Starting /dee2/code/volunteer_pipeline.sh SRR7172125 current disk space = 3085311885312 free memory = 1449566524 SRR7172125 SRAfilesize ea73825b70289ab0238eec2b6a5e0259 SRR7172125.sra SRR7172125.sra file validated SRR7172125 is paired end SRR7172125 is conventional basespace SRR7172125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.78175 33.0 32.0 33.0 27.0 34.0 2 27.944 31.0 25.0 32.0 18.0 33.0 3 31.0635 33.0 30.0 33.0 27.0 33.0 4 32.1735 33.0 33.0 33.0 30.0 33.0 5 32.481 33.0 33.0 33.0 31.0 34.0 6 36.202 37.0 36.0 38.0 33.0 38.0 7 36.70975 38.0 37.0 38.0 34.0 38.0 8 37.118 38.0 38.0 38.0 36.0 38.0 9 37.312 38.0 38.0 38.0 36.0 38.0 10-14 37.3925 38.0 38.0 38.0 37.0 38.0 15-19 37.438 38.0 38.0 38.0 37.0 38.0 20-24 37.417500000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.375099999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.345749999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.351350000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.26105 38.0 38.0 38.0 36.8 38.0 45-49 37.21085 38.0 38.0 38.0 36.4 38.0 50-54 37.1219 38.0 38.0 38.0 36.0 38.0 55-59 37.064949999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.9286 38.0 38.0 38.0 35.4 38.0 65-69 36.9187 38.0 38.0 38.0 35.2 38.0 70-74 36.851299999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.627300000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.589600000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.39835 38.0 37.2 38.0 33.8 38.0 90-94 36.34765 38.0 37.2 38.0 33.8 38.0 95-99 36.29174999999999 38.0 37.0 38.0 33.4 38.0 100-104 36.06665 38.0 37.0 38.0 33.0 38.0 105-109 35.76469999999999 38.0 36.8 38.0 31.4 38.0 110-114 35.604850000000006 38.0 36.0 38.0 30.8 38.0 115-119 35.498900000000006 38.0 36.0 38.0 30.6 38.0 120-124 35.1836 38.0 35.8 38.0 28.4 38.0 125-129 34.9283 38.0 35.0 38.0 27.8 38.0 130-134 34.6558 38.0 35.0 38.0 27.4 38.0 135-139 34.1942 38.0 34.8 38.0 24.2 38.0 140-144 33.54495 38.0 34.0 38.0 21.4 38.0 145-149 32.7661 38.0 33.6 38.0 15.4 38.0 150-151 29.04625 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 0.0 15 1.0 16 0.0 17 3.0 18 1.0 19 2.0 20 5.0 21 6.0 22 4.0 23 8.0 24 14.0 25 12.0 26 19.0 27 26.0 28 31.0 29 31.0 30 46.0 31 67.0 32 72.0 33 139.0 34 229.0 35 411.0 36 1082.0 37 1788.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.65625 18.880208333333336 14.296875 34.166666666666664 2 19.400000000000002 23.35 37.65 19.6 3 16.975 31.65 27.250000000000004 24.125 4 21.775 35.075 23.75 19.400000000000002 5 19.75 36.825 23.875 19.55 6 15.875 36.95 25.5 21.675 7 12.775 20.5 45.975 20.75 8 16.950000000000003 23.025000000000002 27.950000000000003 32.074999999999996 9 17.575 22.75 30.049999999999997 29.625 10-14 20.39 30.45 26.040000000000003 23.119999999999997 15-19 20.205000000000002 29.095 27.395000000000003 23.305 20-24 19.64 29.435 27.48 23.445 25-29 20.01 29.175 28.055000000000003 22.759999999999998 30-34 19.71 29.38 28.07 22.84 35-39 19.82 29.049999999999997 27.37 23.76 40-44 20.49 29.110000000000003 27.425 22.975 45-49 20.3 28.994999999999997 27.605 23.1 50-54 19.775000000000002 29.265 27.615000000000002 23.345 55-59 20.095 28.694999999999997 27.66 23.549999999999997 60-64 20.29 29.494999999999997 27.025 23.189999999999998 65-69 19.86 28.975 27.97 23.195 70-74 20.96 28.854999999999997 27.224999999999998 22.96 75-79 20.535 28.87 27.27 23.325000000000003 80-84 20.495 28.9 27.655 22.95 85-89 19.98 28.720000000000002 27.82 23.48 90-94 20.51 29.415000000000003 27.339999999999996 22.735 95-99 20.349999999999998 28.799999999999997 27.33 23.52 100-104 20.580000000000002 28.78 27.48 23.16 105-109 20.735 28.775000000000002 27.229999999999997 23.26 110-114 21.67 28.315 27.229999999999997 22.785 115-119 20.544999999999998 28.849999999999998 28.03 22.575 