Starting /dee2/code/volunteer_pipeline.sh SRR7172124 current disk space = 3084954976256 free memory = 1579951008 SRR7172124 SRAfilesize 8e6be6d5e515aaf5b6f8878022129129 SRR7172124.sra SRR7172124.sra file validated SRR7172124 is paired end SRR7172124 is conventional basespace SRR7172124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.887 32.0 18.0 33.0 18.0 34.0 2 30.4 31.0 29.0 33.0 25.0 34.0 3 32.03225 33.0 31.0 33.0 29.0 34.0 4 32.79775 33.0 33.0 34.0 31.0 34.0 5 33.0425 33.0 33.0 34.0 33.0 34.0 6 37.099 38.0 37.0 38.0 36.0 38.0 7 37.54475 38.0 38.0 38.0 37.0 38.0 8 37.51475 38.0 38.0 38.0 38.0 38.0 9 37.585 38.0 38.0 38.0 38.0 38.0 10-14 37.509249999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.5667 38.0 38.0 38.0 38.0 38.0 20-24 37.52795 38.0 38.0 38.0 37.8 38.0 25-29 37.424600000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.48405 38.0 38.0 38.0 37.8 38.0 35-39 37.324 38.0 38.0 38.0 37.2 38.0 40-44 37.237199999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.3237 38.0 38.0 38.0 37.0 38.0 50-54 37.3291 38.0 38.0 38.0 37.0 38.0 55-59 37.369150000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.321149999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.2583 38.0 38.0 38.0 37.0 38.0 70-74 37.2154 38.0 38.0 38.0 36.6 38.0 75-79 37.1718 38.0 38.0 38.0 36.2 38.0 80-84 37.06035 38.0 38.0 38.0 36.0 38.0 85-89 36.8968 38.0 38.0 38.0 35.8 38.0 90-94 36.86605 38.0 38.0 38.0 35.4 38.0 95-99 36.76475000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.6566 38.0 38.0 38.0 34.4 38.0 105-109 36.633300000000006 38.0 38.0 38.0 34.8 38.0 110-114 36.1673 38.0 38.0 38.0 34.0 38.0 115-119 35.71305 38.0 36.8 38.0 30.8 38.0 120-124 36.17345 38.0 37.6 38.0 33.4 38.0 125-129 35.829800000000006 38.0 37.0 38.0 32.4 38.0 130-134 35.67764999999999 38.0 36.6 38.0 31.0 38.0 135-139 35.443599999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.91915 38.0 36.0 38.0 29.4 38.0 145-149 34.3735 38.0 35.6 38.0 27.8 38.0 150-151 30.019625 35.5 27.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 0.0 19 1.0 20 5.0 21 2.0 22 5.0 23 6.0 24 14.0 25 9.0 26 8.0 27 14.0 28 22.0 29 26.0 30 38.0 31 44.0 32 52.0 33 99.0 34 144.0 35 279.0 36 610.0 37 2612.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.050000000000004 18.55 14.224999999999998 39.175 2 19.650000000000002 24.6 36.325 19.425 3 17.575 31.424999999999997 25.825 25.174999999999997 4 19.725 37.1 21.4 21.775 5 19.6 37.724999999999994 23.674999999999997 19.0 6 15.725 36.825 26.625 20.825 7 12.775 19.625 45.65 21.95 8 16.875 20.849999999999998 29.125 33.15 9 18.0 22.975 31.825 27.200000000000003 10-14 19.38213498898458 29.541357901061488 26.617264169837775 24.459242940116162 15-19 19.935 28.884999999999998 27.445000000000004 23.735 20-24 19.595000000000002 28.74 28.29 23.375 25-29 19.43694369436944 28.312831283128315 28.497849784978495 23.75237523752375 30-34 19.60098004900245 29.42647132356618 27.10635531776589 23.866193309665483 35-39 19.874968742185548 28.86721680420105 27.591897974493623 23.66591647911978 40-44 20.02500625156289 28.422105526381596 27.85696424106027 23.695923980995246 45-49 19.58195819581958 28.79287928792879 28.08780878087809 23.537353735373536 50-54 20.015 28.794999999999998 28.08 23.11 55-59 20.415 28.389999999999997 27.57 23.625 60-64 20.04 28.299999999999997 27.93 23.73 65-69 20.599999999999998 28.835 