Starting /dee2/code/volunteer_pipeline.sh SRR7172126 current disk space = 3102416048128 free memory = 1582328352 SRR7172126 SRAfilesize c6e216214cc2ddda25097c6514c8572e SRR7172126.sra SRR7172126.sra file validated SRR7172126 is paired end SRR7172126 is conventional basespace SRR7172126 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.1335 18.0 18.0 18.0 18.0 30.0 2 28.362 27.0 27.0 32.0 25.0 32.0 3 31.1905 32.0 32.0 33.0 27.0 33.0 4 31.7 33.0 32.0 33.0 30.0 33.0 5 32.51275 33.0 33.0 33.0 32.0 33.0 6 36.585 38.0 37.0 38.0 34.0 38.0 7 37.27675 38.0 38.0 38.0 36.0 38.0 8 37.3715 38.0 38.0 38.0 37.0 38.0 9 37.435 38.0 38.0 38.0 37.0 38.0 10-14 37.29285 38.0 38.0 38.0 37.2 38.0 15-19 37.44435 38.0 38.0 38.0 37.4 38.0 20-24 37.356700000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.29280000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.295849999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.1774 38.0 38.0 38.0 37.0 38.0 40-44 37.17785 38.0 38.0 38.0 36.6 38.0 45-49 36.78725 38.0 38.0 38.0 35.2 38.0 50-54 37.151300000000006 38.0 38.0 38.0 36.2 38.0 55-59 37.2528 38.0 38.0 38.0 37.0 38.0 60-64 37.24185 38.0 38.0 38.0 36.8 38.0 65-69 37.1914 38.0 38.0 38.0 36.2 38.0 70-74 37.04975 38.0 38.0 38.0 35.8 38.0 75-79 36.885650000000005 38.0 38.0 38.0 35.4 38.0 80-84 36.90005 38.0 38.0 38.0 35.6 38.0 85-89 36.70065 38.0 38.0 38.0 34.8 38.0 90-94 36.62955 38.0 38.0 38.0 34.6 38.0 95-99 36.54655 38.0 38.0 38.0 34.4 38.0 100-104 36.520849999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.47025 38.0 38.0 38.0 34.0 38.0 110-114 36.188599999999994 38.0 37.6 38.0 33.6 38.0 115-119 36.0495 38.0 37.0 38.0 33.0 38.0 120-124 35.899 38.0 37.0 38.0 32.4 38.0 125-129 35.57935 38.0 36.2 38.0 31.0 38.0 130-134 35.1923 38.0 36.0 38.0 29.0 38.0 135-139 34.9101 38.0 35.8 38.0 28.8 38.0 140-144 34.305 38.0 33.8 38.0 26.0 38.0 145-149 33.3117 38.0 33.0 38.0 19.4 38.0 150-151 28.444125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 1.0 17 2.0 18 3.0 19 0.0 20 3.0 21 1.0 22 12.0 23 6.0 24 8.0 25 8.0 26 12.0 27 26.0 28 22.0 29 30.0 30 54.0 31 67.0 32 94.0 33 127.0 34 157.0 35 336.0 36 750.0 37 2273.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.8 18.525 26.125 33.550000000000004 2 20.625 24.6 35.975 18.8 3 16.775000000000002 32.7 28.1 22.425 4 20.375 36.3 24.0 19.325 5 19.70492623155789 35.73393348337085 25.156289072268066 19.4048512128032 6 15.65 36.25 25.4 22.7 7 12.8 19.925 45.875 21.4 8 17.349999999999998 19.8 30.2 32.65 9 17.625 21.224999999999998 32.425 28.725 10-14 19.55366098294885 29.794383149448343 26.273821464393183 24.37813440320963 15-19 19.12 28.775000000000002 28.225 23.880000000000003 20-24 19.765 29.395 27.265 23.575 25-29 19.445 28.95 28.144999999999996 23.46 30-34 19.625 28.754999999999995 28.215 23.405 35-39 19.580000000000002 29.060000000000002 27.98 23.380000000000003 40-44 19.825 29.43 27.04 23.705000000000002 45-49 19.725 28.82 27.91 23.544999999999998 50-54 19.49 29.360000000000003 27.755000000000003 23.395 55-59 19.575 28.87 27.800000000000004 23.755000000000003 60-64 19.67 29.115000000000002 28.275 22.939999999999998 65-69 19.61 29.445 27.450000000000003 23.494999999999997 70-74 19.99 28.849999999999998 27.805000000000003 