.0 38.0 30-34 37.17100000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.14645 38.0 38.0 38.0 37.0 38.0 40-44 37.0955 38.0 38.0 38.0 36.8 38.0 45-49 37.140550000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.174600000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.14135 38.0 38.0 38.0 36.6 38.0 60-64 37.0855 38.0 38.0 38.0 36.6 38.0 65-69 36.99865 38.0 38.0 38.0 36.0 38.0 70-74 36.96715 38.0 38.0 38.0 36.0 38.0 75-79 36.9225 38.0 38.0 38.0 36.0 38.0 80-84 36.761900000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.6619 38.0 38.0 38.0 35.0 38.0 90-94 36.515750000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.26515 38.0 38.0 38.0 33.8 38.0 100-104 36.238299999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.274750000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.142849999999996 38.0 38.0 38.0 33.8 38.0 115-119 35.982600000000005 38.0 37.6 38.0 33.2 38.0 120-124 35.79205 38.0 37.2 38.0 32.0 38.0 125-129 35.60865 38.0 37.0 38.0 31.2 38.0 130-134 35.2653 38.0 36.2 38.0 30.6 38.0 135-139 34.93615 38.0 36.0 38.0 29.8 38.0 140-144 34.3599 38.0 35.4 38.0 26.2 38.0 145-149 33.6691 38.0 34.2 38.0 22.0 38.0 150-151 28.729625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 7.0 17 3.0 18 4.0 19 3.0 20 5.0 21 4.0 22 2.0 23 11.0 24 6.0 25 20.0 26 12.0 27 16.0 28 22.0 29 23.0 30 51.0 31 54.0 32 77.0 33 84.0 34 175.0 35 241.0 36 570.0 37 2590.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.05805805805806 13.363363363363364 18.76876876876877 34.80980980980981 2 23.30413016270338 21.526908635794744 37.87234042553192 17.296620775969963 3 21.35168961201502 25.807259073842303 31.013767209011263 21.827284105131415 4 24.34934934934935 34.65965965965966 20.445445445445447 20.545545545545547 5 24.674674674674673 36.36136136136136 22.097097097097095 16.866866866866868 6 17.8 36.55 25.7 19.950000000000003 7 16.175 15.725 46.675 21.425 8 20.225 21.15 29.425 29.2 9 22.400000000000002 22.775000000000002 29.125 25.7 10-14 22.50725072507251 28.89288928892889 26.962696269626964 21.63716371637164 15-19 23.07 28.08 27.805000000000003 21.044999999999998 20-24 22.57 28.749999999999996 27.74 20.94 25-29 23.1 28.71 27.55 20.64 30-34 22.965 27.639999999999997 28.685 20.71 35-39 22.955000000000002 27.905 28.065 21.075 40-44 23.445 28.48 27.61 20.465 45-49 23.43 27.994999999999997 28.08 20.495 50-54 22.84 28.144999999999996 28.215 20.8 55-59 23.02 27.860000000000003 28.64 20.48 60-64 23.055 28.07 28.08 20.794999999999998 65-69 23.189999999999998 28.67 27.889999999999997 20.25 70-74 22.71 28.78 27.894999999999996 20.615 75-79 23.05 27.889999999999997 28.449999999999996 20.61 80-84 23.86 28.225 27.950000000000003 19.965 85-89 23.54 28.055000000000003 28.185 20.22 90-94 23.24 27.96 28.185 20.615 95-99 23.215 28.26 27.725 20.8 100-104 22.884999999999998 28.07 28.255000000000003 20.79 105-109 23.36 28.73 27.865000000000002 20.044999999999998 110-114 23.169999999999998 28.235 28.384999999999998 20.21 115-119 23.105 28.625 27.935 20.335 120-124 23.52 28.439999999999998 27.794999999999998 20.244999999999997 125-129 24.02 27.985 28.315 19.68 130-134 23.75 28.110000000000003 27.915 20.225 135-139 23.915 28.455000000000002 27.985 19.645000000000003 140-144 24.39 27.855 27.77 19.985 145-149 24.345 27.889999999999997 28.185 19.580000000000002 150-151 25.25 27.3625 27.975 19.412499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.5 23 2.0 24 1.5 25 4.5 26 7.0 27 8.0 28 11.0 29 14.5 30 17.0 31 16.5 32 32.0 33 46.5 34 46.0 35 61.0 36 89.5 37 117.0 38 149.0 39 168.5 40 186.5 41 233.0 42 268.5 43 283.5 44 283.5 45 263.5 46 257.5 47 255.0 48 210.0 49 178.5 50 164.0 51 133.5 52 110.0 53 83.5 54 66.0 55 60.0 56 46.0 57 32.0 58 23.0 59 16.0 60 12.0 61 9.5 62 8.0 63 6.0 64 4.5 65 3.0 66 2.