Starting /dee2/code/volunteer_pipeline.sh SRR7172118 current disk space = 3085536161792 free memory = 1487976448 SRR7172118 SRAfilesize cf394ace3e1e4e5a2f832e9c8f9082e3 SRR7172118.sra SRR7172118.sra file validated SRR7172118 is paired end SRR7172118 is conventional basespace SRR7172118 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68675 33.0 33.0 34.0 32.0 34.0 2 32.701 33.0 33.0 34.0 31.0 34.0 3 32.84475 33.0 33.0 34.0 31.0 34.0 4 31.7035 33.0 32.0 33.0 30.0 34.0 5 32.73 33.0 33.0 33.0 32.0 34.0 6 36.711 38.0 37.0 38.0 34.0 38.0 7 37.06975 38.0 38.0 38.0 35.0 38.0 8 37.11825 38.0 38.0 38.0 36.0 38.0 9 37.43675 38.0 38.0 38.0 37.0 38.0 10-14 37.443349999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.484950000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.4156 38.0 38.0 38.0 37.2 38.0 25-29 37.2896 38.0 38.0 38.0 36.8 38.0 30-34 37.022450000000006 38.0 38.0 38.0 35.8 38.0 35-39 36.7517 38.0 37.8 38.0 34.8 38.0 40-44 36.97625 38.0 38.0 38.0 35.8 38.0 45-49 37.080650000000006 38.0 38.0 38.0 36.2 38.0 50-54 37.133050000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.178399999999996 38.0 38.0 38.0 36.4 38.0 60-64 37.221000000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.21285 38.0 38.0 38.0 36.6 38.0 70-74 37.08925000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.94285 38.0 38.0 38.0 36.0 38.0 80-84 36.76065 38.0 38.0 38.0 34.8 38.0 85-89 36.630250000000004 38.0 38.0 38.0 34.4 38.0 90-94 36.4493 38.0 38.0 38.0 34.2 38.0 95-99 36.47895 38.0 38.0 38.0 34.0 38.0 100-104 36.490300000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.4721 38.0 38.0 38.0 34.0 38.0 110-114 36.273 38.0 37.4 38.0 34.0 38.0 115-119 36.097500000000004 38.0 37.0 38.0 33.2 38.0 120-124 35.8856 38.0 37.0 38.0 32.0 38.0 125-129 35.5612 38.0 36.6 38.0 31.0 38.0 130-134 35.2051 38.0 36.0 38.0 30.2 38.0 135-139 34.843399999999995 38.0 35.6 38.0 28.4 38.0 140-144 34.05585 38.0 33.6 38.0 24.4 38.0 145-149 33.34445 38.0 33.0 38.0 20.2 38.0 150-151 28.373875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 3.0 19 0.0 20 3.0 21 3.0 22 7.0 23 8.0 24 10.0 25 11.0 26 17.0 27 28.0 28 18.0 29 40.0 30 59.0 31 64.0 32 98.0 33 104.0 34 157.0 35 300.0 36 662.0 37 2402.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.050000000000004 16.625 14.05 35.275 2 20.45 24.025 38.7 16.825000000000003 3 18.275 29.2 27.474999999999998 25.05 4 22.55 35.949999999999996 21.925 19.575 5 20.150000000000002 38.125 24.175 17.549999999999997 6 15.75 37.7 26.25 20.3 7 12.950000000000001 20.05 45.824999999999996 21.175 8 18.275 21.25 28.499999999999996 31.974999999999998 9 18.575 22.125 30.225 29.075 10-14 19.732893157262904 30.06702681072429 26.635654261704683 23.564425770308123 15-19 19.785989299464973 28.48142407120356 28.001400070003502 23.731186559327966 20-24 19.939999999999998 28.725 27.62 23.715 25-29 19.869999999999997 28.92 28.03 23.18 30-34 19.37 28.854999999999997 28.035 23.74 35-39 19.564999999999998 29.125 27.915 23.395 40-44 20.285 28.475 28.105000000000004 23.135 45-49 20.175 28.65 27.589999999999996 23.585 50-54 20.0 28.634999999999998 28.055000000000003 23.31 55-59 19.72 28.694999999999997 28.28 23.305 60-64 