Starting /dee2/code/volunteer_pipeline.sh SRR7172120 current disk space = 3085492563968 free memory = 1017109220 SRR7172120 SRAfilesize 3d60211fd7fc7ce77ee77480f456d314 SRR7172120.sra SRR7172120.sra file validated SRR7172120 is paired end SRR7172120 is conventional basespace SRR7172120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7865 33.0 33.0 34.0 30.0 34.0 2 32.7545 33.0 33.0 34.0 31.0 34.0 3 31.6485 33.0 31.0 33.0 28.0 34.0 4 32.91325 33.0 33.0 34.0 32.0 34.0 5 33.16375 33.0 33.0 34.0 33.0 34.0 6 36.89225 38.0 37.0 38.0 35.0 38.0 7 37.36725 38.0 38.0 38.0 37.0 38.0 8 37.51075 38.0 38.0 38.0 37.0 38.0 9 37.6165 38.0 38.0 38.0 38.0 38.0 10-14 37.63045 38.0 38.0 38.0 38.0 38.0 15-19 37.568799999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.5749 38.0 38.0 38.0 38.0 38.0 25-29 37.545500000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.49974999999999 38.0 38.0 38.0 37.4 38.0 35-39 37.4594 38.0 38.0 38.0 37.6 38.0 40-44 37.48645 38.0 38.0 38.0 37.2 38.0 45-49 37.410799999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.28505 38.0 38.0 38.0 36.6 38.0 55-59 37.2418 38.0 38.0 38.0 36.4 38.0 60-64 37.06945 38.0 38.0 38.0 36.0 38.0 65-69 37.0891 38.0 38.0 38.0 36.0 38.0 70-74 37.0056 38.0 38.0 38.0 36.0 38.0 75-79 36.91435 38.0 38.0 38.0 35.4 38.0 80-84 36.7681 38.0 38.0 38.0 35.0 38.0 85-89 36.66345 38.0 38.0 38.0 34.4 38.0 90-94 36.615649999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.53339999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.368050000000004 38.0 37.4 38.0 34.0 38.0 105-109 36.10635 38.0 37.0 38.0 33.0 38.0 110-114 36.05605 38.0 37.0 38.0 33.4 38.0 115-119 35.8739 38.0 37.0 38.0 32.2 38.0 120-124 35.690749999999994 38.0 36.6 38.0 31.6 38.0 125-129 35.2992 38.0 35.8 38.0 30.0 38.0 130-134 35.0369 38.0 35.4 38.0 28.2 38.0 135-139 34.54445 38.0 35.0 38.0 27.2 38.0 140-144 33.9788 38.0 34.2 38.0 23.2 38.0 145-149 33.39415 38.0 34.0 38.0 20.0 38.0 150-151 30.008499999999998 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 3.0 13 1.0 14 2.0 15 1.0 16 0.0 17 2.0 18 3.0 19 4.0 20 6.0 21 4.0 22 3.0 23 5.0 24 7.0 25 6.0 26 12.0 27 14.0 28 20.0 29 27.0 30 29.0 31 43.0 32 72.0 33 90.0 34 157.0 35 378.0 36 966.0 37 2143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.469300587293112 17.271756540309664 15.643352909770423 39.6155899626268 2 18.3 26.950000000000003 38.7 16.05 3 17.849999999999998 30.775000000000002 26.424999999999997 24.95 4 20.825 37.375 21.875 19.925 5 18.95 38.775 23.125 19.15 6 16.650000000000002 36.449999999999996 25.900000000000002 21.0 7 12.5 20.25 44.824999999999996 22.425 8 16.775000000000002 22.225 29.099999999999998 31.900000000000002 9 17.575 22.7 31.35 28.375 10-14 19.040000000000003 30.740000000000002 26.165 24.055 15-19 19.28 29.775000000000002 27.735 23.21 20-24 19.439999999999998 29.794999999999998 27.655 23.11 25-29 19.634999999999998 30.005 27.42 22.939999999999998 30-34 19.744999999999997 29.160000000000004 27.71 23.385 35-39 19.96 29.13 27.48 23.43 40-44 19.12 30.11 27.92 22.85 45-49 19.37 29.615000000000002 27.47 23.544999999999998 50-54 19.68 28.985 27.965 23.369999999999997 55-59 19.985 29.409999999999997 27.0 23.605 60-64 19.919999999999998 29.509999999999998 27.115000000000002 23.455000000000002 65-69 20.325 28.68 27.93 23.064999999999998 70-74 19.85 28.810000000000002 27.900000000000002 23.44 75-79 19.715 29.695 27.54 23.05 80-84 20.419999999999998 28.575 27.48 23.525 85-89 20.02 29.304999999999996 27.339999999999996 23.335 90-94 20.255000000000003 28.96 27.075 23.71 95-99 20.335 28.88 27.529999999999998 23.255 100-104 20.36 29.044999999999998 27.18 23.415 105-109 20.61 28.955 27.215 23.22 110-114 20.86 