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.125 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.8875000000000002 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.2875 0.0 0.0 0.0 0.0 132-133 3.65 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.3375 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATATGT 10 0.0065959026 146.68355 4 >>END_MODULE Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817050 spots for SRR7172116.sra Written 817050 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra Read 817049 spots for SRR7172116.sra Written 817049 spots for SRR7172116.sra SRR ids: ['SRR7172116.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_48n5eu9n SRR7172116.sra spots: 16340981 blocks: [[1, 817049], [817050, 1634098], [1634099, 2451147], [2451148, 3268196], [3268197, 4085245], [4085246, 4902294], [4902295, 5719343], [5719344, 6536392], [6536393, 7353441], [7353442, 8170490], [8170491, 8987539], [8987540, 9804588], [9804589, 10621637], [10621638, 11438686], [11438687, 12255735], [12255736, 13072784], [13072785, 13889833], [13889834, 14706882], [14706883, 15523931], [15523932, 16340981]] SRR7172116 file size 5515721 SRR7172116 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172116 SRR7172116_1.fastq SRR7172116_2.fastq Input file: SRR7172116_1.fastq Paired file: SRR7172116_2.fastq trimmed: SRR7172116-trimmed-pair1.fastq, SRR7172116-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:44:07 2025 >> started Fri Feb 14 06:44:25 2025 >> done (17.993s) 16340981 read pairs processed; of these: 10699 ( 0.07%) short read pairs filtered out after trimming by size control 10341 ( 0.06%) empty read pairs filtered out after trimming by size control 16319941 (99.87%) read pairs available; of these: 8118213 (49.74%) trimmed read pairs available after processing 8201728 (50.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 3 0.00% 25 6 0.00% 26 4 0.00% 27 0 0.00% 28 4 0.00% 29 4 0.00% 30 3 0.00% 31 6 0.00% 32 4 0.00% 33 6 0.00% 34 12 0.00% 35 10 0.00% 36 6 0.00% 37 9 0.00% 38 11 0.00% 39 9 0.00% 40 5 0.00% 41 6 0.00% 42 10 0.00% 43 8 0.00% 44 12 0.00% 45 12 0.00% 46 9 0.00% 47 23 0.00% 48 18 0.00% 49 18 0.00% 50 17 0.00% 51 21 0.00% 52 25 0.00% 53 43 0.00% 54 31 0.00% 55 26 0.00% 56 37 0.00% 57 46 0.00% 58 66 0.00% 59 80 0.00% 60 90 0.00% 61 118 0.00% 62 101 0.00% 63 105 0.00% 64 148 0.00% 65 135 0.00% 66 173 0.00% 67 196 0.00% 68 215 0.00% 69 235 0.00% 70 267 0.00% 71 272 0.00% 72 373 0.00% 73 419 0.00% 74 465 0.00% 75 518 0.00% 76 638 0.00% 77 704 0.00% 78 823 0.01% 79 977 0.01% 80 1058 0.01% 81 1135 0.01% 82 1376 0.01% 83 1643 0.01% 84 2653 0.02% 85 3272 0.02% 86 3326 0.02% 87 3610 0.02% 88 3984 0.02% 89 4099 0.03% 90 4034 0.02% 91 4373 0.03% 92 4948 0.03% 93 5144 0.03% 94 5649 0.03% 95 6138 0.04% 96 6468 0.04% 97 7126 0.04% 98 8009 0.05% 99 8796 0.05% 100 9954 0.06% 101 9818 0.06% 102 10365 0.06% 103 10884 0.07% 104 11477 0.07% 105 12399 0.08% 106 13361 0.08% 107 14083 0.09% 108 14812 0.09% 109 15773 0.10% 110 16651 0.10% 111 17464 0.11% 112 18407 0.11% 113 19393 0.12% 114 20416 0.13% 115 21471 0.13% 116 22512 0.14% 117 23767 0.15% 118 24808 0.15% 119 26007 0.16% 120 27251 0.17% 121 28572 0.18% 122 29554 0.18% 123 31029 0.19% 124 32226 0.20% 125 34208 0.21% 126 35663 