Starting /dee2/code/volunteer_pipeline.sh SRR7172123 current disk space = 3085466824704 free memory = 1480422192 SRR7172123 SRAfilesize 98ab18307d905f59ec444aad84e749a3 SRR7172123.sra SRR7172123.sra file validated SRR7172123 is paired end SRR7172123 is conventional basespace SRR7172123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8825 33.0 33.0 34.0 32.0 34.0 2 33.17725 34.0 33.0 34.0 32.0 34.0 3 32.52575 33.0 33.0 34.0 31.0 34.0 4 33.1725 34.0 33.0 34.0 32.0 34.0 5 33.29325 34.0 33.0 34.0 33.0 34.0 6 37.22725 38.0 38.0 38.0 36.0 38.0 7 37.49325 38.0 38.0 38.0 37.0 38.0 8 37.60775 38.0 38.0 38.0 38.0 38.0 9 37.584 38.0 38.0 38.0 38.0 38.0 10-14 37.383900000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.5558 38.0 38.0 38.0 38.0 38.0 20-24 37.5073 38.0 38.0 38.0 37.6 38.0 25-29 37.41005 38.0 38.0 38.0 37.4 38.0 30-34 37.446749999999994 38.0 38.0 38.0 37.4 38.0 35-39 37.371 38.0 38.0 38.0 37.0 38.0 40-44 37.33475 38.0 38.0 38.0 37.0 38.0 45-49 37.04105 38.0 38.0 38.0 36.0 38.0 50-54 37.2677 38.0 38.0 38.0 36.8 38.0 55-59 37.383 38.0 38.0 38.0 37.0 38.0 60-64 37.31155 38.0 38.0 38.0 37.0 38.0 65-69 37.2933 38.0 38.0 38.0 37.0 38.0 70-74 37.21045 38.0 38.0 38.0 36.8 38.0 75-79 37.111450000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.12585 38.0 38.0 38.0 36.2 38.0 85-89 36.89215 38.0 38.0 38.0 35.6 38.0 90-94 36.86280000000001 38.0 38.0 38.0 35.2 38.0 95-99 36.86615 38.0 38.0 38.0 35.2 38.0 100-104 36.77499999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.6098 38.0 38.0 38.0 34.2 38.0 110-114 36.431850000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.2545 38.0 37.8 38.0 34.0 38.0 120-124 36.26345 38.0 38.0 38.0 34.0 38.0 125-129 35.91635 38.0 37.0 38.0 33.0 38.0 130-134 35.68305 38.0 36.6 38.0 31.4 38.0 135-139 35.38175 38.0 36.0 38.0 31.0 38.0 140-144 34.9178 38.0 35.8 38.0 29.4 38.0 145-149 34.173300000000005 38.0 35.6 38.0 26.4 38.0 150-151 29.049875 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 2.0 19 1.0 20 4.0 21 0.0 22 6.0 23 6.0 24 9.0 25 8.0 26 15.0 27 19.0 28 13.0 29 28.0 30 37.0 31 53.0 32 63.0 33 105.0 34 139.0 35 218.0 36 590.0 37 2679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.475 15.8 16.875 37.85 2 18.8 23.225 39.7 18.275 3 17.525 31.125000000000004 26.75 24.6 4 19.85 38.175 21.625 20.349999999999998 5 20.775 36.625 23.7 18.9 6 16.400000000000002 37.25 26.174999999999997 20.175 7 12.45 21.25 46.1 20.200000000000003 8 17.424999999999997 21.3 29.45 31.825 9 17.424999999999997 21.575 32.4 28.599999999999998 10-14 18.833743162543282 31.19385758016761 26.461584784463295 23.510814472825814 15-19 19.255 29.409999999999997 28.005000000000003 23.330000000000002 20-24 18.805 29.265 28.03 23.9 25-29 19.25 29.37 28.01 23.369999999999997 30-34 19.335 28.92 28.084999999999997 23.66 35-39 19.17 29.4 28.060000000000002 23.369999999999997 40-44 19.89 29.365000000000002 27.810000000000002 22.935 45-49 19.41 29.505 27.76 23.325000000000003 50-54 19.950000000000003 29.14 27.72 23.189999999999998 55-59 19.79 29.39 27.72 23.1 60-64 19.285 29.34 27.855 23.52 65-69 20.27 28.194999999999997 27.705000000000002 23.830000000000002 70-74 19.515 28.375 28.315 23.794999999999998 75-79 20.025000000000002 