Starting /dee2/code/volunteer_pipeline.sh SRR7172121 current disk space = 3110986526720 free memory = 1455168700 SRR7172121 SRAfilesize fd8669735aba48d787fec6a4288c174b SRR7172121.sra SRR7172121.sra file validated SRR7172121 is paired end SRR7172121 is conventional basespace SRR7172121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7745 33.0 33.0 34.0 32.0 34.0 2 33.171 34.0 33.0 34.0 32.0 34.0 3 32.78825 33.0 33.0 34.0 32.0 34.0 4 32.922 33.0 33.0 34.0 32.0 34.0 5 33.1165 34.0 33.0 34.0 32.0 34.0 6 36.95025 38.0 37.0 38.0 35.0 38.0 7 37.459 38.0 38.0 38.0 37.0 38.0 8 37.45475 38.0 38.0 38.0 37.0 38.0 9 37.371 38.0 38.0 38.0 38.0 38.0 10-14 37.5396 38.0 38.0 38.0 38.0 38.0 15-19 37.53405 38.0 38.0 38.0 38.0 38.0 20-24 37.48145 38.0 38.0 38.0 37.6 38.0 25-29 37.424400000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.30925 38.0 38.0 38.0 36.8 38.0 35-39 37.2957 38.0 38.0 38.0 37.0 38.0 40-44 37.22825 38.0 38.0 38.0 36.8 38.0 45-49 37.18765 38.0 38.0 38.0 36.8 38.0 50-54 37.318400000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.31015 38.0 38.0 38.0 37.0 38.0 60-64 37.172399999999996 38.0 38.0 38.0 36.4 38.0 65-69 37.199600000000004 38.0 38.0 38.0 36.6 38.0 70-74 37.1523 38.0 38.0 38.0 36.0 38.0 75-79 37.00385 38.0 38.0 38.0 36.0 38.0 80-84 36.9591 38.0 38.0 38.0 36.0 38.0 85-89 36.8406 38.0 38.0 38.0 35.6 38.0 90-94 36.738350000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.679449999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.53574999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.455799999999996 38.0 38.0 38.0 33.8 38.0 110-114 36.1177 38.0 37.8 38.0 33.6 38.0 115-119 35.98205 38.0 37.0 38.0 32.8 38.0 120-124 35.782650000000004 38.0 37.0 38.0 31.6 38.0 125-129 35.418549999999996 38.0 36.0 38.0 31.0 38.0 130-134 35.271550000000005 38.0 36.0 38.0 31.0 38.0 135-139 34.87815 38.0 35.8 38.0 28.6 38.0 140-144 34.2423 38.0 34.0 38.0 25.4 38.0 145-149 33.6768 38.0 33.6 38.0 22.0 38.0 150-151 28.594875000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 3.0 20 1.0 21 6.0 22 7.0 23 9.0 24 14.0 25 11.0 26 9.0 27 27.0 28 29.0 29 33.0 30 48.0 31 56.0 32 77.0 33 109.0 34 134.0 35 261.0 36 608.0 37 2552.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.375 17.474999999999998 15.8 38.35 2 19.975 24.224999999999998 38.65 17.150000000000002 3 18.075 30.95 27.175 23.799999999999997 4 20.40510127531883 36.75918979744936 23.10577644411103 19.72993248312078 5 20.75 37.175000000000004 23.775 18.3 6 16.375 36.0 25.324999999999996 22.3 7 11.899999999999999 19.15 48.05 20.9 8 19.925 20.1 28.4 31.574999999999996 9 17.58933064921993 21.71615500754907 31.731253145445393 28.963261197785606 10-14 19.687953192978945 28.95934390158524 27.024053608041203 24.32864929739461 15-19 19.335 28.305000000000003 28.02 24.34 20-24 19.7 29.075 27.689999999999998 23.535 25-29 20.07600380019001 28.7714385719286 27.66638331916596 23.486174308715434 30-34 19.470000000000002 29.160000000000004 27.975 23.395 35-39 19.725 29.095 27.955000000000002 23.225 40-44 19.45597279863993 29.226461323066154 27.896394819740987 23.42117105855293 45-49 20.0880132019803 28.849327399109864 27.729159373906086 23.33350002500375 50-54 19.634999999999998 29.189999999999998 27.985 23.189999999999998 55-59 19.63 28.535 28.389999999999997 23.445 60-64 19.97 28.744999999999997 27.889999999999997 23.395 