23.355 75-79 19.830000000000002 28.485 28.24 23.445 80-84 19.835 28.73 28.425 23.01 85-89 19.78 28.845 27.91 23.465 90-94 20.05 29.395 27.655 22.900000000000002 95-99 20.06 28.28 28.694999999999997 22.965 100-104 20.11 28.335 27.860000000000003 23.695 105-109 19.790884986742707 27.795287408074444 28.42063134724098 23.993196257941868 110-114 20.126069338135974 28.650757916854268 28.190504777627694 23.03266796738206 115-119 20.87104355217761 28.746437321866093 27.321366068303416 23.061153057652884 120-124 20.39039039039039 28.428428428428425 27.43743743743744 23.743743743743746 125-129 20.336605890603085 28.43117611701062 27.805049088359045 23.427168904027248 130-134 20.880000000000003 27.775 27.49 23.855 135-139 21.065 29.14 27.575 22.220000000000002 140-144 20.155 28.560000000000002 27.21 24.075 145-149 20.895 28.860000000000003 26.465 23.78 150-151 20.9125 28.537499999999998 27.3125 23.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 1.5 24 2.0 25 4.5 26 7.0 27 8.0 28 11.0 29 15.0 30 27.0 31 34.5 32 43.0 33 59.0 34 74.5 35 82.5 36 101.5 37 133.5 38 158.5 39 182.5 40 223.0 41 260.0 42 264.5 43 275.0 44 278.0 45 274.5 46 245.5 47 218.5 48 205.5 49 171.5 50 150.5 51 115.0 52 80.0 53 69.0 54 56.5 55 39.5 56 25.0 57 22.0 58 20.0 59 13.0 60 12.0 61 8.5 62 3.0 63 4.0 64 5.0 65 4.0 66 2.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.3 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.055 110-114 0.055 115-119 0.005 120-124 0.1 125-129 0.18 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.2375 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.7125000000000004 0.0 0.0 0.0 0.0 130-131 3.0625 0.0 0.0 0.0 0.0 132-133 3.3125 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAAAT 10 0.006830828 145.0 7 >>END_MODULE SRR7172126 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82775 33.0 33.0 34.0 32.0 34.0 2 32.8805 34.0 33.0 34.0 32.0 34.0 3 32.93375 34.0 33.0 34.0 32.0 34.0 4 32.87375 34.0 33.0 34.0 32.0 34.0 5 32.95825 34.0 33.0 34.0 32.0 34.0 6 37.13775 38.0 38.0 38.0 37.0 38.0 7 37.29325 38.0 38.0 38.0 37.0 38.0 8 37.24475 38.0 38.0 38.0 37.0 38.0 9 37.22775 38.0 38.0 38.0 37.0 38.0 10-14 37.177499999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.07935 38.0 38.0 38.0 37.0 38.0 20-24 37.0474 38.0 38.0 38.0 36.8 38.0 25-29 36.9021 38.0 38.0 38.0 36.0 38.0 30-34 37.012649999999994 38.0 38.0 38.0 36.8 38.0 35-39 36.974900000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.863099999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.953250000000004 38.0 38.0 38.0 36.4 38.0 50-54 37.01665 38.0 38.0 38.0 36.6 38.0 55-59 36.95385 38.0 38.0 38.0 36.0 38.0 60-64 36.92705 38.0 38.0 38.0 36.0 38.0 65-69 36.8491 38.0 38.0 38.0 36.0 38.0 70-74 36.785900000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.77040000000001 38.0 38.0 38.0 35.8 38.0 80-84 36.5706 38.0 38.0 38.0 34.6 38.0 85-89 36.47465 38.0 38.0 38.0 34.4 38.0 90-94 36.367149999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.18555 38.0 38.0 38.0 33.8 38.0 100-104 36.137649999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.043350000000004 38.0 38.0 38.0 33.2 38.0 110-114 35.9442 38.0 37.8 38.0 33.0 38.0 115-119 35.72095 38.0 37.2 38.0 31.8 38.0 120-124 35.58299999999999 