Starting /dee2/code/volunteer_pipeline.sh SRR7172122 current disk space = 3085402873856 free memory = 1449582648 SRR7172122 SRAfilesize 9f51edc886089ea8ad145d904b32346d SRR7172122.sra SRR7172122.sra file validated SRR7172122 is paired end SRR7172122 is conventional basespace SRR7172122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.56625 32.0 18.0 33.0 18.0 34.0 2 30.37875 31.0 29.0 33.0 27.0 34.0 3 31.9415 33.0 31.0 33.0 29.0 34.0 4 32.33575 33.0 33.0 33.0 31.0 34.0 5 32.81375 33.0 33.0 33.0 32.0 34.0 6 37.12025 38.0 37.0 38.0 36.0 38.0 7 37.39875 38.0 38.0 38.0 37.0 38.0 8 37.5145 38.0 38.0 38.0 37.0 38.0 9 37.5475 38.0 38.0 38.0 38.0 38.0 10-14 37.52695 38.0 38.0 38.0 38.0 38.0 15-19 37.6016 38.0 38.0 38.0 38.0 38.0 20-24 37.5994 38.0 38.0 38.0 38.0 38.0 25-29 37.48675000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.4968 38.0 38.0 38.0 37.8 38.0 35-39 37.42885 38.0 38.0 38.0 37.6 38.0 40-44 37.31395 38.0 38.0 38.0 37.0 38.0 45-49 37.38155 38.0 38.0 38.0 37.0 38.0 50-54 37.37335 38.0 38.0 38.0 37.0 38.0 55-59 37.426950000000005 38.0 38.0 38.0 37.2 38.0 60-64 37.406099999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.372350000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.29145 38.0 38.0 38.0 37.0 38.0 75-79 37.282000000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.137249999999995 38.0 38.0 38.0 36.2 38.0 85-89 36.9869 38.0 38.0 38.0 35.8 38.0 90-94 36.9541 38.0 38.0 38.0 35.4 38.0 95-99 36.90185 38.0 38.0 38.0 35.2 38.0 100-104 36.73165 38.0 38.0 38.0 34.8 38.0 105-109 36.70785 38.0 38.0 38.0 34.8 38.0 110-114 36.3839 38.0 38.0 38.0 34.0 38.0 115-119 35.8993 38.0 37.0 38.0 31.8 38.0 120-124 36.30095 38.0 37.8 38.0 34.0 38.0 125-129 35.937400000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.856550000000006 38.0 36.6 38.0 32.0 38.0 135-139 35.6654 38.0 36.2 38.0 31.0 38.0 140-144 35.149950000000004 38.0 36.0 38.0 30.6 38.0 145-149 34.6163 38.0 35.8 38.0 29.2 38.0 150-151 30.1535 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 3.0 18 1.0 19 3.0 20 0.0 21 3.0 22 1.0 23 4.0 24 7.0 25 11.0 26 17.0 27 15.0 28 18.0 29 25.0 30 29.0 31 45.0 32 52.0 33 81.0 34 125.0 35 247.0 36 659.0 37 2649.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.8 16.175 15.35 37.675 2 20.125 22.325 37.85 19.7 3 19.8 29.25 26.200000000000003 24.75 4 24.15 36.5 19.05 20.3 5 21.95 36.199999999999996 22.975 18.875 6 17.575 35.325 24.525 22.575 7 14.499999999999998 20.549999999999997 45.074999999999996 19.875 8 18.575 21.625 29.049999999999997 30.75 9 19.925 21.25 30.95 27.875 10-14 19.917905591430145 29.518946788807128 26.170095609951442 24.393052009811285 15-19 21.310000000000002 28.43 27.229999999999997 23.03 20-24 21.21 28.13 27.089999999999996 23.57 25-29 21.151057552877646 27.986399319965997 27.616380819040952 23.246162308115405 30-34 21.16211621162116 28.332833283328334 26.887688768876888 23.617361736173617 35-39 21.10527631907977 27.6419104776194 27.426856714178545 23.82595648912228 40-44 20.914182836567313 27.99059811962393 27.320464092818565 23.7747549509902 45-49 21.313196979546934 28.064209631444715 27.374106115917385 23.248487273090966 50-54 21.256062803140157 27.75638781939097 27.231361568078405 23.756187809390468 55-59 20.880000000000003 28.275 27.060000000000002 23.785 60-64 20.775 27.589999999999996 27.400000000000002 24.235 65-69 21.135 27.26 27.32 24.285 70-74 21.74608730436522 27.67638381919096 26.871343567178357 23.70618530926546 75-79 21.905 27.705000000000002 26.66 23.73 80-84 22.319463892778554 27.765553110622125 26.980396079215847 22.934586917383477 85-89 21.30171594376907 