65-69 20.02 28.395 28.465 23.119999999999997 70-74 19.535 28.685 28.1 23.68 75-79 20.29 28.73 27.474999999999998 23.505000000000003 80-84 20.075000000000003 28.425 27.92 23.580000000000002 85-89 19.816981698169815 28.937893789378936 27.86278627862786 23.382338233823383 90-94 20.11 28.425 27.725 23.74 95-99 19.605 28.884999999999998 27.834999999999997 23.674999999999997 100-104 19.790989549477477 28.97644882244112 27.681384069203457 23.551177558877946 105-109 19.92599629981499 28.576428821441073 28.136406820341016 23.36116805840292 110-114 20.62124248496994 28.98296593186373 27.349699398797593 23.04609218436874 115-119 20.544999999999998 28.7 27.665 23.09 120-124 20.78474550823282 28.386967619238273 27.55117361493419 23.277113257594714 125-129 21.00175306786877 28.539944903581265 26.98722764838467 23.471074380165287 130-134 20.805 28.46 27.41 23.325000000000003 135-139 20.91 28.244999999999997 27.375 23.47 140-144 21.151057552877646 27.956397819890995 27.13135656782839 23.761188059402972 145-149 20.79 28.01 27.205000000000002 23.995 150-151 20.6625 29.325000000000003 27.175 22.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 2.0 25 2.5 26 5.5 27 7.5 28 9.5 29 18.0 30 26.5 31 35.0 32 47.0 33 57.0 34 65.5 35 78.5 36 97.5 37 123.0 38 152.5 39 185.5 40 199.5 41 225.5 42 260.0 43 270.0 44 278.0 45 262.5 46 256.5 47 246.0 48 208.5 49 177.0 50 154.0 51 135.5 52 98.0 53 68.5 54 57.5 55 48.5 56 39.5 57 25.5 58 18.0 59 13.5 60 7.0 61 4.5 62 5.0 63 7.0 64 5.5 65 2.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.65 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.2 115-119 0.0 120-124 0.095 125-129 0.17500000000000002 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1625 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.95 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGCA 10 0.0063626515 148.4359 7 GAGTAGC 10 0.0063626515 148.4359 6 GTAGCAA 10 0.0063626515 148.4359 8 >>END_MODULE SRR7172121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97675 33.0 33.0 34.0 32.0 34.0 2 33.09325 34.0 33.0 34.0 33.0 34.0 3 33.17925 34.0 33.0 34.0 33.0 34.0 4 33.13925 34.0 33.0 34.0 33.0 34.0 5 33.181 34.0 33.0 34.0 33.0 34.0 6 37.25475 38.0 38.0 38.0 37.0 38.0 7 37.30725 38.0 38.0 38.0 37.0 38.0 8 37.3255 38.0 38.0 38.0 37.0 38.0 9 37.3235 38.0 38.0 38.0 37.0 38.0 10-14 37.27455 38.0 38.0 38.0 37.0 38.0 15-19 37.24640000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.223400000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.14365 38.0 38.0 38.0 37.0 38.0 30-34 37.126099999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.11750000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.05585 38.0 38.0 38.0 36.6 38.0 45-49 37.04065 38.0 38.0 38.0 36.6 38.0 50-54 37.11185 38.0 38.0 38.0 37.0 38.0 55-59 37.06565 38.0 38.0 38.0 36.8 38.0 60-64 37.05114999999999 38.0 38.0 38.0 36.6 38.0 65-69 36.9012 38.0 38.0 38.0 36.0 38.0 70-74 36.9116 38.0 38.0 38.0 36.0 38.0 75-79 36.81079999999999 38.0 38.0 38.0 35.8 38.0 80-84 36.73915000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.62915 38.0 38.0 38.0 35.0 38.0 90-94 36.4962 38.0 38.0 38.0 34.6 38.0 95-99 36.3646 38.0 38.0 38.0 34.0 38.0 100-104 36.3248 38.0 38.0 38.0 34.0 38.0 105-109 36.2227 38.0 38.0 38.0 34.0 38.0 110-114 35.967699999999994 38.0 37.8 38.0 33.2 38.0 115-119 35.84585 38.0 37.4 38.0 32.0 38.0 120-124 35.6875 38.0 37.2 38.0 31.4 38.0 125-129 35.360400000000006 38.0 36.8 38.0 31.0 38.0 130-134 34.9381 38.0 36.0 38.0 28.8 38.0 135-139 34.38595 38.0 36.0 38.0 25.8 38.0 140-144 33.7547 38.0 33.6 38.0 21.6 38.0 145-149 33.158500000000004 38.0 33.0 38.0 17.6 38.0 150-151 28.21775 34.