Starting /dee2/code/volunteer_pipeline.sh SRR7172119 current disk space = 3085093978112 free memory = 1582610920 SRR7172119 SRAfilesize 00ad67676339387323f3d5945417c9fb SRR7172119.sra SRR7172119.sra file validated SRR7172119 is paired end SRR7172119 is conventional basespace SRR7172119 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172119_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.35125 33.0 32.0 33.0 31.0 34.0 2 32.58675 33.0 33.0 34.0 31.0 34.0 3 32.1125 33.0 32.0 33.0 30.0 34.0 4 31.80025 33.0 32.0 33.0 30.0 34.0 5 31.93725 33.0 32.0 33.0 30.0 34.0 6 36.66075 38.0 37.0 38.0 34.0 38.0 7 37.182 38.0 38.0 38.0 36.0 38.0 8 37.35625 38.0 38.0 38.0 36.0 38.0 9 37.63275 38.0 38.0 38.0 37.0 38.0 10-14 37.659 38.0 38.0 38.0 38.0 38.0 15-19 37.70255 38.0 38.0 38.0 38.0 38.0 20-24 37.686400000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.664750000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.6546 38.0 38.0 38.0 38.0 38.0 35-39 37.620000000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.57725000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.55345 38.0 38.0 38.0 38.0 38.0 50-54 37.49705 38.0 38.0 38.0 37.8 38.0 55-59 37.433350000000004 38.0 38.0 38.0 37.2 38.0 60-64 37.3879 38.0 38.0 38.0 37.0 38.0 65-69 37.320049999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.3724 38.0 38.0 38.0 37.0 38.0 75-79 37.23305 38.0 38.0 38.0 36.6 38.0 80-84 37.17565 38.0 38.0 38.0 36.0 38.0 85-89 37.092 38.0 38.0 38.0 36.0 38.0 90-94 37.0569 38.0 38.0 38.0 36.0 38.0 95-99 36.89185 38.0 38.0 38.0 35.6 38.0 100-104 36.83515 38.0 38.0 38.0 35.2 38.0 105-109 36.53315 38.0 38.0 38.0 34.2 38.0 110-114 36.39415 38.0 37.8 38.0 34.0 38.0 115-119 36.2863 38.0 37.6 38.0 33.8 38.0 120-124 36.28605 38.0 37.6 38.0 33.8 38.0 125-129 35.95845 38.0 37.0 38.0 33.0 38.0 130-134 35.73465 38.0 36.4 38.0 31.8 38.0 135-139 35.325 38.0 36.0 38.0 30.6 38.0 140-144 35.2072 38.0 36.0 38.0 30.0 38.0 145-149 34.5488 38.0 35.0 38.0 27.6 38.0 150-151 31.059124999999998 36.5 30.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 2.0 19 4.0 20 2.0 21 4.0 22 3.0 23 4.0 24 6.0 25 5.0 26 7.0 27 9.0 28 21.0 29 27.0 30 21.0 31 35.0 32 40.0 33 61.0 34 116.0 35 227.0 36 739.0 37 2661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.28519385896435 18.605256310174344 13.869372885766328 39.24017694509498 2 18.809404702351177 24.262131065532767 38.19409704852426 18.734367183591797 3 17.0 28.575 26.875 27.55 4 21.3 36.075 22.0 20.625 5 20.65 37.175000000000004 23.0 19.175 6 16.175 36.875 25.775 21.175 7 11.75 19.75 46.75 21.75 8 17.75 21.3 28.95 32.0 9 18.099999999999998 22.25 30.85 28.799999999999997 10-14 19.545 30.475 26.700000000000003 23.28 15-19 19.3 28.92 27.815 23.965 20-24 19.765 28.884999999999998 27.955000000000002 23.395 25-29 19.98 29.110000000000003 28.42 22.49 30-34 20.32 29.065 27.505000000000003 23.11 35-39 20.115 29.310000000000002 27.075 23.5 40-44 19.54 28.515 28.294999999999998 23.65 45-49 19.985 28.955 27.495000000000005 23.565 50-54 20.175 28.605000000000004 28.1 23.119999999999997 55-59 20.035 28.999999999999996 27.474999999999998 23.49 60-64 19.955000000000002 28.749999999999996 27.450000000000003 23.845 65-69 20.185 28.18 28.134999999999998 23.5 70-74 20.755000000000003 28.76 27.500000000000004 22.985 75-79 20.724999999999998 28.59 27.29 23.395 80-84 20.424999999999997 28.205000000000002 27.99 23.380000000000003 85-89 21.095 28.32 27.694999999999997 22.89 90-94 21.02 28.199999999999996 27.48 23.3 95-99 20.57 28.485 27.794999999999998 23.150000000000002 100-104 20.39 28.12 28.23 23.26 105-109 20.77 27.815 27.785 23.630000000000003 110-114 21.14 28.62 27.450000000000003 22.79 115-119 21.255 28.645 27.11 22.99 120-124 20.515 28.189999999999998 27.51 23.785 125-129 21.044999999999998 