20.255000000000003 29.085 27.465 23.195 65-69 20.03 28.305000000000003 27.700000000000003 23.965 70-74 20.150000000000002 29.049999999999997 27.875 22.925 75-79 20.72 28.565 27.735 22.98 80-84 20.39 28.73 27.33 23.549999999999997 85-89 20.905 28.49 27.925 22.68 90-94 20.51 28.33 27.634999999999998 23.525 95-99 19.99 27.965 28.199999999999996 23.845 100-104 20.445 28.849999999999998 27.505000000000003 23.200000000000003 105-109 20.485 28.965000000000003 27.505000000000003 23.044999999999998 110-114 21.207120712071205 29.102910291029104 27.032703270327037 22.657265726572657 115-119 20.685171292823206 28.292073018254566 27.711927981995498 23.31082770692673 120-124 20.601180354106233 28.40852255676703 27.728318495548663 23.26197859357807 125-129 20.87675350701403 28.361723446893787 27.40981963927856 23.351703406813627 130-134 20.405 28.884999999999998 27.435 23.275000000000002 135-139 21.125 28.48 26.729999999999997 23.665 140-144 21.135 28.000000000000004 27.68 23.185 145-149 21.08 28.310000000000002 27.26 23.35 150-151 21.15 27.725 27.150000000000002 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.5 18 2.0 19 1.5 20 2.0 21 1.0 22 0.0 23 1.0 24 3.0 25 7.0 26 6.5 27 5.0 28 10.0 29 13.5 30 17.5 31 25.5 32 34.0 33 43.5 34 63.5 35 84.5 36 106.5 37 128.0 38 145.0 39 166.0 40 184.0 41 211.0 42 247.5 43 278.0 44 301.0 45 290.5 46 262.5 47 242.5 48 214.0 49 179.5 50 156.0 51 139.5 52 112.0 53 77.5 54 59.5 55 48.0 56 37.0 57 28.5 58 15.5 59 10.0 60 9.0 61 7.0 62 5.5 63 4.0 64 2.0 65 1.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.04 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.025 120-124 0.03 125-129 0.2 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.25 0.0 0.0 0.0 0.0 126-127 2.5250000000000004 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCAT 10 0.006843168 144.91249 1 CCTCATT 10 0.006843168 144.91249 2 TCCCTTC 10 0.006843168 144.91249 7 >>END_MODULE SRR7172118 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78925 33.0 33.0 34.0 32.0 34.0 2 32.9535 34.0 33.0 34.0 32.0 34.0 3 32.9905 34.0 33.0 34.0 32.0 34.0 4 33.02875 34.0 33.0 34.0 32.0 34.0 5 33.022 34.0 33.0 34.0 33.0 34.0 6 37.177 38.0 38.0 38.0 37.0 38.0 7 37.24425 38.0 38.0 38.0 37.0 38.0 8 37.174 38.0 38.0 38.0 37.0 38.0 9 37.2395 38.0 38.0 38.0 37.0 38.0 10-14 37.233450000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.11555 38.0 38.0 38.0 37.0 38.0 20-24 37.0999 38.0 38.0 38.0 36.8 38.0 25-29 37.07015 38.0 38.0 38.0 36.8 38.0 30-34 37.046 38.0 38.0 38.0 36.8 38.0 35-39 37.016549999999995 38.0 38.0 38.0 36.6 38.0 40-44 36.913799999999995 38.0 38.0 38.0 36.2 38.0 45-49 36.962450000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.947199999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.93745 38.0 38.0 38.0 36.2 38.0 60-64 36.89805 38.0 38.0 38.0 36.0 38.0 65-69 36.8172 38.0 38.0 38.0 36.0 38.0 70-74 36.70395 38.0 38.0 38.0 35.2 38.0 75-79 36.72240000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.57895 38.0 38.0 38.0 34.8 38.0 85-89 36.318949999999994 38.0 38.0 38.0 34.0 38.0 90-94 36.1764 38.0 38.0 38.0 33.8 38.0 95-99 36.107 38.0 38.0 38.0 33.6 38.0 100-104 36.00035 38.0 37.8 38.0 33.0 38.0 105-109 35.9545 38.0 37.4 38.0 33.2 38.0 110-114 35.8914 38.0 37.2 38.0 32.8 38.0 115-119 35.7531 38.0 37.0 38.0 32.2 38.0 120-124 35.3424 38.0 36.8 38.0 30.6 38.0 125-129 35.04785 38.0 36.0 38.0 29.0 38.0 130-134 34.8277 38.0 36.0 38.0 28.6 38.0 135-139 34.08345 38.0 34.0 38.0 24.4 38.0 140-144 33.55385 38.0 33.0 38.0 21.4 38.0 145-149 32.71045 38.0 33.0 38.0 13.4 38.0 150-151 27.2705 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 2.0 5 3.0 6 2.0 7 3.