120-124 20.735 29.37 27.105 22.79 125-129 20.985 28.075 27.725 23.215 130-134 21.055 29.14 26.424999999999997 23.380000000000003 135-139 21.38 28.294999999999998 27.24 23.085 140-144 20.905 28.749999999999996 26.895000000000003 23.45 145-149 21.18 28.98 26.384999999999998 23.455000000000002 150-151 20.4375 28.462500000000002 26.937499999999996 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 3.5 23 4.0 24 3.5 25 6.0 26 8.0 27 6.0 28 10.0 29 19.0 30 27.5 31 30.5 32 35.5 33 51.0 34 67.5 35 87.0 36 101.0 37 121.5 38 146.0 39 175.0 40 205.5 41 219.0 42 234.0 43 258.0 44 265.5 45 270.5 46 265.0 47 231.0 48 217.0 49 203.5 50 170.5 51 127.5 52 100.0 53 85.5 54 60.5 55 40.0 56 32.0 57 28.0 58 21.0 59 15.0 60 11.0 61 8.5 62 4.5 63 3.0 64 4.0 65 3.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.225 0.0 0.0 0.0 0.0 120-121 2.7125000000000004 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.1875 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 5.112500000000001 0.0 0.0 0.0 0.0 134-135 5.7375 0.0 0.0 0.0 0.0 136-137 6.125 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05175 33.0 33.0 34.0 32.0 34.0 2 33.12725 34.0 33.0 34.0 32.0 34.0 3 33.19975 34.0 33.0 34.0 33.0 34.0 4 33.2025 34.0 33.0 34.0 33.0 34.0 5 33.205 34.0 33.0 34.0 33.0 34.0 6 37.298 38.0 38.0 38.0 37.0 38.0 7 37.3785 38.0 38.0 38.0 37.0 38.0 8 37.37075 38.0 38.0 38.0 37.0 38.0 9 37.331 38.0 38.0 38.0 37.0 38.0 10-14 37.3243 38.0 38.0 38.0 37.0 38.0 15-19 37.35815 38.0 38.0 38.0 37.0 38.0 20-24 37.2945 38.0 38.0 38.0 37.0 38.0 25-29 37.264300000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.2267 38.0 38.0 38.0 37.0 38.0 35-39 37.088300000000004 38.0 38.0 38.0 36.4 38.0 40-44 37.15185 38.0 38.0 38.0 36.8 38.0 45-49 37.103449999999995 38.0 38.0 38.0 36.4 38.0 50-54 37.0854 38.0 38.0 38.0 36.0 38.0 55-59 37.01755 38.0 38.0 38.0 36.0 38.0 60-64 36.97475 38.0 38.0 38.0 36.0 38.0 65-69 36.86875 38.0 38.0 38.0 35.8 38.0 70-74 36.77714999999999 38.0 38.0 38.0 35.0 38.0 75-79 36.691500000000005 38.0 38.0 38.0 34.8 38.0 80-84 36.536249999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.4419 38.0 38.0 38.0 34.2 38.0 90-94 36.3285 38.0 38.0 38.0 34.0 38.0 95-99 36.1263 38.0 37.4 38.0 33.2 38.0 100-104 36.0693 38.0 37.0 38.0 33.0 38.0 105-109 35.898700000000005 38.0 37.0 38.0 32.2 38.0 110-114 35.6229 38.0 36.8 38.0 30.8 38.0 115-119 35.45745000000001 38.0 36.4 38.0 30.2 38.0 120-124 35.21900000000001 38.0 36.0 38.0 29.0 38.0 125-129 34.74505 38.0 35.2 38.0 27.2 38.0 130-134 34.498000000000005 38.0 35.0 38.0 25.6 38.0 135-139 34.092949999999995 38.0 34.8 38.0 23.4 38.0 140-144 33.4618 38.0 33.8 38.0 20.2 38.0 145-149 32.576800000000006 38.0 32.6 38.0 13.8 38.0 150-151 28.02475 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 5.0 12 0.0 13 2.0 14 1.0 15 2.0 16 2.0 17 3.0 18 3.0 19 6.0 20 7.0 21 9.0 22 7.0 23 12.0 24 9.0 25 20.0 26 13.0 27 24.0 28 24.0 29 34.0 30 51.0 31 55.0 32 75.0 33 124.0 34 177.0 35 359.0 36 836.0 37 2133.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 15.475 16.5 29.975 2 23.974999999999998 21.025 36.475 18.525 3 19.625 25.424999999999997 33.074999999999996 21.875 4 23.799999999999997 33.175 22.025 21.0 5 23.225 38.5 21.099999999999998 17.175 6 16.950000000000003 37.25 24.375 21.425 7 17.349999999999998 17.0 44.55 21.099999999999998 8 20.775 21.8 27.3 30.125 9 20.424999999999997 24.425 29.125 26.025 10-14 22.645 28.605000000000004 26.740000000000002 22.009999999999998 15-19 23.400000000000002 27.685 28.165000000000003 20.75 20-24 22.52 28.335 27.950000000000003 21.195 25-29 23.044999999999998 28.735 27.625 20.595 30-34 22.805 28.294999999999998 27.634999999999998 21.265 35-39 22.939999999999998 27.950000000000003 28.07 21.04 40-44 22.705000000000002 27.839999999999996 