27.855 27.435 23.665 130-134 21.265 28.34 27.025 23.369999999999997 135-139 21.11 28.025 26.834999999999997 24.03 140-144 21.05 28.449999999999996 27.42 23.080000000000002 145-149 21.675 28.815 26.52 22.99 150-151 22.2625 27.725 26.787499999999998 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 3.5 26 8.0 27 13.0 28 15.0 29 14.5 30 19.5 31 28.0 32 39.0 33 51.5 34 67.0 35 77.5 36 93.0 37 117.5 38 148.5 39 185.0 40 205.0 41 233.5 42 250.5 43 254.5 44 276.0 45 275.5 46 250.0 47 236.5 48 218.0 49 181.0 50 155.5 51 122.0 52 95.0 53 84.5 54 61.5 55 48.5 56 41.5 57 30.0 58 19.0 59 13.5 60 13.0 61 9.5 62 8.5 63 6.5 64 3.0 65 4.0 66 3.0 67 3.0 68 2.5 69 1.0 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.925 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.5499999999999998 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.6624999999999996 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.4 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.425 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172119 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172119_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34975 34.0 33.0 34.0 33.0 34.0 2 33.446 34.0 33.0 34.0 33.0 34.0 3 33.47925 34.0 33.0 34.0 33.0 34.0 4 33.4555 34.0 33.0 34.0 33.0 34.0 5 33.492 34.0 33.0 34.0 33.0 34.0 6 37.62625 38.0 38.0 38.0 38.0 38.0 7 37.67375 38.0 38.0 38.0 38.0 38.0 8 37.66325 38.0 38.0 38.0 38.0 38.0 9 37.6025 38.0 38.0 38.0 38.0 38.0 10-14 37.627050000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.63405 38.0 38.0 38.0 38.0 38.0 20-24 37.6164 38.0 38.0 38.0 38.0 38.0 25-29 37.5839 38.0 38.0 38.0 38.0 38.0 30-34 37.533550000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.51555 38.0 38.0 38.0 38.0 38.0 40-44 37.494049999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.49225 38.0 38.0 38.0 38.0 38.0 50-54 37.48285 38.0 38.0 38.0 38.0 38.0 55-59 37.433550000000004 38.0 38.0 38.0 37.8 38.0 60-64 37.3986 38.0 38.0 38.0 37.2 38.0 65-69 37.31115 38.0 38.0 38.0 37.0 38.0 70-74 37.2377 38.0 38.0 38.0 37.0 38.0 75-79 37.13745 38.0 38.0 38.0 36.4 38.0 80-84 37.14175 38.0 38.0 38.0 36.6 38.0 85-89 37.05159999999999 38.0 38.0 38.0 36.2 38.0 90-94 37.0294 38.0 38.0 38.0 36.0 38.0 95-99 36.88725000000001 38.0 38.0 38.0 35.8 38.0 100-104 36.81785000000001 38.0 38.0 38.0 35.2 38.0 105-109 36.7416 38.0 38.0 38.0 35.0 38.0 110-114 36.55535 38.0 38.0 38.0 34.2 38.0 115-119 36.4318 38.0 38.0 38.0 34.0 38.0 120-124 36.26915 38.0 38.0 38.0 34.0 38.0 125-129 36.013099999999994 38.0 37.0 38.0 33.2 38.0 130-134 35.752449999999996 38.0 36.4 38.0 32.2 38.0 135-139 35.44029999999999 38.0 36.0 38.0 30.6 38.0 140-144 35.1381 38.0 36.0 38.0 31.0 38.0 145-149 34.54445 38.0 35.0 38.0 28.0 38.0 150-151 31.033875 36.5 29.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 2.0 14 1.0 15 1.0 16 2.0 17 1.0 18 1.0 19 2.0 20 4.0 21 2.0 22 8.0 23 2.0 24 5.0 25 4.0 26 10.0 27 8.0 28 18.0 29 21.0 30 32.0 31 35.0 32 56.0 33 58.0 34 120.0 35 204.0 36 516.0 37 2881.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.7 12.9 17.65 35.75 2 22.55 22.775000000000002 38.05 16.625 3 20.7 25.825 31.225 22.25 4 24.275 33.975 20.424999999999997 21.325 5 22.625 37.35 21.975 18.05 6 16.525000000000002 38.5 24.0 20.974999999999998 7 16.875 15.9 45.0 22.225 8 20.424999999999997 22.15 28.4 29.025000000000002 9 21.25 24.45 28.025 26.275 10-14 23.01 28.465 26.200000000000003 22.325 15-19 23.165 27.73 27.61 21.495 20-24 23.36 27.765 27.47 21.404999999999998 25-29 23.044999999999998 28.29 27.0 21.665 30-34 22.765 28.155 28.01 21.07 35-39 23.06 27.389999999999997 27.779999999999998 21.77 40-44 22.86 27.589999999999996 27.735 21.815 45-49 22.82 27.865000000000002 27.855 21.46 50-54 23.055 27.925 27.845 21.175 55-59 