27.825303917154436 27.13492420831457 23.73805593076192 90-94 22.042714950232583 27.51463012054219 27.01445505927074 23.428199869954483 95-99 21.78608930446522 27.9813990699535 26.711335566778338 23.52117605880294 100-104 21.897664182463863 27.724703646276193 26.55929575351373 23.81833641774621 105-109 21.783267490123517 27.859178876831525 26.518977846677 23.838575786367954 110-114 22.358969206811675 28.306625810016577 26.19179183201889 23.14261315115286 115-119 22.19160236496643 27.693155626816313 26.620903898186192 23.494338110031066 120-124 22.462862001700596 27.734707147501624 26.114139948982146 23.688290901815638 125-129 22.278988229401453 27.778612572001 26.17580766341097 23.766591535186578 130-134 22.72613630681534 27.83639181959098 26.061303065153258 23.376168808440422 135-139 22.716135806790337 27.76638831941597 25.896294814740738 23.621181059052955 140-144 22.51287950782774 27.924773670784774 25.658980643225128 23.903366178162358 145-149 23.113868320992594 27.991795077046227 25.470282169301584 23.424054432659595 150-151 22.525000000000002 27.6 25.974999999999998 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 1.0 21 2.0 22 2.5 23 2.0 24 2.0 25 5.0 26 8.0 27 9.0 28 11.5 29 16.0 30 18.0 31 30.0 32 42.0 33 47.0 34 60.5 35 75.0 36 89.5 37 108.0 38 128.0 39 162.5 40 190.5 41 195.0 42 205.0 43 214.5 44 238.0 45 230.5 46 218.0 47 218.5 48 194.5 49 175.5 50 149.0 51 134.0 52 120.0 53 106.0 54 98.0 55 82.0 56 66.0 57 55.0 58 50.5 59 47.5 60 40.0 61 33.5 62 30.0 63 25.0 64 18.0 65 12.0 66 8.5 67 7.5 68 6.0 69 2.5 70 1.0 71 0.5 72 0.5 73 1.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.11499999999999999 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.01 35-39 0.025 40-44 0.02 45-49 0.015 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.02 85-89 0.055 90-94 0.034999999999999996 95-99 0.005 100-104 0.034999999999999996 105-109 0.015 110-114 0.46499999999999997 115-119 0.21 120-124 0.034999999999999996 125-129 0.17500000000000002 130-134 0.005 135-139 0.005 140-144 0.034999999999999996 145-149 0.06 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.856416772554 97.25 2 0.8640406607369758 1.7000000000000002 3 0.20330368487928843 0.6 4 0.025412960609911054 0.1 5 0.0 0.0 6 0.025412960609911054 0.15 7 0.0 0.0 8 0.025412960609911054 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGG 8 0.2 No Hit GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGC 10 0.006830828 145.0 5 >>END_MODULE SRR7172122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09625 33.0 33.0 34.0 33.0 34.0 2 33.17525 34.0 33.0 34.0 33.0 34.0 3 33.14925 34.0 33.0 34.0 33.0 34.0 4 33.12875 34.0 33.0 34.0 33.0 34.0 5 32.9975 34.0 33.0 34.0 33.0 34.0 6 37.2185 38.0 38.0 38.0 37.0 38.0 7 37.2875 38.0 38.0 38.0 38.0 38.0 8 37.2875 38.0 38.0 38.0 38.0 38.0 9 37.2765 38.0 38.0 38.0 37.0 38.0 10-14 37.278549999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.2251 38.0 38.0 38.0 37.0 38.0 20-24 37.164 38.0 38.0 38.0 37.0 38.0 25-29 37.2419 38.0 38.0 38.0 37.0 38.0 30-34 37.285 38.0 38.0 38.0 37.0 38.0 35-39 37.249300000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.09305 38.0 38.0 38.0 37.0 38.0 45-49 37.1804 38.0 38.0 38.0 37.0 38.0 50-54 37.186949999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.125 38.0 38.0 38.0 37.0 38.0 60-64 37.12055 38.0 38.0 38.0 36.8 38.0 65-69 37.05645 38.0 38.0 38.0 36.8 38.0 70-74 37.10985 38.0 38.0 38.0 37.0 38.0 75-79 37.009750000000004 38.0 38.0 38.0 36.2 38.0 80-84 36.877050000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.74075 38.0 38.0 38.0 35.0 38.0 90-94 36.498599999999996 38.0 