28.065 21.39 45-49 23.04 27.500000000000004 28.499999999999996 20.96 50-54 22.825 28.345 28.01 20.82 55-59 23.315 28.225 27.775 20.685000000000002 60-64 23.255 27.224999999999998 28.43 21.09 65-69 22.795 27.91 28.04 21.255 70-74 23.18 27.985 27.73 21.105 75-79 23.51 27.32 28.215 20.955 80-84 23.06 28.384999999999998 27.58 20.974999999999998 85-89 23.330000000000002 28.084999999999997 28.189999999999998 20.395 90-94 23.025000000000002 27.305 28.544999999999998 21.125 95-99 22.765 28.325 28.12 20.79 100-104 23.25 27.315 28.515 20.919999999999998 105-109 23.52 27.735 28.355000000000004 20.39 110-114 23.305 27.825 28.37 20.5 115-119 23.544999999999998 27.495000000000005 28.465 20.495 120-124 23.34 27.93 28.24 20.49 125-129 23.599999999999998 27.815 28.22 20.365 130-134 24.425 27.52 28.005000000000003 20.05 135-139 24.38 26.784999999999997 28.82 20.015 140-144 24.43 27.644999999999996 27.834999999999997 20.09 145-149 24.57 27.955000000000002 27.63 19.845 150-151 24.6875 27.237499999999997 27.962500000000002 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 3.0 24 4.5 25 3.0 26 3.5 27 6.0 28 8.0 29 11.5 30 11.5 31 12.5 32 27.0 33 45.0 34 56.5 35 65.5 36 81.5 37 108.5 38 133.5 39 159.5 40 176.5 41 219.0 42 260.5 43 253.0 44 265.5 45 289.0 46 283.5 47 270.0 48 244.5 49 203.0 50 172.0 51 142.0 52 109.0 53 95.5 54 77.0 55 48.0 56 39.0 57 36.0 58 22.0 59 12.0 60 10.0 61 6.5 62 5.5 63 5.0 64 3.5 65 1.5 66 1.0 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72403411941796 99.375 2 0.22579026593075763 0.44999999999999996 3 0.025087807325639738 0.075 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.225 0.0 0.0 0.0 0.0 138-139 6.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTATCA 10 0.006830828 145.0 5 GCACTTA 10 0.006830828 145.0 2 >>END_MODULE Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607671 spots for SRR7172125.sra Written 607671 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra Read 607658 spots for SRR7172125.sra Written 607658 spots for SRR7172125.sra SRR ids: ['SRR7172125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jo_6hts1 SRR7172125.sra spots: 12153173 blocks: [[1, 607658], [607659, 1215316], [1215317, 1822974], [1822975, 2430632], [2430633, 3038290], [3038291, 3645948], [3645949, 4253606], [4253607, 4861264], [4861265, 5468922], [5468923, 6076580], [6076581, 6684238], [6684239, 7291896], [7291897, 7899554], [7899555, 8507212], [8507213, 9114870], [9114871, 9722528], [9722529, 10330186], [10330187, 10937844], [10937845, 11545502], [11545503, 12153173]] SRR7172125 file size 4096611 SRR7172125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172125 SRR7172125_1.fastq SRR7172125_2.fastq Input file: SRR7172125_1.fastq Paired file: SRR7172125_2.fastq trimmed: SRR7172125-trimmed-pair1.fastq, SRR7172125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:20:59 2025 >> started Fri Feb 14 06:21:18 2025 >> done (19.532s) 12153173 read pairs processed; of these: 7128 ( 0.06%) short read pairs filtered out after trimming by size control 4079 ( 0.03%) empty read pairs filtered out after trimming by size control 12141966 (99.91%) read pairs available; of these: 7653596 (63.03%) trimmed read pairs available after processing 4488370 (36.