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 1.0 6 3.0 7 1.0 8 2.0 9 0.0 10 1.0 11 2.0 12 1.0 13 2.0 14 1.0 15 1.0 16 2.0 17 5.0 18 7.0 19 2.0 20 1.0 21 3.0 22 8.0 23 10.0 24 12.0 25 17.0 26 23.0 27 17.0 28 24.0 29 48.0 30 51.0 31 69.0 32 81.0 33 98.0 34 134.0 35 239.0 36 537.0 37 2588.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.17238787271361 13.655725382109745 19.343522926584818 34.82836381859183 2 23.610415623435152 20.906359539308962 38.90836254381572 16.57486229344016 3 20.77077077077077 24.8998998998999 31.03103103103103 23.2982982982983 4 24.005006257822277 34.36795994993742 20.32540675844806 21.30162703379224 5 22.7977977977978 37.33733733733734 22.44744744744745 17.417417417417415 6 17.85177766649975 37.0555833750626 24.386579869804706 20.70605908863295 7 16.299449173760642 14.797195793690534 46.344516775162745 22.55883825738608 8 20.97097097097097 20.92092092092092 27.427427427427425 30.680680680680684 9 20.94070552914686 22.742056542406804 28.32124093069802 27.995996997748314 10-14 21.914105516067675 28.13594954449895 27.43017319050956 22.519771748923816 15-19 22.609392209872833 27.610894162411135 28.176629618504055 21.603084009211976 20-24 22.312271749462205 28.650757916854268 27.420081044574516 21.61688928910901 25-29 22.941147057352868 28.126406320316015 28.0114005700285 20.921046052302618 30-34 22.74 28.465 27.925 20.87 35-39 22.31 28.749999999999996 27.685 21.255 40-44 23.115 28.125 27.73 21.029999999999998 45-49 22.869999999999997 28.744999999999997 27.08 21.305 50-54 22.96114805740287 27.661383069153455 28.41142057102855 20.96604830241512 55-59 22.48062015503876 27.836959239809957 28.287071767941985 21.3953488372093 60-64 23.120780195048763 28.447111777944485 27.721930482620653 20.710177544386095 65-69 23.263142099734907 28.249887460611212 27.849747411594056 20.63722302805982 70-74 23.06191857557267 27.9183755126538 27.848354506351907 21.171351405421625 75-79 23.07153576788394 28.054027013506754 28.284142071035518 20.590295147573787 80-84 23.729491796718687 27.546018407362943 28.11124449779912 20.61324529811925 85-89 23.5032261291452 28.19986995448407 27.58465462912019 20.712249287250536 90-94 23.220449202140962 27.647441348606872 28.307738482317042 20.82437096693512 95-99 22.78183455036511 28.223467040112034 28.343503050915274 20.651195358607584 100-104 22.916145807290363 27.721386069303467 28.371418570928547 20.991049552477623 105-109 23.21 28.349999999999998 27.54 20.9 110-114 23.724999999999998 28.535 27.625 20.115 115-119 23.75356303445517 28.00920138020703 28.119217882682403 20.1180177026554 120-124 23.05076269067267 27.47686921730433 28.772193048262068 20.70017504376094 125-129 24.267280184055217 28.053416024807444 27.47324197259178 20.206061818545564 130-134 24.049619847939173 27.831132452981194 28.331332533013203 19.787915166066426 135-139 23.927178153446032 28.6035810743223 28.04341302390717 19.425827748324497 140-144 24.00220066019806 28.15344603381014 27.87336200860258 19.97099129738922 145-149 24.75747574757476 28.202820282028203 27.662766276627664 19.376937693769378 150-151 23.875 27.962500000000002 28.075 20.