23.400000000000002 27.750000000000004 28.194999999999997 20.655 60-64 22.939999999999998 27.83 27.439999999999998 21.790000000000003 65-69 23.225 27.860000000000003 28.444999999999997 20.47 70-74 22.895 27.6 28.315 21.19 75-79 23.515 27.750000000000004 27.815 20.919999999999998 80-84 23.955000000000002 27.495000000000005 27.639999999999997 20.91 85-89 23.695 27.834999999999997 28.035 20.435 90-94 23.72 27.805000000000003 27.54 20.935000000000002 95-99 23.56 27.265 28.22 20.955 100-104 24.01 27.994999999999997 27.384999999999998 20.61 105-109 22.96 27.939999999999998 28.465 20.635 110-114 23.7 27.339999999999996 28.08 20.880000000000003 115-119 23.855 27.450000000000003 27.689999999999998 21.005 120-124 23.830000000000002 27.67 27.779999999999998 20.72 125-129 23.849999999999998 27.889999999999997 28.21 20.05 130-134 24.355 27.21 28.110000000000003 20.325 135-139 24.515 27.68 27.800000000000004 20.005 140-144 24.675 27.310000000000002 27.825 20.19 145-149 25.290000000000003 27.905 27.265 19.54 150-151 24.5125 28.125 27.0 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 2.0 27 2.5 28 2.0 29 4.5 30 11.5 31 14.5 32 17.0 33 25.0 34 38.0 35 56.0 36 76.5 37 102.0 38 135.5 39 175.0 40 196.0 41 224.0 42 254.0 43 261.0 44 278.5 45 299.0 46 296.5 47 265.5 48 225.5 49 212.5 50 179.5 51 132.5 52 107.5 53 84.0 54 65.5 55 51.5 56 41.5 57 30.5 58 29.0 59 29.5 60 20.0 61 11.5 62 9.5 63 8.0 64 6.0 65 3.5 66 3.5 67 2.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.4625 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.925000000000001 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGCCA 10 0.006830828 145.0 3 AACAGAC 10 0.006830828 145.0 5 >>END_MODULE Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515462 spots for SRR7172119.sra Written 515462 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra Read 515460 spots for SRR7172119.sra Written 515460 spots for SRR7172119.sra SRR ids: ['SRR7172119.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ywd2wgs3 SRR7172119.sra spots: 10309202 blocks: [[1, 515460], [515461, 1030920], [1030921, 1546380], [1546381, 2061840], [2061841, 2577300], [2577301, 3092760], [3092761, 3608220], [3608221, 4123680], [4123681, 4639140], [4639141, 5154600], [5154601, 5670060], [5670061, 6185520], [6185521, 6700980], [6700981, 7216440], [7216441, 7731900], [7731901, 8247360], [8247361, 8762820], [8762821, 9278280], [9278281, 9793740], [9793741, 10309202]] SRR7172119 file size 3471749 SRR7172119 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172119 SRR7172119_1.fastq SRR7172119_2.fastq Input file: SRR7172119_1.fastq Paired file: SRR7172119_2.fastq trimmed: SRR7172119-trimmed-pair1.fastq, SRR7172119-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:42:36 2025 >> started Fri Feb 14 06:42:47 2025 >> done (10.828s) 10309202 read pairs processed; of these: 3533 ( 0.03%) short read pairs filtered out after trimming by size control 2222 ( 0.02%) empty read pairs filtered out after trimming by size control 10303447 (99.94%) read pairs available; of these: 4941493 (47.96%) trimmed read pairs available after processing 5361954 (52.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 0 0.00% 26 2 0.00% 27 3 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 0 0.00% 32 3 0.00% 33 3 0.00% 34 0 0.00% 35 1 0.00% 36 6 0.00% 37 4 0.00% 38 1 0.00% 39 4 0.00% 40 2 0.00% 41 3 0.00% 42 2 0.00% 43 5 0.00% 44 5 0.00% 45 5 0.00% 46 5 0.00% 47 8 0.00% 48 5 0.00% 49 10 0.00% 50 17 0.00% 51 9 0.00% 52 11 0.00% 53 10 0.00% 54 30 0.00% 55 25 0.00% 56 24 0.00% 57 21 0.00% 58 24 0.00% 59 34 0.00% 60 39 0.00% 61 41 0.00% 62 47 0.00% 63 64 0.00% 64 65 0.00% 65 91 0.00% 66 74 0.00% 67 106 0.00% 68 112 0.00% 69 122 0.00% 70 167 0.00% 71 155 0.00% 72 173 0.00% 73 217 0.00% 