27.529999999999998 23.035 70-74 20.62 28.549999999999997 27.49 23.34 75-79 20.32 28.24 27.735 23.705000000000002 80-84 20.5330799619943 28.369255388308247 27.754163124468672 23.343501525228785 85-89 20.02401080486219 28.432794757640938 27.67745485468461 23.865739582812264 90-94 19.61686590306607 28.28990146551293 28.484969739408793 23.608262892012206 95-99 20.165 27.85 27.889999999999997 24.095 100-104 20.396118835650697 28.7186155846754 27.603280984295285 23.281984595378614 105-109 20.64 28.26 27.889999999999997 23.21 110-114 20.85784683461558 28.053502287926786 27.957962488057525 23.130688389400113 115-119 20.855266456108687 28.224795708627866 27.23717852308618 23.68275931217727 120-124 21.224244848969796 27.215443088617725 28.11562312462493 23.444688937787557 125-129 20.5337472461446 28.174444221910676 27.678750250350493 23.61305828159423 130-134 21.12105605280264 28.34141707085354 27.27136356817841 23.266163308165407 135-139 21.15 28.24 27.025 23.585 140-144 21.102385835042263 28.600010003501225 26.934427049467313 23.3631771119892 145-149 21.21166641652909 28.43063685026765 26.80974535994797 23.54795137325529 150-151 21.475 28.012500000000003 26.875 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 2.0 22 2.0 23 2.0 24 2.5 25 3.0 26 5.0 27 7.5 28 15.0 29 23.0 30 25.5 31 26.5 32 33.0 33 45.5 34 63.0 35 81.0 36 94.0 37 113.5 38 145.0 39 180.5 40 211.5 41 232.5 42 255.5 43 271.5 44 276.5 45 277.5 46 252.5 47 225.5 48 198.0 49 166.5 50 143.5 51 129.0 52 112.5 53 86.0 54 64.0 55 49.5 56 40.5 57 31.0 58 27.5 59 22.0 60 14.0 61 10.5 62 7.5 63 4.5 64 5.5 65 4.5 66 1.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.13999999999999999 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.005 35-39 0.025 40-44 0.025 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.015 85-89 0.045 90-94 0.034999999999999996 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.565 115-119 0.265 120-124 0.02 125-129 0.13999999999999999 130-134 0.005 135-139 0.0 140-144 0.034999999999999996 145-149 0.055 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.7317688619732526 1.4500000000000002 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.475 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTACT 10 0.0068768123 144.675 1 >>END_MODULE SRR7172124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.132 33.0 33.0 34.0 33.0 34.0 2 33.23075 34.0 33.0 34.0 33.0 34.0 3 33.24625 34.0 33.0 34.0 33.0 34.0 4 33.20275 34.0 33.0 34.0 33.0 34.0 5 33.17725 34.0 33.0 34.0 33.0 34.0 6 37.28575 38.0 38.0 38.0 37.0 38.0 7 37.3295 38.0 38.0 38.0 38.0 38.0 8 37.30525 38.0 38.0 38.0 38.0 38.0 9 37.34625 38.0 38.0 38.0 38.0 38.0 10-14 37.35725 38.0 38.0 38.0 37.8 38.0 15-19 37.308049999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.27475 38.0 38.0 38.0 37.0 38.0 25-29 37.274950000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.31295 38.0 38.0 38.0 37.0 38.0 35-39 37.2913 38.0 38.0 38.0 37.0 38.0 40-44 37.21365 38.0 38.0 38.0 37.0 38.0 45-49 37.2224 38.0 38.0 38.0 37.0 38.0 50-54 37.26375 38.0 38.0 38.0 37.0 38.0 55-59 37.248799999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.1751 38.0 38.0 38.0 37.0 38.0 65-69 37.16365 38.0 38.0 38.0 37.0 38.0 70-74 37.16505000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.03875 38.0 38.0 38.0 36.2 38.0 80-84 36.8941 38.0 38.0 38.0 36.0 38.0 85-89 