28.689999999999998 27.04 23.41 115-119 20.53 29.13 26.950000000000003 23.39 120-124 20.125 28.63 27.73 23.515 125-129 21.015 28.355000000000004 27.01 23.62 130-134 20.885 28.515 27.265 23.335 135-139 20.825 27.944999999999997 27.800000000000004 23.43 140-144 20.965 28.835 26.745 23.455000000000002 145-149 21.19 28.325 26.85 23.635 150-151 20.674999999999997 28.1125 27.6375 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 3.0 25 3.0 26 7.0 27 14.0 28 16.5 29 21.5 30 30.0 31 34.5 32 43.5 33 58.0 34 71.0 35 79.5 36 113.5 37 147.0 38 159.0 39 178.0 40 202.5 41 232.0 42 254.5 43 258.5 44 257.0 45 257.5 46 257.5 47 239.0 48 204.0 49 174.0 50 146.0 51 119.5 52 104.5 53 83.0 54 52.5 55 40.5 56 34.0 57 25.0 58 20.5 59 13.0 60 6.5 61 8.0 62 5.5 63 3.5 64 2.0 65 1.5 66 1.5 67 2.5 68 4.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.6 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.1875 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.0125 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTGT 10 0.0068396386 144.9375 9 AAAAAAA 135 0.009615169 8.588888 25-29 >>END_MODULE SRR7172120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.27825 34.0 33.0 34.0 33.0 34.0 2 33.37525 34.0 33.0 34.0 33.0 34.0 3 33.3875 34.0 33.0 34.0 33.0 34.0 4 33.322 34.0 33.0 34.0 33.0 34.0 5 33.32075 34.0 33.0 34.0 33.0 34.0 6 37.43725 38.0 38.0 38.0 38.0 38.0 7 37.57475 38.0 38.0 38.0 38.0 38.0 8 37.51625 38.0 38.0 38.0 38.0 38.0 9 37.51425 38.0 38.0 38.0 38.0 38.0 10-14 37.4944 38.0 38.0 38.0 38.0 38.0 15-19 37.5104 38.0 38.0 38.0 38.0 38.0 20-24 37.4948 38.0 38.0 38.0 38.0 38.0 25-29 37.504400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.463049999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.37595 38.0 38.0 38.0 37.2 38.0 40-44 37.386700000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.36365 38.0 38.0 38.0 37.0 38.0 50-54 37.310700000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.21085000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.22215 38.0 38.0 38.0 36.8 38.0 65-69 37.1589 38.0 38.0 38.0 36.4 38.0 70-74 37.053700000000006 38.0 38.0 38.0 36.2 38.0 75-79 37.01445 38.0 38.0 38.0 36.0 38.0 80-84 36.898450000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.887299999999996 38.0 38.0 38.0 35.6 38.0 90-94 36.7336 38.0 38.0 38.0 35.2 38.0 95-99 36.5947 38.0 38.0 38.0 34.6 38.0 100-104 36.50785 38.0 38.0 38.0 34.0 38.0 105-109 36.299150000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.15835 38.0 37.4 38.0 33.6 38.0 115-119 35.95785 38.0 37.0 38.0 33.0 38.0 120-124 35.75645 38.0 36.6 38.0 32.2 38.0 125-129 35.423 38.0 36.4 38.0 29.8 38.0 130-134 35.189499999999995 38.0 36.0 38.0 29.0 38.0 135-139 34.998599999999996 38.0 35.4 38.0 28.6 38.0 140-144 34.54174999999999 38.0 34.8 38.0 27.2 38.0 145-149 33.7834 38.0 34.2 38.0 23.8 38.0 150-151 29.436875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 2.0 17 0.0 18 3.0 19 6.0 20 4.0 21 4.0 22 4.0 23 8.0 24 6.0 25 6.0 26 15.0 27 16.0 28 20.0 29 19.0 30 34.0 31 47.0 32 56.0 33 108.0 34 137.0 35 247.0 36 650.0 37 2595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.449999999999996 12.85 18.575 34.125 2 22.925 21.9 37.275000000000006 17.9 3 21.099999999999998 24.85 31.724999999999998 22.325 4 26.174999999999997 32.425 20.75 20.65 5 23.9 37.875 20.75 17.474999999999998 6 18.55 37.6 24.7 19.15 7 16.900000000000002 15.775 45.275 22.05 8 20.775 21.275 28.749999999999996 29.2 9 22.25 23.25 29.2 25.3 10-14 23.3 28.465 26.484999999999996 21.75 15-19 23.325000000000003 27.72 27.605 21.349999999999998 20-24 23.435 27.965 27.325 21.275 25-29 22.425 28.555000000000003 27.639999999999997 21.38 30-34 22.925 28.185 