29.165000000000003 27.04 23.77 80-84 19.77 28.785 27.73 23.715 85-89 20.015 28.48 28.050000000000004 23.455000000000002 90-94 19.935 29.044999999999998 27.845 23.175 95-99 20.560000000000002 28.42 27.400000000000002 23.62 100-104 20.305 28.754999999999995 27.405 23.535 105-109 20.34508627156789 29.57739434858715 26.926731682920728 23.15078769692423 110-114 20.768115217282592 29.02935440316047 27.16407461119168 23.038455768365253 115-119 20.331016550827542 28.756437821891094 27.52637631881594 23.386169308465423 120-124 20.810202550637662 28.392098024506122 27.67691922980745 23.120780195048763 125-129 20.911729383506806 28.793034427542036 27.00160128102482 23.293634907926343 130-134 20.51 28.99 26.96 23.54 135-139 20.86 28.499999999999996 27.38 23.26 140-144 21.154999999999998 28.18 26.834999999999997 23.830000000000002 145-149 20.885 28.77 26.884999999999998 23.46 150-151 20.599999999999998 28.3125 26.700000000000003 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.5 17 1.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 3.5 25 4.5 26 5.5 27 8.5 28 16.5 29 22.5 30 29.0 31 40.0 32 51.0 33 66.5 34 82.5 35 101.5 36 119.5 37 141.5 38 161.5 39 175.5 40 206.0 41 235.0 42 241.5 43 244.5 44 245.0 45 250.0 46 249.0 47 215.0 48 197.5 49 178.0 50 139.5 51 120.0 52 95.0 53 77.5 54 64.0 55 44.0 56 32.5 57 28.5 58 25.5 59 15.5 60 11.0 61 13.5 62 11.5 63 7.5 64 4.5 65 1.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.365 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.015 115-119 0.005 120-124 0.025 125-129 0.08 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.475 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.2249999999999996 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.425 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.75 0.0 0.0 0.0 0.0 134-135 6.300000000000001 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTACA 10 0.0065874006 146.74684 7 >>END_MODULE SRR7172123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93825 33.0 33.0 34.0 32.0 34.0 2 32.993 34.0 33.0 34.0 32.0 34.0 3 33.1095 34.0 33.0 34.0 33.0 34.0 4 33.05425 34.0 33.0 34.0 33.0 34.0 5 33.135 34.0 33.0 34.0 33.0 34.0 6 37.32925 38.0 38.0 38.0 37.0 38.0 7 37.26675 38.0 38.0 38.0 37.0 38.0 8 37.301 38.0 38.0 38.0 37.0 38.0 9 37.24425 38.0 38.0 38.0 37.0 38.0 10-14 37.27225 38.0 38.0 38.0 37.0 38.0 15-19 37.2842 38.0 38.0 38.0 37.0 38.0 20-24 37.14970000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.11305 38.0 38.0 38.0 37.0 38.0 30-34 37.141 38.0 38.0 38.0 37.0 38.0 35-39 37.0471 38.0 38.0 38.0 36.8 38.0 40-44 37.00565 38.0 38.0 38.0 36.8 38.0 45-49 37.06945 38.0 38.0 38.0 37.0 38.0 50-54 37.067249999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.081399999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.052299999999995 38.0 38.0 38.0 36.8 38.0 65-69 36.969649999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.929899999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.89015 38.0 38.0 38.0 36.0 38.0 80-84 36.8052 38.0 38.0 38.0 36.0 38.0 85-89 36.70285 38.0 38.0 38.0 35.6 38.0 90-94 36.5333 38.0 38.0 38.0 34.6 38.0 95-99 36.290749999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.247749999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.21875 