38.0 38.0 34.2 38.0 95-99 36.44575 38.0 38.0 38.0 34.2 38.0 100-104 36.4225 38.0 38.0 38.0 34.2 38.0 105-109 36.40405 38.0 38.0 38.0 34.0 38.0 110-114 36.21935 38.0 38.0 38.0 33.8 38.0 115-119 36.122550000000004 38.0 38.0 38.0 33.6 38.0 120-124 35.89515 38.0 37.8 38.0 32.2 38.0 125-129 35.698949999999996 38.0 37.0 38.0 31.0 38.0 130-134 35.252250000000004 38.0 36.2 38.0 29.8 38.0 135-139 34.8716 38.0 36.0 38.0 28.2 38.0 140-144 34.245250000000006 38.0 35.4 38.0 25.8 38.0 145-149 33.2637 38.0 33.0 38.0 19.6 38.0 150-151 27.675624999999997 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 0.0 15 2.0 16 3.0 17 2.0 18 2.0 19 3.0 20 1.0 21 9.0 22 12.0 23 12.0 24 8.0 25 9.0 26 14.0 27 14.0 28 30.0 29 35.0 30 42.0 31 51.0 32 66.0 33 99.0 34 143.0 35 221.0 36 579.0 37 2624.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.25831457864466 12.55313828457114 18.37959489872468 35.80895223805952 2 23.861930965482742 20.710355177588795 35.967983991996 19.459729864932466 3 21.785892946473236 23.88694347173587 29.939969984992498 24.387193596798397 4 24.59344508381286 33.500125093820365 19.664748561421067 22.241681260945708 5 22.40300375469337 36.37046307884856 22.177722152690862 19.048811013767207 6 17.502507522567704 38.841524573721166 22.191574724172515 21.464393179538614 7 17.109884596086303 15.253386853988962 43.67787255393878 23.95885599598595 8 21.353383458646615 21.203007518796994 25.764411027568922 31.67919799498747 9 21.715145436308926 22.993981945837515 27.708124373119357 27.5827482447342 10-14 22.704273332999346 28.06472621612144 25.634988227042733 23.596012223836482 15-19 23.529116969028767 26.99208178811266 26.806655307206572 22.672145935652 20-24 23.79783610498898 26.858345021037866 27.05369665397716 22.290122219995993 25-29 23.30315610463662 27.00945330865803 27.139498824588603 22.54789176211674 30-34 23.315 26.875 27.165 22.645 35-39 23.385 26.96 27.089999999999996 22.564999999999998 40-44 23.375 27.500000000000004 26.695 22.43 45-49 23.131939581874562 26.482944883465038 27.773331999599883 22.611783535060518 50-54 23.39 26.974999999999998 27.32 22.314999999999998 55-59 23.474999999999998 26.38 27.27 22.875 60-64 23.275000000000002 27.215 27.46 22.05 65-69 23.18 26.979999999999997 27.075 22.765 70-74 23.355 26.915 27.46 22.27 75-79 23.25 26.905 27.57 22.275 80-84 23.3 27.485 27.265 21.95 85-89 23.265 27.345000000000002 27.405 21.985 90-94 23.724999999999998 26.840000000000003 27.52 21.915000000000003 95-99 23.695 26.91 27.694999999999997 21.7 100-104 23.445 27.185 27.11 22.259999999999998 105-109 23.46 27.384999999999998 27.16 21.995 110-114 23.845 27.189999999999998 27.185 21.78 115-119 24.060000000000002 26.855 27.200000000000003 21.884999999999998 120-124 24.03 27.735 26.87 21.365000000000002 125-129 24.04 27.205000000000002 27.435 21.32 130-134 24.745 26.985 26.855 21.415 135-139 24.349999999999998 27.62 26.924999999999997 21.105 140-144 25.615 27.060000000000002 26.775 20.549999999999997 145-149 25.985000000000003 26.985 26.63 20.4 150-151 25.55 26.637499999999996 26.325 21.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.5 24 2.0 25 0.5 26 1.0 27 1.5 28 4.5 29 7.5 30 11.0 31 15.5 32 26.0 33 29.5 34 31.5 35 59.5 36 86.5 37 94.0 38 119.0 39 143.0 40 160.5 41 188.5 42 213.0 43 237.5 44 239.0 45 233.0 46 236.0 47 230.0 48 206.5 49 182.0 50 168.0 51 140.0 52 125.0 53 126.5 54 111.5 55 97.5 56 86.0 57 75.5 58 64.5 59 49.0 60 39.5 61 34.0 62 25.0 63 24.0 64 24.0 65 13.0 66 6.5 67 7.0 68 5.5 69 4.0 70 3.