28.075 20.815 35-39 23.075000000000003 27.544999999999998 28.345 21.035 40-44 23.244999999999997 28.015 28.255000000000003 20.485 45-49 23.23 27.83 28.055000000000003 20.885 50-54 23.21 28.825 27.500000000000004 20.465 55-59 24.060000000000002 27.01 28.000000000000004 20.93 60-64 22.505 28.57 28.12 20.805 65-69 22.935 28.335 28.015 20.715 70-74 23.599999999999998 28.075 27.855 20.47 75-79 23.830000000000002 27.955000000000002 27.744999999999997 20.47 80-84 23.255 27.555000000000003 28.725 20.465 85-89 23.335 27.91 28.625 20.13 90-94 23.03 27.88 28.705000000000002 20.385 95-99 23.385 27.400000000000002 28.365000000000002 20.849999999999998 100-104 24.345 27.02 28.249999999999996 20.385 105-109 23.9 27.52 28.54 20.04 110-114 23.645 27.985 28.12 20.25 115-119 24.02 27.62 28.46 19.900000000000002 120-124 23.669999999999998 28.37 28.23 19.73 125-129 24.305 27.505000000000003 28.410000000000004 19.78 130-134 24.075 27.955000000000002 28.015 19.955000000000002 135-139 25.069999999999997 27.92 27.439999999999998 19.57 140-144 24.685000000000002 27.97 27.765 19.580000000000002 145-149 24.81 27.834999999999997 27.73 19.625 150-151 24.8 28.1125 27.725 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 2.5 26 5.0 27 6.0 28 5.5 29 8.5 30 13.5 31 16.5 32 20.0 33 36.5 34 47.5 35 51.5 36 79.5 37 109.0 38 136.5 39 182.5 40 197.5 41 217.5 42 261.5 43 276.5 44 286.5 45 267.5 46 267.5 47 262.5 48 231.0 49 204.0 50 172.5 51 151.5 52 128.5 53 98.0 54 60.5 55 43.5 56 36.0 57 30.5 58 27.0 59 17.5 60 10.5 61 6.0 62 4.5 63 5.0 64 3.0 65 2.0 66 1.5 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCATTT 10 0.006830828 145.0 7 >>END_MODULE Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560519 spots for SRR7172120.sra Written 560519 spots for SRR7172120.sra Read 560523 spots for SRR7172120.sra Written 560523 spots for SRR7172120.sra SRR ids: ['SRR7172120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aagaq_pe SRR7172120.sra spots: 11210384 blocks: [[1, 560519], [560520, 1121038], [1121039, 1681557], [1681558, 2242076], [2242077, 2802595], [2802596, 3363114], [3363115, 3923633], [3923634, 4484152], [4484153, 5044671], [5044672, 5605190], [5605191, 6165709], [6165710, 6726228], [6726229, 7286747], [7286748, 7847266], [7847267, 8407785], [8407786, 8968304], [8968305, 9528823], [9528824, 10089342], [10089343, 10649861], [10649862, 11210384]] SRR7172120 file size 3777130 SRR7172120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172120 SRR7172120_1.fastq SRR7172120_2.fastq Input file: SRR7172120_1.fastq Paired file: SRR7172120_2.fastq trimmed: SRR7172120-trimmed-pair1.fastq, SRR7172120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:11:44 2025 >> started Fri Feb 14 06:11:58 2025 >> done (14.172s) 11210384 read pairs processed; of these: 3741 ( 0.03%) short read pairs filtered out after trimming by size control 2505 ( 0.02%) empty read pairs filtered out after trimming by size control 11204138 (99.94%) read pairs available; of these: 6511695 (58.12%) trimmed read pairs available after processing 4692443 (41.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 1 0.00% 23 5 0.00% 24 5 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 4 0.00% 30 9 0.00% 31 5 0.00% 32 4 0.00% 33 8 0.00% 34 5 0.00% 35 4 0.00% 36 8 0.00% 37 5 0.00% 38 3 0.00% 39 8 0.00% 40 13 0.00% 41 7 0.00% 42 7 0.00% 43 9 0.00% 44 5 0.00% 45 12 0.00% 46 10 0.00% 47 11 0.00% 48 7 0.00% 49 14 0.00% 50 25 0.00% 51 20 0.00% 52 28 0.00% 53 25 0.00% 54 32 0.00% 55 29 0.00% 56 44 0.00% 57 55 0.00% 58 40 0.00% 59 52 0.00% 60 75 0.00% 61 81 0.00% 62 102 0.00% 63 107 0.00% 64 128 0.00% 65 125 0.00% 66 190 0.00% 67 182 0.00% 68 222 0.00% 69 