74 245 0.00% 75 311 0.00% 76 400 0.00% 77 398 0.00% 78 441 0.00% 79 508 0.00% 80 582 0.01% 81 715 0.01% 82 770 0.01% 83 868 0.01% 84 1109 0.01% 85 1409 0.01% 86 1531 0.01% 87 1763 0.02% 88 1957 0.02% 89 2147 0.02% 90 2178 0.02% 91 2552 0.02% 92 2725 0.03% 93 2963 0.03% 94 3341 0.03% 95 3611 0.04% 96 3917 0.04% 97 4320 0.04% 98 4479 0.04% 99 4945 0.05% 100 5445 0.05% 101 5791 0.06% 102 6287 0.06% 103 6877 0.07% 104 7177 0.07% 105 7769 0.08% 106 8403 0.08% 107 9052 0.09% 108 9409 0.09% 109 10026 0.10% 110 10505 0.10% 111 11201 0.11% 112 12077 0.12% 113 12547 0.12% 114 13316 0.13% 115 13995 0.14% 116 14987 0.15% 117 15708 0.15% 118 16216 0.16% 119 16825 0.16% 120 17878 0.17% 121 18690 0.18% 122 19714 0.19% 123 20326 0.20% 124 21685 0.21% 125 22355 0.22% 126 24038 0.23% 127 25076 0.24% 128 26156 0.25% 129 27370 0.27% 130 28964 0.28% 131 30642 0.30% 132 32274 0.31% 133 33662 0.33% 134 35729 0.35% 135 37611 0.37% 136 39358 0.38% 137 42165 0.41% 138 44230 0.43% 139 47500 0.46% 140 50868 0.49% 141 55200 0.54% 142 61355 0.60% 143 68698 0.67% 144 79836 0.77% 145 96021 0.93% 146 121692 1.18% 147 169723 1.65% 148 273902 2.66% 149 580265 5.63% 150 2522946 24.49% 151 5361954 52.04% 10303447 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=24 prefix-density=0.42 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=40.75 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=7.1 sequence=CCTTCCTTGTCCTGGATCTTGGCCTT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=27 prefix-density=0.42 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=48.08 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=11.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172119 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:43:38 Started mapping on | Feb 14 06:43:38 Finished on | Feb 14 06:46:15 Mapping speed, Million of reads per hour | 236.26 Number of input reads | 10303447 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8940235 Uniquely mapped reads % | 86.77% Average mapped length | 295.23 Number of splices: Total | 8707978 Number of splices: Annotated (sjdb) | 8550439 Number of splices: GT/AG | 8559174 Number of splices: GC/AG | 115370 Number of splices: AT/AC | 6292 Number of splices: Non-canonical | 27142 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.26 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348590 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 71775 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.76% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1018974 1018974 1018974 N_multimapping 348590 348590 348590 N_noFeature 254035 8853584 292465 N_ambiguous 94416 471 45893 UnstrandedReadsAssigned:8591784 PositiveStrandReadsAssigned:86180 NegativeStrandReadsAssigned:8601877 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172119 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172119-trimmed-pair1.fastq SRR7172119-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,303,447 reads, 8,608,757 reads pseudoaligned [quant] estimated average fragment length: 241.425 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR7172119.ke.tsv 34699 SRR7172119.se.tsv 87100 total ==> SRR7172119.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.57 890 55.4123 Potri.005G024800.1.v4.1 1035 794.575 284 39.5574 Potri.004G059700.1.v4.1 961 720.59 13 1.99664 Potri.007G009000.2.v4.1 1416 1175.57 20 1.88289 Potri.003G141000.2.v4.1 2943 2702.57 252 10.3197 Potri.016G087400.1.v4.1 270 78.7807 611.597 859.192 Potri.015G069301.1.v4.1 564 327.824 0 0 Potri.010G195200.1.v4.1 1773 1532.57 333.802 24.1053 Potri.012G127500.1.v4.1 977 736.58 2593 389.607 ==> SRR7172119.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 318 SRR7172119 completed mapping pipeline successfully