38.0 38.0 38.0 34.0 38.0 110-114 36.0972 38.0 38.0 38.0 33.8 38.0 115-119 35.93175 38.0 37.8 38.0 33.6 38.0 120-124 35.822050000000004 38.0 37.6 38.0 33.0 38.0 125-129 35.6407 38.0 37.0 38.0 31.8 38.0 130-134 35.22710000000001 38.0 36.6 38.0 31.0 38.0 135-139 34.9012 38.0 36.0 38.0 29.4 38.0 140-144 34.23715 38.0 35.0 38.0 25.6 38.0 145-149 33.6252 38.0 35.0 38.0 20.8 38.0 150-151 28.56075 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 3.0 5 1.0 6 2.0 7 2.0 8 0.0 9 1.0 10 0.0 11 3.0 12 1.0 13 1.0 14 1.0 15 1.0 16 5.0 17 7.0 18 4.0 19 7.0 20 2.0 21 8.0 22 10.0 23 8.0 24 10.0 25 16.0 26 11.0 27 24.0 28 28.0 29 29.0 30 41.0 31 58.0 32 66.0 33 82.0 34 118.0 35 240.0 36 548.0 37 2654.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.10057543157368 12.83462596947711 19.5896922692019 33.47510632974731 2 23.040320560981716 21.337340345604808 37.766090658652644 17.856248434760833 3 21.888304532932633 25.018782870022537 31.580265464562984 21.512647132481845 4 24.417731029301276 33.433508640120216 21.487603305785125 20.66115702479339 5 25.15644555694618 36.72090112640801 21.60200250312891 16.520650813516895 6 18.554638659664917 37.484371092773195 24.5311327831958 19.42985746436609 7 17.825 15.275 45.675 21.224999999999998 8 22.025 20.875 27.525 29.575000000000003 9 22.25 22.825 28.625 26.3 10-14 23.53117655882794 28.73143657182859 26.72633631681584 21.011050552527628 15-19 23.685000000000002 28.21 28.075 20.03 20-24 22.875 28.389999999999997 27.87 20.865000000000002 25-29 23.195 28.37 27.705000000000002 20.73 30-34 22.905 27.715 28.425 20.955 35-39 23.78 28.265 27.800000000000004 20.155 40-44 23.01 28.34 27.994999999999997 20.655 45-49 23.294999999999998 28.084999999999997 27.99 20.630000000000003 50-54 23.66 27.994999999999997 27.965 20.380000000000003 55-59 23.875 28.115000000000002 27.534999999999997 20.474999999999998 60-64 23.01 27.855 28.705000000000002 20.43 65-69 23.47 27.555000000000003 28.475 20.5 70-74 22.830000000000002 28.055000000000003 28.470000000000002 20.645 75-79 23.665 28.15 28.075 20.11 80-84 23.169999999999998 27.405 28.854999999999997 20.57 85-89 23.73 27.634999999999998 28.084999999999997 20.549999999999997 90-94 23.84 28.04 27.939999999999998 20.18 95-99 23.505000000000003 28.28 28.065 20.150000000000002 100-104 23.635 28.194999999999997 28.255000000000003 19.915 105-109 23.05 27.400000000000002 29.475 20.075000000000003 110-114 23.405 27.37 28.860000000000003 20.365 115-119 23.95 27.27 28.87 19.91 120-124 23.755000000000003 27.79 28.28 20.175 125-129 24.15 27.855 28.185 19.81 130-134 24.41 28.125 27.889999999999997 19.575 135-139 24.54 28.04 27.694999999999997 19.725 140-144 25.525 27.63 27.534999999999997 19.31 145-149 25.085 28.265 27.715 18.935 150-151 24.625 28.3625 27.6125 19.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 2.0 25 2.5 26 3.5 27 4.0 28 5.0 29 8.0 30 12.0 31 14.0 32 21.0 33 35.5 34 54.5 35 72.0 36 87.5 37 124.5 38 147.0 39 164.0 40 192.0 41 210.0 42 258.5 43 299.0 44 302.0 45 286.5 46 256.0 47 249.5 48 235.5 49 195.0 50 154.5 51 128.0 52 111.0 53 86.5 54 63.5 55 49.0 56 40.0 57 27.0 58 21.0 59 16.5 60 11.0 61 9.0 62 6.0 63 5.0 64 3.0 65 3.0 66 3.5 67 3.0 68 4.5 69 2.5 70 2.5 71 2.