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 2.0 16 1.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 2.0 26 4.5 27 6.0 28 6.5 29 9.0 30 13.5 31 16.0 32 24.0 33 33.5 34 45.0 35 59.0 36 82.5 37 112.0 38 148.0 39 171.5 40 190.0 41 226.0 42 262.0 43 285.5 44 291.0 45 271.0 46 258.5 47 259.5 48 237.5 49 205.0 50 165.0 51 138.5 52 114.5 53 82.5 54 68.0 55 57.5 56 37.5 57 27.5 58 24.5 59 14.5 60 9.5 61 9.0 62 5.0 63 4.5 64 4.5 65 2.0 66 1.5 67 2.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.15 3 0.1 4 0.125 5 0.1 6 0.15 7 0.15 8 0.1 9 0.075 10-14 0.11 15-19 0.13 20-24 0.055 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.025 60-64 0.025 65-69 0.034999999999999996 70-74 0.03 75-79 0.05 80-84 0.04 85-89 0.034999999999999996 90-94 0.045 95-99 0.03 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.025 125-129 0.03 130-134 0.04 135-139 0.03 140-144 0.03 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1625 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGAGAT 10 0.006830828 145.0 5 >>END_MODULE Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025398 spots for SRR7172121.sra Written 1025398 spots for SRR7172121.sra Read 1025406 spots for SRR7172121.sra Written 1025406 spots for SRR7172121.sra SRR ids: ['SRR7172121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ehheitt5 SRR7172121.sra spots: 20507968 blocks: [[1, 1025398], [1025399, 2050796], [2050797, 3076194], [3076195, 4101592], [4101593, 5126990], [5126991, 6152388], [6152389, 7177786], [7177787, 8203184], [8203185, 9228582], [9228583, 10253980], [10253981, 11279378], [11279379, 12304776], [12304777, 13330174], [13330175, 14355572], [14355573, 15380970], [15380971, 16406368], [16406369, 17431766], [17431767, 18457164], [18457165, 19482562], [19482563, 20507968]] SRR7172121 file size 6927777 SRR7172121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172121 SRR7172121_1.fastq SRR7172121_2.fastq Input file: SRR7172121_1.fastq Paired file: SRR7172121_2.fastq trimmed: SRR7172121-trimmed-pair1.fastq, SRR7172121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:57:14 2025 >> started Fri Feb 14 17:57:44 2025 >> done (29.698s) 20507968 read pairs processed; of these: 11533 ( 0.06%) short read pairs filtered out after trimming by size control 10059 ( 0.05%) empty read pairs filtered out after trimming by size control 20486376 (99.89%) read pairs available; of these: 11419232 (55.74%) trimmed read pairs available after processing 9067144 (44.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 5 0.00% 23 6 0.00% 24 5 0.00% 25 7 0.00% 26 5 0.00% 27 3 0.00% 28 11 0.00% 29 5 0.00% 30 3 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 9 0.00% 35 15 0.00% 36 9 0.00% 37 7 0.00% 38 7 0.00% 39 5 0.00% 40 10 0.00% 41 9 0.00% 42 5 0.00% 43 11 0.00% 44 7 0.00% 45 10 0.00% 46 11 0.00% 47 12 0.00% 48 16 0.00% 49 14 0.00% 50 20 0.00% 51 33 0.00% 52 25 0.00% 53 28 0.00% 54 41 0.00% 55 41 0.00% 56 45 0.00% 57 75 0.00% 58 197 0.00% 59 306 0.00% 60 203 0.00% 61 138 0.00% 62 98 0.00% 63 124 0.00% 64 124 0.00% 65 148 0.00% 66 164 0.00% 67 180 0.00% 68 204 0.00% 69 226 0.00% 70 278 0.00% 71 333 0.00% 72 370 0.00% 73 416 0.00% 74 496 0.00% 75 597 0.00% 76 727 0.00% 77 822 0.00% 78 1031 0.01% 79 1194 0.01% 80 1247 0.01% 81 1335 0.01% 82 1701 0.01% 83 