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 5.0 17 2.0 18 7.0 19 3.0 20 6.0 21 8.0 22 9.0 23 10.0 24 18.0 25 28.0 26 14.0 27 20.0 28 30.0 29 32.0 30 60.0 31 70.0 32 79.0 33 107.0 34 143.0 35 255.0 36 660.0 37 2406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.0060135304435 13.95640190428464 17.58957654723127 32.44800801804059 2 23.186593296648326 22.661330665332667 36.14307153576789 18.009004502251123 3 21.060530265132567 25.987993996998497 30.7903951975988 22.161080540270135 4 23.111555777888945 34.39219609804903 21.96098049024512 20.535267633816908 5 23.386693346673336 38.24412206103052 21.010505252626313 17.358679339669834 6 18.425 36.9 24.85 19.825 7 16.333166583291643 15.382691345672836 46.39819909954978 21.885942971485743 8 20.25 21.75 28.349999999999998 29.65 9 21.975 23.525 29.5 25.0 10-14 22.834133653461386 28.626450580232092 26.64565826330532 21.8937575030012 15-19 23.06153076538269 28.51425712856428 27.788894447223612 20.635317658829415 20-24 22.939587917583516 28.360672134426885 27.945589117823566 20.754150830166033 25-29 22.71 27.99 28.405 20.895 30-34 22.835 27.925 28.485 20.755000000000003 35-39 22.900000000000002 27.495000000000005 28.29 21.315 40-44 23.085 28.244999999999997 28.285 20.385 45-49 22.775000000000002 28.345 28.265 20.615 50-54 23.25 27.700000000000003 28.27 20.78 55-59 23.235 28.07 27.939999999999998 20.755000000000003 60-64 23.02 28.035 28.425 20.52 65-69 23.255 27.685 28.349999999999998 20.71 70-74 23.155 27.800000000000004 28.615000000000002 20.43 75-79 23.18 27.63 27.965 21.224999999999998 80-84 23.26 27.845 28.18 20.715 85-89 22.919999999999998 27.839999999999996 28.17 21.07 90-94 23.16 28.044999999999998 28.050000000000004 20.745 95-99 23.317331733173315 27.9027902790279 28.192819281928195 20.587058705870586 100-104 24.11 27.67 27.96 20.26 105-109 23.015 27.665 28.485 20.835 110-114 23.22 28.560000000000002 28.02 20.200000000000003 115-119 23.595 28.215 27.860000000000003 20.330000000000002 120-124 23.445 28.325 27.37 20.86 125-129 24.275 27.985 27.375 20.365 130-134 23.44 28.194999999999997 27.744999999999997 20.62 135-139 23.325000000000003 27.865000000000002 27.495000000000005 21.315 140-144 23.415 28.04 28.060000000000002 20.485 145-149 24.495 28.08 26.825 20.599999999999998 150-151 24.15 27.5875 27.9125 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 3.5 26 4.5 27 6.5 28 9.0 29 13.5 30 16.0 31 13.0 32 20.5 33 30.0 34 41.0 35 51.0 36 69.0 37 107.5 38 142.5 39 174.0 40 212.0 41 243.0 42 268.5 43 294.0 44 293.0 45 293.0 46 285.5 47 239.0 48 217.0 49 205.0 50 165.5 51 146.0 52 123.0 53 83.0 54 66.0 55 46.0 56 28.5 57 24.5 58 15.0 59 7.5 60 8.5 61 8.5 62 5.5 63 4.5 64 2.5 65 2.5 66 3.