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.05 4 0.075 5 0.125 6 0.3 7 0.35000000000000003 8 0.25 9 0.3 10-14 0.19499999999999998 15-19 0.22999999999999998 20-24 0.18 25-29 0.034999999999999996 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62560447951132 96.875 2 1.1198778315092899 2.1999999999999997 3 0.15271061338763045 0.44999999999999996 4 0.050903537795876815 0.2 5 0.025451768897938407 0.125 6 0.025451768897938407 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 6 0.15 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 3.075 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.8375000000000004 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.6625 0.0 0.0 0.0 0.0 132-133 5.137499999999999 0.0 0.0 0.0 0.0 134-135 5.6875 0.0 0.0 0.0 0.0 136-137 6.074999999999999 0.0 0.0 0.0 0.0 138-139 6.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAGGT 10 0.006830828 145.0 3 AAGGTGC 10 0.006830828 145.0 5 AAAAATG 10 0.006830828 145.0 9 CCCCCCC 40 0.0076550315 18.125 105-109 >>END_MODULE Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684576 spots for SRR7172122.sra Written 684576 spots for SRR7172122.sra Read 684581 spots for SRR7172122.sra Written 684581 spots for SRR7172122.sra SRR ids: ['SRR7172122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aucytphc SRR7172122.sra spots: 13691525 blocks: [[1, 684576], [684577, 1369152], [1369153, 2053728], [2053729, 2738304], [2738305, 3422880], [3422881, 4107456], [4107457, 4792032], [4792033, 5476608], [5476609, 6161184], [6161185, 6845760], [6845761, 7530336], [7530337, 8214912], [8214913, 8899488], [8899489, 9584064], [9584065, 10268640], [10268641, 10953216], [10953217, 11637792], [11637793, 12322368], [12322369, 13006944], [13006945, 13691525]] SRR7172122 file size 4617908 SRR7172122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172122 SRR7172122_1.fastq SRR7172122_2.fastq Input file: SRR7172122_1.fastq Paired file: SRR7172122_2.fastq trimmed: SRR7172122-trimmed-pair1.fastq, SRR7172122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:21:46 2025 >> started Fri Feb 14 06:22:01 2025 >> done (15.300s) 13691525 read pairs processed; of these: 9025 ( 0.07%) short read pairs filtered out after trimming by size control 6169 ( 0.05%) empty read pairs filtered out after trimming by size control 13676331 (99.89%) read pairs available; of these: 7403737 (54.14%) trimmed read pairs available after processing 6272594 (45.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 4 0.00% 22 8 0.00% 23 5 0.00% 24 2 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 2 0.00% 29 6 0.00% 30 4 0.00% 31 4 0.00% 32 5 0.00% 33 6 0.00% 34 7 0.00% 35 3 0.00% 36 7 0.00% 37 6 0.00% 38 8 0.00% 39 4 0.00% 40 7 0.00% 41 5 0.00% 42 5 0.00% 43 6 0.00% 44 8 0.00% 45 8 0.00% 46 9 0.00% 47 13 0.00% 48 15 0.00% 49 16 0.00% 50 15 0.00% 51 27 0.00% 52 21 0.00% 53 27 0.00% 54 36 0.00% 55 34 0.00% 56 29 0.00% 57 46 0.00% 58 32 0.00% 59 44 0.00% 60 70 0.00% 61 81 0.00% 62 78 0.00% 63 105 0.00% 64 101 0.00% 65 109 0.00% 66 127 0.00% 67 164 0.00% 68 169 0.00% 69 196 0.00% 70 220 0.00% 71 254 0.00% 72 328 0.00% 73 388 0.00% 74 437 0.00% 75 560 0.00% 76 610 0.00% 77 762 0.01% 78 699 0.01% 79 908 0.01% 80 1083 0.01% 81 1149 0.01% 82 1336 0.01% 83 1569 0.01% 84 2405 0.02% 85 2843 0.02% 86 3262 0.02% 87 3519 0.03% 88 3662 0.03% 89 3995 0.03% 90 4285 0.03% 91 4480 0.03% 92 4824 0.04% 93 5206 0.04% 94 5433 0.04% 95 6186 0.05% 96 6894 0.05% 97 7029 0.05% 98 7776 0.06% 99 8263 0.06% 100 9077 0.07% 101 9663 0.07% 102 10520 0.08% 103 11298 0.08% 104 12169 0.09% 105 12912 0.09% 106 13852 0.10% 107 14684 0.11% 108 15538 0.11% 109 16189 0.12% 110 17106 0.13% 111 17874 0.13% 112 18839 0.14% 113 20333 