36.771699999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.660250000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.64805 38.0 38.0 38.0 34.6 38.0 100-104 36.5931 38.0 38.0 38.0 34.6 38.0 105-109 36.51235 38.0 38.0 38.0 34.4 38.0 110-114 36.2214 38.0 38.0 38.0 34.0 38.0 115-119 36.097 38.0 38.0 38.0 33.6 38.0 120-124 35.88805 38.0 37.8 38.0 32.2 38.0 125-129 35.61275 38.0 37.0 38.0 31.0 38.0 130-134 35.200149999999994 38.0 36.2 38.0 29.8 38.0 135-139 34.8104 38.0 36.0 38.0 28.6 38.0 140-144 34.375 38.0 35.8 38.0 26.6 38.0 145-149 33.35435 38.0 33.2 38.0 18.8 38.0 150-151 27.818624999999997 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 3.0 11 1.0 12 1.0 13 0.0 14 3.0 15 2.0 16 4.0 17 3.0 18 3.0 19 6.0 20 6.0 21 4.0 22 10.0 23 8.0 24 12.0 25 10.0 26 11.0 27 22.0 28 26.0 29 27.0 30 32.0 31 50.0 32 79.0 33 96.0 34 129.0 35 243.0 36 557.0 37 2647.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.633408352088026 13.228307076769191 17.97949487371843 35.15878969742436 2 22.98649324662331 21.235617808904454 37.11855927963982 18.659329664832416 3 19.734867433716857 26.488244122061033 31.86593296648324 21.91095547773887 4 23.692769577182887 35.20140105078809 21.290968226169625 19.814861145859393 5 22.822822822822822 37.88788788788789 21.871871871871875 17.417417417417415 6 17.739914808318716 37.75995990979704 24.705587572037082 19.794537709847155 7 16.783743100852984 15.955845459106873 45.183140993477174 22.07727044656297 8 20.96693386773547 20.29058116232465 27.85571142284569 30.886773547094187 9 21.44825858180907 23.402655975945876 29.466299173139564 25.68278626910549 10-14 23.069604406609916 28.532799198798198 26.42463695543315 21.97295943915874 15-19 22.57401933770853 28.174941135213665 28.16993136616402 21.081108160913782 20-24 22.754580955241817 28.266746770802044 28.131571042355063 20.84710123160108 25-29 23.330832708177045 27.591897974493623 27.871967991997998 21.205301325331334 30-34 22.685 28.970000000000002 27.455000000000002 20.89 35-39 22.595000000000002 27.58 28.03 21.795 40-44 22.175 28.544999999999998 27.860000000000003 21.42 45-49 23.419683936787358 28.11562312462493 27.560512102420482 20.90418083616723 50-54 23.265 28.02 27.634999999999998 21.08 55-59 22.925 28.439999999999998 28.115000000000002 20.52 60-64 23.095 28.02 27.884999999999998 21.0 65-69 23.39 28.1 27.450000000000003 21.060000000000002 70-74 23.225 27.425 28.310000000000002 21.04 75-79 23.665 28.08 26.974999999999998 21.279999999999998 80-84 23.32 27.985 27.655 21.04 85-89 23.169999999999998 27.96 28.065 20.805 90-94 23.285 28.74 27.675 20.3 95-99 23.93 28.095 27.474999999999998 20.5 100-104 24.044999999999998 27.295 28.465 20.195 105-109 23.72 28.105000000000004 28.02 20.155 110-114 23.175 27.800000000000004 28.475 20.549999999999997 115-119 23.385 27.935 27.72 20.96 120-124 23.915 27.805000000000003 28.03 20.25 125-129 23.69 27.975 28.000000000000004 20.335 130-134 23.68 27.97 27.389999999999997 20.96 135-139 24.404999999999998 28.205000000000002 27.16 20.23 140-144 24.165 28.33 27.534999999999997 19.97 145-149 24.51 28.625 26.895000000000003 19.97 150-151 25.337500000000002 26.9625 27.900000000000002 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 1.0 26 1.0 27 3.5 28 6.5 29 7.5 30 8.5 31 12.5 32 22.5 33 31.0 34 37.5 35 59.5 36 88.0 37 124.5 38 160.5 39 182.5 40 206.0 41 229.5 42 252.5 43 270.0 44 274.0 45 284.0 46 269.5 47 260.0 48 243.5 49 188.0 50 148.0 51 127.5 52 104.0 53 78.0 54 67.0 55 57.0 56 44.5 57 30.5 58 22.0 59 18.0 60 16.0 61 16.5 62 12.0 63 5.0 64 5.5 65 5.5 66 3.5 67 3.