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.125 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.525 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.4625 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATCC 10 0.006830828 145.0 7 AAAATGC 10 0.006830828 145.0 8 >>END_MODULE Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771939 spots for SRR7172123.sra Written 771939 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra Read 771921 spots for SRR7172123.sra Written 771921 spots for SRR7172123.sra SRR ids: ['SRR7172123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j2_x89zq SRR7172123.sra spots: 15438438 blocks: [[1, 771921], [771922, 1543842], [1543843, 2315763], [2315764, 3087684], [3087685, 3859605], [3859606, 4631526], [4631527, 5403447], [5403448, 6175368], [6175369, 6947289], [6947290, 7719210], [7719211, 8491131], [8491132, 9263052], [9263053, 10034973], [10034974, 10806894], [10806895, 11578815], [11578816, 12350736], [12350737, 13122657], [13122658, 13894578], [13894579, 14666499], [14666500, 15438438]] SRR7172123 file size 5209879 SRR7172123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172123 SRR7172123_1.fastq SRR7172123_2.fastq Input file: SRR7172123_1.fastq Paired file: SRR7172123_2.fastq trimmed: SRR7172123-trimmed-pair1.fastq, SRR7172123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:17:20 2025 >> started Fri Feb 14 06:17:36 2025 >> done (16.512s) 15438438 read pairs processed; of these: 10875 ( 0.07%) short read pairs filtered out after trimming by size control 8657 ( 0.06%) empty read pairs filtered out after trimming by size control 15418906 (99.87%) read pairs available; of these: 7770292 (50.39%) trimmed read pairs available after processing 7648614 (49.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 7 0.00% 22 9 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 5 0.00% 27 8 0.00% 28 11 0.00% 29 9 0.00% 30 4 0.00% 31 6 0.00% 32 7 0.00% 33 6 0.00% 34 3 0.00% 35 9 0.00% 36 5 0.00% 37 7 0.00% 38 7 0.00% 39 9 0.00% 40 10 0.00% 41 9 0.00% 42 8 0.00% 43 10 0.00% 44 16 0.00% 45 11 0.00% 46 11 0.00% 47 14 0.00% 48 23 0.00% 49 22 0.00% 50 31 0.00% 51 34 0.00% 52 27 0.00% 53 47 0.00% 54 36 0.00% 55 37 0.00% 56 52 0.00% 57 67 0.00% 58 90 0.00% 59 98 0.00% 60 86 0.00% 61 115 0.00% 62 143 0.00% 63 169 0.00% 64 168 0.00% 65 174 0.00% 66 225 0.00% 67 244 0.00% 68 267 0.00% 69 322 0.00% 70 362 0.00% 71 421 0.00% 72 471 0.00% 73 554 0.00% 74 672 0.00% 75 745 0.00% 76 903 0.01% 77 1013 0.01% 78 1227 0.01% 79 1397 0.01% 80 1468 0.01% 81 1687 0.01% 82 2009 0.01% 83 2383 0.02% 84 3395 0.02% 85 4002 0.03% 86 4415 0.03% 87 4994 0.03% 88 5318 0.03% 89 5629 0.04% 90 5676 0.04% 91 6285 0.04% 92 6675 0.04% 93 7207 0.05% 94 7763 0.05% 95 8489 0.06% 96 9228 0.06% 97 10004 0.06% 98 10858 0.07% 99 11694 0.08% 100 13210 0.09% 101 13279 0.09% 102 13888 0.09% 103 15116 0.10% 104 15775 0.10% 105 17123 0.11% 106 18230 0.12% 107 19026 0.12% 108 20232 0.13% 109 21194 0.14% 110 22546 0.15% 111 23345 0.15% 112 24330 0.16% 113 25514 0.17% 114 26776 0.17% 115 28324 0.18% 116 29667 0.19% 117 30988 0.20% 118 32086 0.21% 119 33917 0.22% 120 35102 0.23% 121 36562 0.24% 122 37134 0.24% 123 39449 0.26% 