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 1 0.00% 25 5 0.00% 26 4 0.00% 27 1 0.00% 28 7 0.00% 29 3 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 7 0.00% 34 3 0.00% 35 1 0.00% 36 6 0.00% 37 4 0.00% 38 6 0.00% 39 3 0.00% 40 5 0.00% 41 5 0.00% 42 12 0.00% 43 12 0.00% 44 10 0.00% 45 14 0.00% 46 12 0.00% 47 9 0.00% 48 16 0.00% 49 23 0.00% 50 26 0.00% 51 34 0.00% 52 29 0.00% 53 39 0.00% 54 39 0.00% 55 41 0.00% 56 51 0.00% 57 48 0.00% 58 73 0.00% 59 70 0.00% 60 85 0.00% 61 110 0.00% 62 109 0.00% 63 132 0.00% 64 123 0.00% 65 132 0.00% 66 149 0.00% 67 190 0.00% 68 204 0.00% 69 248 0.00% 70 258 0.00% 71 320 0.00% 72 373 0.00% 73 451 0.00% 74 482 0.00% 75 619 0.01% 76 633 0.01% 77 735 0.01% 78 776 0.01% 79 850 0.01% 80 1074 0.01% 81 1199 0.01% 82 1472 0.01% 83 1695 0.01% 84 2173 0.02% 85 2519 0.02% 86 2726 0.02% 87 3097 0.03% 88 3452 0.03% 89 3702 0.03% 90 3852 0.03% 91 4272 0.04% 92 4738 0.04% 93 5085 0.04% 94 5674 0.05% 95 6228 0.05% 96 6580 0.05% 97 7092 0.06% 98 7673 0.06% 99 8327 0.07% 100 9200 0.08% 101 10007 0.08% 102 10723 0.09% 103 11529 0.09% 104 12300 0.10% 105 13416 0.11% 106 14217 0.12% 107 15108 0.12% 108 15835 0.13% 109 16811 0.14% 110 18032 0.15% 111 18714 0.15% 112 19894 0.16% 113 21088 0.17% 114 22662 0.19% 115 23732 0.20% 116 25176 0.21% 117 26010 0.21% 118 27263 0.22% 119 28062 0.23% 120 29430 0.24% 121 31223 0.26% 122 33011 0.27% 123 34765 0.29% 124 36209 0.30% 125 38123 0.31% 126 40114 0.33% 127 42543 0.35% 128 44391 0.37% 129 46818 0.39% 130 49761 0.41% 131 52441 0.43% 132 56393 0.46% 133 60268 0.50% 134 64573 0.53% 135 68038 0.56% 136 73729 0.61% 137 79227 0.65% 138 86365 0.71% 139 93970 0.77% 140 102481 0.84% 141 113630 0.94% 142 129951 1.07% 143 150472 1.24% 144 179713 1.48% 145 221460 1.82% 146 286099 2.36% 147 393082 3.24% 148 592703 4.88% 149 1048598 8.64% 150 2923981 24.08% 151 4488370 36.97% 12141966 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=22 prefix-density=0.27 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=49.11 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=7.4 sequence=TTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.0 sequence=CTGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=103.72 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=20.7 sequence=TGATGAGGATGA SRR7172125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:22:14 Started mapping on | Feb 14 06:22:14 Finished on | Feb 14 06:24:13 Mapping speed, Million of reads per hour | 367.32 Number of input reads | 12141966 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11214771 Uniquely mapped reads % | 92.36% Average mapped length | 292.00 Number of splices: Total | 10169554 Number of splices: Annotated (sjdb) | 9951045 Number of splices: GT/AG | 9996410 Number of splices: GC/AG | 132165 Number of splices: AT/AC | 8906 Number of splices: Non-canonical | 32073 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330695 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 34548 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.51% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 604792 604792 604792 N_multimapping 330695 330695 330695 N_noFeature 397826 11092677 463387 N_ambiguous 121926 1204 64463 UnstrandedReadsAssigned:10695019 PositiveStrandReadsAssigned:120890 NegativeStrandReadsAssigned:10686921 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172125-trimmed-pair1.fastq SRR7172125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,141,966 reads, 10,635,642 reads pseudoaligned [quant] estimated average fragment length: 231.147 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7172125.ke.tsv 34699 SRR7172125.se.tsv 87100 total ==> SRR7172125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.85 1160 63.2261 Potri.005G024800.1.v4.1 1035 804.853 389 47.0981 Potri.004G059700.1.v4.1 961 730.873 9 1.19997 Potri.007G009000.2.v4.1 1416 1185.85 0 0 Potri.003G141000.2.v4.1 2943 2712.85 477.632 17.1569 Potri.016G087400.1.v4.1 270 82.6995 506.491 596.814 Potri.015G069301.1.v4.1 564 336.527 0 0 Potri.010G195200.1.v4.1 1773 1542.85 549 34.6751 Potri.012G127500.1.v4.1 977 746.863 9986 1302.93 ==> SRR7172125.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 175 Potri.001G452600.v4.1 274 SRR7172125 completed mapping pipeline successfully