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.05 4 0.075 5 0.1 6 0.22499999999999998 7 0.35000000000000003 8 0.2 9 0.22499999999999998 10-14 0.15 15-19 0.19499999999999998 20-24 0.13 25-29 0.025 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.807061790668348 1.6 3 0.0 0.0 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra Read 775199 spots for SRR7172124.sra Written 775199 spots for SRR7172124.sra SRR ids: ['SRR7172124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lo589lik SRR7172124.sra spots: 15503980 blocks: [[1, 775199], [775200, 1550398], [1550399, 2325597], [2325598, 3100796], [3100797, 3875995], [3875996, 4651194], [4651195, 5426393], [5426394, 6201592], [6201593, 6976791], [6976792, 7751990], [7751991, 8527189], [8527190, 9302388], [9302389, 10077587], [10077588, 10852786], [10852787, 11627985], [11627986, 12403184], [12403185, 13178383], [13178384, 13953582], [13953583, 14728781], [14728782, 15503980]] SRR7172124 file size 5232089 SRR7172124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172124 SRR7172124_1.fastq SRR7172124_2.fastq Input file: SRR7172124_1.fastq Paired file: SRR7172124_2.fastq trimmed: SRR7172124-trimmed-pair1.fastq, SRR7172124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:01:40 2025 >> started Fri Feb 14 07:01:57 2025 >> done (17.742s) 15503980 read pairs processed; of these: 7981 ( 0.05%) short read pairs filtered out after trimming by size control 6776 ( 0.04%) empty read pairs filtered out after trimming by size control 15489223 (99.90%) read pairs available; of these: 7945716 (51.30%) trimmed read pairs available after processing 7543507 (48.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 5 0.00% 25 2 0.00% 26 8 0.00% 27 3 0.00% 28 0 0.00% 29 5 0.00% 30 3 0.00% 31 4 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 4 0.00% 36 8 0.00% 37 4 0.00% 38 5 0.00% 39 4 0.00% 40 6 0.00% 41 4 0.00% 42 8 0.00% 43 15 0.00% 44 7 0.00% 45 10 0.00% 46 4 0.00% 47 8 0.00% 48 5 0.00% 49 14 0.00% 50 15 0.00% 51 18 0.00% 52 18 0.00% 53 19 0.00% 54 25 0.00% 55 18 0.00% 56 44 0.00% 57 43 0.00% 58 50 0.00% 59 49 0.00% 60 66 0.00% 61 67 0.00% 62 81 0.00% 63 101 0.00% 64 124 0.00% 65 119 0.00% 66 137 0.00% 67 143 0.00% 68 148 0.00% 69 187 0.00% 70 221 0.00% 71 241 0.00% 72 290 0.00% 73 306 0.00% 74 365 0.00% 75 405 0.00% 76 544 0.00% 77 596 0.00% 78 673 0.00% 79 736 0.00% 80 895 0.01% 81 942 0.01% 82 1147 0.01% 83 1380 0.01% 84 2024 0.01% 85 2452 0.02% 86 2724 0.02% 87 2767 0.02% 88 3018 0.02% 89 3127 0.02% 90 3507 0.02% 91 3827 0.02% 92 3970 0.03% 93 4313 0.03% 94 4562 0.03% 95 5007 0.03% 96 5430 0.04% 97 5900 0.04% 98 6260 0.04% 99 6658 0.04% 100 7458 0.05% 101 8109 0.05% 102 8643 0.06% 103 9038 0.06% 104 9831 0.06% 105 10598 0.07% 106 11334 0.07% 107 11479 0.07% 108 12365 0.08% 109 12922 0.08% 110 13731 0.09% 111 14336 0.09% 112 15237 0.10% 113 16252 0.10% 114 16921 0.11% 115 17756 0.11% 116 18679 0.12% 117 20040 0.13% 118 21210 0.14% 119 22046 0.14% 120 23080 0.15% 121 24201 0.16% 122 25542 0.16% 123 26602 0.17% 124 28303 0.18% 125 29488 0.19% 126 31235 0.20% 127 32590 0.21% 128 34859 0.23% 129 36215 0.23% 130 39063 0.25% 131 40859 0.26% 