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.05 8 0.0 9 0.0 10-14 0.04 15-19 0.05 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.9124999999999999 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 4.0625 0.0 0.0 0.0 0.0 138-139 4.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCAAA 20 3.5877043E-4 108.75 6 >>END_MODULE Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920787 spots for SRR7172118.sra Written 920787 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra Read 920768 spots for SRR7172118.sra Written 920768 spots for SRR7172118.sra SRR ids: ['SRR7172118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9v992twm SRR7172118.sra spots: 18415379 blocks: [[1, 920768], [920769, 1841536], [1841537, 2762304], [2762305, 3683072], [3683073, 4603840], [4603841, 5524608], [5524609, 6445376], [6445377, 7366144], [7366145, 8286912], [8286913, 9207680], [9207681, 10128448], [10128449, 11049216], [11049217, 11969984], [11969985, 12890752], [12890753, 13811520], [13811521, 14732288], [14732289, 15653056], [15653057, 16573824], [16573825, 17494592], [17494593, 18415379]] SRR7172118 file size 6218667 SRR7172118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172118 SRR7172118_1.fastq SRR7172118_2.fastq Input file: SRR7172118_1.fastq Paired file: SRR7172118_2.fastq trimmed: SRR7172118-trimmed-pair1.fastq, SRR7172118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:00:13 2025 >> started Fri Feb 14 06:00:32 2025 >> done (19.124s) 18415379 read pairs processed; of these: 15960 ( 0.09%) short read pairs filtered out after trimming by size control 15892 ( 0.09%) empty read pairs filtered out after trimming by size control 18383527 (99.83%) read pairs available; of these: 10561283 (57.45%) trimmed read pairs available after processing 7822244 (42.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 7 0.00% 22 9 0.00% 23 4 0.00% 24 3 0.00% 25 5 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 9 0.00% 31 6 0.00% 32 7 0.00% 33 1 0.00% 34 18 0.00% 35 6 0.00% 36 12 0.00% 37 9 0.00% 38 3 0.00% 39 3 0.00% 40 7 0.00% 41 10 0.00% 42 3 0.00% 43 12 0.00% 44 11 0.00% 45 3 0.00% 46 10 0.00% 47 17 0.00% 48 9 0.00% 49 22 0.00% 50 20 0.00% 51 21 0.00% 52 20 0.00% 53 27 0.00% 54 27 0.00% 55 49 0.00% 56 85 0.00% 57 429 0.00% 58 206 0.00% 59 188 0.00% 60 164 0.00% 61 95 0.00% 62 116 0.00% 63 155 0.00% 64 148 0.00% 65 165 0.00% 66 181 0.00% 67 256 0.00% 68 290 0.00% 69 292 0.00% 70 318 0.00% 71 282 0.00% 72 367 0.00% 73 558 0.00% 74 520 0.00% 75 501 0.00% 76 715 0.00% 77 1090 0.01% 78 1526 0.01% 79 1150 0.01% 80 1336 0.01% 81 1418 0.01% 82 1483 0.01% 83 2138 0.01% 84 4254 0.02% 85 4490 0.02% 86 4333 0.02% 87 4173 0.02% 88 4051 0.02% 89 4291 0.02% 90 4587 0.02% 91 4701 0.03% 92 5066 0.03% 93 5826 0.03% 94 6163 0.03% 95 6638 0.04% 96 7284 0.04% 97 8168 0.04% 98 8564 0.05% 99 9189 0.05% 100 9542 0.05% 101 10745 0.06% 102 11049 0.06% 103 11638 0.06% 104 12589 0.07% 105 13462 0.07% 106 14443 0.08% 107 15086 0.08% 108 15812 0.09% 109 17004 0.09% 110 17792 0.10% 111 19177 0.10% 112 20329 0.11% 113 21871 0.12% 114 22769 0.12% 115 24348 0.13% 116 25685 0.14% 117 27103 0.15% 118 28551 0.16% 119 30076 0.16% 120 31631 0.17% 121 33846 0.18% 