3080 0.02% 84 4384 0.02% 85 4711 0.02% 86 4348 0.02% 87 4825 0.02% 88 4921 0.02% 89 4892 0.02% 90 4544 0.02% 91 4999 0.02% 92 5467 0.03% 93 5894 0.03% 94 6317 0.03% 95 7109 0.03% 96 7476 0.04% 97 8352 0.04% 98 8953 0.04% 99 9754 0.05% 100 11361 0.06% 101 11348 0.06% 102 11642 0.06% 103 12552 0.06% 104 13365 0.07% 105 14189 0.07% 106 14874 0.07% 107 15765 0.08% 108 16821 0.08% 109 17993 0.09% 110 18893 0.09% 111 19993 0.10% 112 21177 0.10% 113 22808 0.11% 114 23898 0.12% 115 25010 0.12% 116 26732 0.13% 117 28641 0.14% 118 29908 0.15% 119 31639 0.15% 120 33026 0.16% 121 35024 0.17% 122 37009 0.18% 123 39262 0.19% 124 41969 0.20% 125 44546 0.22% 126 46989 0.23% 127 49960 0.24% 128 52868 0.26% 129 55580 0.27% 130 58239 0.28% 131 61797 0.30% 132 65326 0.32% 133 68755 0.34% 134 73095 0.36% 135 77848 0.38% 136 83585 0.41% 137 88309 0.43% 138 95732 0.47% 139 104654 0.51% 140 119118 0.58% 141 128399 0.63% 142 144772 0.71% 143 168543 0.82% 144 200269 0.98% 145 236821 1.16% 146 308782 1.51% 147 428623 2.09% 148 639454 3.12% 149 1300771 6.35% 150 6028276 29.43% 151 9067144 44.26% 20486376 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.19 sequence-density-rank=10 fanout-score=13.23 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=3.2 sequence=TTGCAGCCACTGCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=24.19 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:59:18 Started mapping on | Feb 14 17:59:18 Finished on | Feb 14 18:01:38 Mapping speed, Million of reads per hour | 526.79 Number of input reads | 20486376 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19509868 Uniquely mapped reads % | 95.23% Average mapped length | 294.82 Number of splices: Total | 19154017 Number of splices: Annotated (sjdb) | 18818031 Number of splices: GT/AG | 18839852 Number of splices: GC/AG | 248991 Number of splices: AT/AC | 15237 Number of splices: Non-canonical | 49937 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.45 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 555664 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 43513 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435097 435097 435097 N_multimapping 555664 555664 555664 N_noFeature 545483 19316256 632902 N_ambiguous 202810 1184 95964 UnstrandedReadsAssigned:18761575 PositiveStrandReadsAssigned:192428 NegativeStrandReadsAssigned:18781002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172121-trimmed-pair1.fastq SRR7172121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,486,376 reads, 18,586,720 reads pseudoaligned [quant] estimated average fragment length: 250.46 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7172121.ke.tsv 34699 SRR7172121.se.tsv 87100 total ==> SRR7172121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.54 1482 42.6543 Potri.005G024800.1.v4.1 1035 785.54 502 32.5286 Potri.004G059700.1.v4.1 961 711.569 92 6.58113 Potri.007G009000.2.v4.1 1416 1166.54 0 0 Potri.003G141000.2.v4.1 2943 2693.54 848.385 16.0324 Potri.016G087400.1.v4.1 270 75.6702 1281 861.696 Potri.015G069301.1.v4.1 564 319.18 0 0 Potri.010G195200.1.v4.1 1773 1523.54 444 14.834 Potri.012G127500.1.v4.1 977 727.569 6878 481.191 ==> SRR7172121.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 644 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 113 SRR7172121 completed mapping pipeline successfully