132 44192 0.29% 133 46931 0.30% 134 50268 0.32% 135 54702 0.35% 136 61046 0.39% 137 62987 0.41% 138 67590 0.44% 139 74106 0.48% 140 78910 0.51% 141 85338 0.55% 142 94860 0.61% 143 108437 0.70% 144 126952 0.82% 145 151146 0.98% 146 189746 1.23% 147 261858 1.69% 148 404094 2.61% 149 818391 5.28% 150 4438219 28.65% 151 7543507 48.70% 15489223 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=22 prefix-density=0.82 prefix-fanout=2.3 sequence=AAGGATCTCTCTCCTTTAACG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=79.05 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=15.6 sequence=GCAGCAGCAGCATGCACGCATATGATACTGACCGATCATTCATGCCTGTGCTGTTGGTAGCTGGGTAAGGTGATGATCCTCAATGTCTTTGCTGCAATGGATGCAAAACTCAAGCAACGTTTGAGGATCTGGAACGTTCTCATTTAGCTTCTCATATTCAAAAGTCCAGTGAGCCAAGCAGCTGCCCTCTCCTTTGGGAGTAGCTTGAACGATAATTATGAAATTCTTGTACTCCGTGGTGATGTCTCCTTCAATCACTTTGAAGGTGGTTGACAGCTTCTCATCGTCTATAGCTTCAATAACCTCCTTAGCAGTCTTAGCAACCCCATCATGTACATAACTCCAGCAGATTACAGTGCCCGGCTTCCCCCATTCACCTTCATGCAGATCAACATTCTGTATCTTGGCAGGGCTCATATTGGAAACGTGGTGTGGTCTGCAGCTGAAGATATCATGAAATGTTTCAGCAGAAACTTTGATCTCTACTTCAGCCTCCATCTTACCAAAGAGT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=0.62 prefix-fanout=2.0 sequence=CTCAGTTGTTCCTTTACAATGATGGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=143.71 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=16.5 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172124 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:02:44 Started mapping on | Feb 14 07:02:44 Finished on | Feb 14 07:05:06 Mapping speed, Million of reads per hour | 392.68 Number of input reads | 15489223 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14257355 Uniquely mapped reads % | 92.05% Average mapped length | 295.56 Number of splices: Total | 13816236 Number of splices: Annotated (sjdb) | 13583097 Number of splices: GT/AG | 13594277 Number of splices: GC/AG | 175971 Number of splices: AT/AC | 9546 Number of splices: Non-canonical | 36442 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428554 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 141102 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 812368 812368 812368 N_multimapping 428554 428554 428554 N_noFeature 366288 14131986 419633 N_ambiguous 150599 1343 77787 UnstrandedReadsAssigned:13740468 PositiveStrandReadsAssigned:124026 NegativeStrandReadsAssigned:13759935 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172124-trimmed-pair1.fastq SRR7172124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,489,223 reads, 13,750,478 reads pseudoaligned [quant] estimated average fragment length: 255.122 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7172124.ke.tsv 34699 SRR7172124.se.tsv 87100 total ==> SRR7172124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.88 930 37.6151 Potri.005G024800.1.v4.1 1035 780.878 100 9.13617 Potri.004G059700.1.v4.1 961 706.884 12 1.2111 Potri.007G009000.2.v4.1 1416 1161.88 0 0 Potri.003G141000.2.v4.1 2943 2688.88 451.279 11.9735 Potri.016G087400.1.v4.1 270 75.1041 812.53 771.833 Potri.015G069301.1.v4.1 564 315.746 0 0 Potri.010G195200.1.v4.1 1773 1518.88 247 11.6017 Potri.012G127500.1.v4.1 977 722.878 4723 466.123 ==> SRR7172124.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 409 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 319 SRR7172124 completed mapping pipeline successfully