0.15% 114 20943 0.15% 115 22631 0.17% 116 23642 0.17% 117 24752 0.18% 118 26319 0.19% 119 26873 0.20% 120 28113 0.21% 121 29774 0.22% 122 30746 0.22% 123 32203 0.24% 124 33778 0.25% 125 35553 0.26% 126 37293 0.27% 127 38780 0.28% 128 40455 0.30% 129 42341 0.31% 130 44733 0.33% 131 46874 0.34% 132 49397 0.36% 133 52097 0.38% 134 55021 0.40% 135 59435 0.43% 136 64565 0.47% 137 66349 0.49% 138 70507 0.52% 139 77228 0.56% 140 82656 0.60% 141 86996 0.64% 142 96934 0.71% 143 107627 0.79% 144 122983 0.90% 145 144132 1.05% 146 178761 1.31% 147 241636 1.77% 148 367542 2.69% 149 727950 5.32% 150 3874001 28.33% 151 6272594 45.86% 13676331 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.45 fanout-score-rank=18 prefix-density=0.28 prefix-fanout=3.3 sequence=TCCACACTTGCAGCCATTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=51.44 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=14.0 sequence=TCTCCTTCAATCACTTTGAAGGTGGTTGACAGCTTCTCATCGTCTATAGCTTCAATAACCTCCTTGGCAGTCTTAGCAACCCCATCATGTACATAACTCCAGCAGATTACAGTGCCCGGCTTCCCCCATTCACCTTCATGCAGATCAACATTCTGTATCTTGGCAGGGCTCATATTGGAAACGTGGTGTGGTCTGCAGCTGAAGATATCATGAAATGTTTCAGCAGAAACTTTGATCTCTACTTCAGCCTCCATCTTACCAAAGAGTGTCATTTTGTTGCGCAGGTAATCAAACTATAAACAGTGTAAGCTTTGAGATA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=31 prefix-density=0.38 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAATGGCTGCAAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=218.34 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.5 sequence=CTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTT SRR7172122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:23:19 Started mapping on | Feb 14 06:23:19 Finished on | Feb 14 06:32:30 Mapping speed, Million of reads per hour | 89.36 Number of input reads | 13676331 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9246246 Uniquely mapped reads % | 67.61% Average mapped length | 294.36 Number of splices: Total | 8142044 Number of splices: Annotated (sjdb) | 7955705 Number of splices: GT/AG | 8004279 Number of splices: GC/AG | 104897 Number of splices: AT/AC | 6758 Number of splices: Non-canonical | 26110 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.30 Insertion rate per base | 0.03% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306355 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 115354 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 28.96% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4130789 4130789 4130789 N_multimapping 306355 306355 306355 N_noFeature 289423 9151449 331603 N_ambiguous 114141 598 61189 UnstrandedReadsAssigned:8842682 PositiveStrandReadsAssigned:94199 NegativeStrandReadsAssigned:8853454 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172122-trimmed-pair1.fastq SRR7172122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,676,331 reads, 8,900,377 reads pseudoaligned [quant] estimated average fragment length: 237.352 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR7172122.ke.tsv 34699 SRR7172122.se.tsv 87100 total ==> SRR7172122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.65 1484 89.0833 Potri.005G024800.1.v4.1 1035 798.648 664 88.9195 Potri.004G059700.1.v4.1 961 724.667 0 0 Potri.007G009000.2.v4.1 1416 1179.65 0 0 Potri.003G141000.2.v4.1 2943 2706.65 262.471 10.3713 Potri.016G087400.1.v4.1 270 80.5999 253 335.715 Potri.015G069301.1.v4.1 564 331.119 0 0 Potri.010G195200.1.v4.1 1773 1536.65 744 51.7825 Potri.012G127500.1.v4.1 977 740.667 19420 2804.21 ==> SRR7172122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 422 SRR7172122 completed mapping pipeline successfully