246 0.00% 70 250 0.00% 71 316 0.00% 72 357 0.00% 73 464 0.00% 74 493 0.00% 75 552 0.00% 76 666 0.01% 77 769 0.01% 78 792 0.01% 79 904 0.01% 80 1071 0.01% 81 1173 0.01% 82 1406 0.01% 83 1586 0.01% 84 1913 0.02% 85 2111 0.02% 86 2537 0.02% 87 2774 0.02% 88 3090 0.03% 89 3172 0.03% 90 3582 0.03% 91 4029 0.04% 92 4431 0.04% 93 4658 0.04% 94 5137 0.05% 95 5517 0.05% 96 6052 0.05% 97 6367 0.06% 98 6794 0.06% 99 7453 0.07% 100 8161 0.07% 101 8628 0.08% 102 9064 0.08% 103 9854 0.09% 104 10384 0.09% 105 11199 0.10% 106 11964 0.11% 107 12524 0.11% 108 13517 0.12% 109 13995 0.12% 110 14526 0.13% 111 15311 0.14% 112 16051 0.14% 113 17143 0.15% 114 18252 0.16% 115 19081 0.17% 116 20188 0.18% 117 20794 0.19% 118 21701 0.19% 119 22347 0.20% 120 23319 0.21% 121 24481 0.22% 122 25902 0.23% 123 27080 0.24% 124 28286 0.25% 125 29325 0.26% 126 30803 0.27% 127 32651 0.29% 128 34027 0.30% 129 36350 0.32% 130 37726 0.34% 131 39886 0.36% 132 42215 0.38% 133 44786 0.40% 134 47359 0.42% 135 50337 0.45% 136 53320 0.48% 137 57490 0.51% 138 62548 0.56% 139 67672 0.60% 140 74127 0.66% 141 82638 0.74% 142 93557 0.84% 143 108567 0.97% 144 130413 1.16% 145 161292 1.44% 146 212189 1.89% 147 301927 2.69% 148 477575 4.26% 149 893265 7.97% 150 2803497 25.02% 151 4692443 41.88% 11204138 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=28 prefix-density=0.47 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=338.66 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=33.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=4.76 fanout-score-rank=12 prefix-density=0.82 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=102.38 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=15.5 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:12:47 Started mapping on | Feb 14 06:12:47 Finished on | Feb 14 06:14:32 Mapping speed, Million of reads per hour | 384.14 Number of input reads | 11204138 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10511313 Uniquely mapped reads % | 93.82% Average mapped length | 293.24 Number of splices: Total | 9977350 Number of splices: Annotated (sjdb) | 9794888 Number of splices: GT/AG | 9811773 Number of splices: GC/AG | 127105 Number of splices: AT/AC | 7433 Number of splices: Non-canonical | 31039 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.28 Insertion rate per base | 0.03% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318734 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 26550 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 379026 379026 379026 N_multimapping 318734 318734 318734 N_noFeature 281739 10399959 330187 N_ambiguous 114657 765 51357 UnstrandedReadsAssigned:10114917 PositiveStrandReadsAssigned:110589 NegativeStrandReadsAssigned:10129769 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172120-trimmed-pair1.fastq SRR7172120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,204,138 reads, 10,026,740 reads pseudoaligned [quant] estimated average fragment length: 232.115 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7172120.ke.tsv 34699 SRR7172120.se.tsv 87100 total ==> SRR7172120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.88 675 32.2167 Potri.005G024800.1.v4.1 1035 803.885 195 20.6878 Potri.004G059700.1.v4.1 961 729.894 29 3.38854 Potri.007G009000.2.v4.1 1416 1184.88 0 0 Potri.003G141000.2.v4.1 2943 2711.88 421.169 13.2452 Potri.016G087400.1.v4.1 270 81.0413 925 973.441 Potri.015G069301.1.v4.1 564 335.49 0 0 Potri.010G195200.1.v4.1 1773 1541.88 316 17.4787 Potri.012G127500.1.v4.1 977 745.889 3562 407.281 ==> SRR7172120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 198 SRR7172120 completed mapping pipeline successfully