124 40635 0.26% 125 42231 0.27% 126 43916 0.28% 127 45756 0.30% 128 47675 0.31% 129 49941 0.32% 130 51566 0.33% 131 53245 0.35% 132 56034 0.36% 133 58584 0.38% 134 61520 0.40% 135 64813 0.42% 136 68510 0.44% 137 71907 0.47% 138 77356 0.50% 139 83468 0.54% 140 92155 0.60% 141 95698 0.62% 142 104202 0.68% 143 116794 0.76% 144 132233 0.86% 145 155616 1.01% 146 189064 1.23% 147 251338 1.63% 148 375196 2.43% 149 734099 4.76% 150 3884283 25.19% 151 7648614 49.61% 15418906 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=25 prefix-density=0.84 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=33.91 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.1 sequence=CCTTCCTTGTCCTGGATCTTGGCCTT criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=25 prefix-density=0.79 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=71.51 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.8 sequence=TTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAAGCCCACCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGATC SRR7172123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:18:27 Started mapping on | Feb 14 06:18:27 Finished on | Feb 14 06:21:22 Mapping speed, Million of reads per hour | 317.19 Number of input reads | 15418906 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13836058 Uniquely mapped reads % | 89.73% Average mapped length | 293.48 Number of splices: Total | 12107163 Number of splices: Annotated (sjdb) | 11805038 Number of splices: GT/AG | 11890019 Number of splices: GC/AG | 157555 Number of splices: AT/AC | 11671 Number of splices: Non-canonical | 47918 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.05% Deletion average length | 2.28 Insertion rate per base | 0.03% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468666 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 96978 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.35% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1127075 1127075 1127075 N_multimapping 468666 468666 468666 N_noFeature 467128 13680421 529740 N_ambiguous 176058 918 82619 UnstrandedReadsAssigned:13192872 PositiveStrandReadsAssigned:154719 NegativeStrandReadsAssigned:13223699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172123-trimmed-pair1.fastq SRR7172123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,418,906 reads, 13,125,365 reads pseudoaligned [quant] estimated average fragment length: 229.048 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52401 SRR7172123.ke.tsv 34699 SRR7172123.se.tsv 87100 total ==> SRR7172123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.95 2715 101.001 Potri.005G024800.1.v4.1 1035 806.952 432 35.6478 Potri.004G059700.1.v4.1 961 732.957 38 3.45225 Potri.007G009000.2.v4.1 1416 1187.95 0 0 Potri.003G141000.2.v4.1 2943 2714.95 441.243 10.8221 Potri.016G087400.1.v4.1 270 82.9182 642 515.563 Potri.015G069301.1.v4.1 564 338.36 0 0 Potri.010G195200.1.v4.1 1773 1544.95 701.768 30.2465 Potri.012G127500.1.v4.1 977 748.957 14110 1254.49 ==> SRR7172123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 779 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 354 Potri.001G452600.v4.1 683 SRR7172123 completed mapping pipeline successfully