0.22% 127 37100 0.23% 128 39227 0.24% 129 41245 0.25% 130 43455 0.27% 131 45296 0.28% 132 48171 0.30% 133 50259 0.31% 134 53073 0.33% 135 57270 0.35% 136 61472 0.38% 137 65169 0.40% 138 70985 0.43% 139 77605 0.48% 140 88849 0.54% 141 93649 0.57% 142 103750 0.64% 143 117021 0.72% 144 136647 0.84% 145 163276 1.00% 146 206152 1.26% 147 279728 1.71% 148 426154 2.61% 149 849947 5.21% 150 4315951 26.45% 151 8201728 50.26% 16319941 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=29 prefix-density=0.41 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=130.38 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=13.0 sequence=CAAAACTTGAAGAGAGGAGAAAATAAAATCAAACAGGCAGAGAAGCAGACATAAACTAGGCTAAACTGTAACTAAGCAAACACTTCACTTTTTCTTTACTGCGGACTTGGTGACCTTGGCACCAGATGGATCCTTCTTCTCAACACTCTTAATGACACCAACCGCCACGGTCTGACGCATGTCCCTCACTGCAAAACGACCAAGAGGAGGATAGGCAGAAAAGGTCTCAACAACCATAGGCTTGGTGGGAATCATCTTCACAAACCCAGCATCACCATTCTTCAAGAACTTGGGCTCCTTCTCGAGCTCTTTGCCAGATCGCCTGTCAATCTTGGTCAAAATCTCAGCAAACTTGACAGCAATGTGGCAGGTGTGACAGTCAAGGACAGGGGCATATCCATTCCCAATTTGACCAGGGTGGTTCATGATGATGACCTGAGAGGTGAAGTTGGCAGCCTCCTTGGCAGGATCATCCTTAGAGTTGGAAGCAACAAAACCACGTTTGAGATCC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=30 prefix-density=0.41 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=55.02 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.8 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAAT SRR7172116 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:45:17 Started mapping on | Feb 14 06:45:17 Finished on | Feb 14 06:49:10 Mapping speed, Million of reads per hour | 252.15 Number of input reads | 16319941 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14417962 Uniquely mapped reads % | 88.35% Average mapped length | 295.11 Number of splices: Total | 13516363 Number of splices: Annotated (sjdb) | 13209004 Number of splices: GT/AG | 13269344 Number of splices: GC/AG | 189810 Number of splices: AT/AC | 13295 Number of splices: Non-canonical | 43914 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.42 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376526 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 54141 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.89% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1536565 1536565 1536565 N_multimapping 376526 376526 376526 N_noFeature 584982 14288029 650749 N_ambiguous 144695 653 80195 UnstrandedReadsAssigned:13688285 PositiveStrandReadsAssigned:129280 NegativeStrandReadsAssigned:13687018 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172116 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172116-trimmed-pair1.fastq SRR7172116-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,319,941 reads, 13,593,258 reads pseudoaligned [quant] estimated average fragment length: 244.676 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7172116.ke.tsv 34699 SRR7172116.se.tsv 87100 total ==> SRR7172116.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.32 2104 89.2487 Potri.005G024800.1.v4.1 1035 791.324 533 50.6946 Potri.004G059700.1.v4.1 961 717.357 15 1.57378 Potri.007G009000.2.v4.1 1416 1172.32 0 0 Potri.003G141000.2.v4.1 2943 2699.32 507.469 14.1496 Potri.016G087400.1.v4.1 270 77.5464 565 548.373 Potri.015G069301.1.v4.1 564 324.793 0 0 Potri.010G195200.1.v4.1 1773 1529.32 970.856 47.7798 Potri.012G127500.1.v4.1 977 733.335 31482 3231.09 ==> SRR7172116.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 448 Potri.001G452600.v4.1 357 SRR7172116 completed mapping pipeline successfully