122 36318 0.20% 123 37886 0.21% 124 40792 0.22% 125 42950 0.23% 126 45523 0.25% 127 48120 0.26% 128 50981 0.28% 129 53846 0.29% 130 56459 0.31% 131 59280 0.32% 132 62810 0.34% 133 67135 0.37% 134 71480 0.39% 135 76648 0.42% 136 83079 0.45% 137 89233 0.49% 138 96953 0.53% 139 106423 0.58% 140 116850 0.64% 141 130564 0.71% 142 148900 0.81% 143 169114 0.92% 144 201468 1.10% 145 246957 1.34% 146 312572 1.70% 147 422514 2.30% 148 635264 3.46% 149 1232734 6.71% 150 5275541 28.70% 151 7822244 42.55% 18383527 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=23 prefix-density=0.47 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=39.21 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=9.5 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGTGTCTGAGCTCTCGACCTCCAGAGTGATGGTCTT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=25 prefix-density=0.48 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=33.54 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=10.6 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172118 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:01:32 Started mapping on | Feb 14 06:01:32 Finished on | Feb 14 06:03:11 Mapping speed, Million of reads per hour | 668.49 Number of input reads | 18383527 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16636835 Uniquely mapped reads % | 90.50% Average mapped length | 290.38 Number of splices: Total | 16092648 Number of splices: Annotated (sjdb) | 15816275 Number of splices: GT/AG | 15834094 Number of splices: GC/AG | 199222 Number of splices: AT/AC | 12546 Number of splices: Non-canonical | 46786 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.26 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 508904 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 36634 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.47% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1255073 1255073 1255073 N_multimapping 508904 508904 508904 N_noFeature 404604 16478513 469339 N_ambiguous 234229 1572 139573 UnstrandedReadsAssigned:15998002 PositiveStrandReadsAssigned:156750 NegativeStrandReadsAssigned:16027923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172118-trimmed-pair1.fastq SRR7172118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,383,527 reads, 16,681,220 reads pseudoaligned [quant] estimated average fragment length: 244.396 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR7172118.ke.tsv 34699 SRR7172118.se.tsv 87100 total ==> SRR7172118.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.6 1195 38.2502 Potri.005G024800.1.v4.1 1035 791.604 240 17.2215 Potri.004G059700.1.v4.1 961 717.613 23 1.82056 Potri.007G009000.2.v4.1 1416 1172.6 0 0 Potri.003G141000.2.v4.1 2943 2699.6 704 14.8129 Potri.016G087400.1.v4.1 270 77.3334 852.847 626.429 Potri.015G069301.1.v4.1 564 324.521 0 0 Potri.010G195200.1.v4.1 1773 1529.6 304 11.2892 Potri.012G127500.1.v4.1 977 733.604 4710 364.692 ==> SRR7172118.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 51 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 604 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 117 SRR7172118 completed mapping pipeline successfully