38.0 37.0 38.0 31.0 38.0 125-129 35.42185 38.0 37.0 38.0 31.0 38.0 130-134 35.129949999999994 38.0 36.2 38.0 30.2 38.0 135-139 34.70309999999999 38.0 36.0 38.0 28.0 38.0 140-144 34.24305 38.0 34.6 38.0 24.8 38.0 145-149 33.5421 38.0 33.8 38.0 20.0 38.0 150-151 28.906999999999996 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 3.0 10 3.0 11 2.0 12 2.0 13 4.0 14 2.0 15 2.0 16 7.0 17 6.0 18 3.0 19 2.0 20 5.0 21 4.0 22 8.0 23 4.0 24 8.0 25 18.0 26 15.0 27 23.0 28 23.0 29 35.0 30 51.0 31 55.0 32 70.0 33 121.0 34 162.0 35 255.0 36 549.0 37 2542.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.054650288292805 14.840812233642517 17.648533467034344 29.456004011030334 2 23.752194632555806 22.397792826686732 35.390017557060446 18.459994983697015 3 21.168798595435163 25.457737647353902 32.43039879608728 20.943064961123653 4 23.325808878856282 35.74115876598947 21.921244043140206 19.011788312014048 5 23.64593781344032 35.65697091273822 22.091273821464394 18.60581745235707 6 18.197747183979978 36.2953692115144 25.832290362953692 19.67459324155194 7 16.675 15.475 46.400000000000006 21.45 8 19.525000000000002 21.425 29.15 29.9 9 21.625 24.9 28.050000000000004 25.424999999999997 10-14 22.870291631234053 28.5278375268871 26.75203841728778 21.849832424591064 15-19 22.955000000000002 28.055000000000003 28.53 20.46 20-24 22.86 27.584999999999997 28.665000000000003 20.89 25-29 22.855 27.92 28.425 20.8 30-34 22.23 28.360000000000003 28.365000000000002 21.044999999999998 35-39 22.89 27.625 28.595 20.89 40-44 22.875 27.77 28.765 20.59 45-49 22.955000000000002 27.985 28.389999999999997 20.669999999999998 50-54 22.95 28.134999999999998 28.294999999999998 20.62 55-59 22.945 27.83 28.27 20.955 60-64 22.865 28.01 28.26 20.865000000000002 65-69 23.59 28.035 27.705000000000002 20.669999999999998 70-74 23.355 28.16 28.625 19.86 75-79 23.175 28.194999999999997 27.845 20.785 80-84 22.835 27.994999999999997 28.4 20.77 85-89 23.169999999999998 28.52 28.12 20.19 90-94 23.155 28.425 27.915 20.505000000000003 95-99 23.580000000000002 28.29 27.985 20.145 100-104 24.240000000000002 27.765 28.03 19.965 105-109 23.54 27.805000000000003 28.389999999999997 20.265 110-114 23.115 27.92 28.804999999999996 20.16 115-119 24.03 27.455000000000002 28.425 20.09 120-124 23.285 28.389999999999997 28.294999999999998 20.03 125-129 23.805 28.105000000000004 28.155 19.935 130-134 24.305 28.194999999999997 28.02 19.48 135-139 24.03 27.92 28.43 19.62 140-144 24.310000000000002 28.13 27.825 19.735 145-149 24.275 28.255000000000003 27.839999999999996 19.63 150-151 25.924999999999997 27.55 26.924999999999997 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 3.0 25 3.5 26 4.0 27 6.5 28 9.5 29 12.0 30 17.0 31 20.5 32 24.0 33 35.0 34 44.0 35 66.0 36 97.5 37 121.0 38 148.0 39 173.5 40 200.5 41 232.0 42 262.5 43 279.5 44 287.0 45 290.5 46 261.5 47 244.0 48 224.0 49 179.5 50 156.0 51 135.5 52 113.5 53 90.5 54 70.0 55 50.5 56 33.0 57 24.0 58 16.5 59 14.0 60 14.5 61 10.0 62 5.5 63 3.0 64 3.0 65 3.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.325 3 0.325 4 0.325 5 0.3 6 0.125 7 0.0 8 0.0 9 0.0 10-14 0.045 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.655076845553036 1.3 3 0.02519526329050139 0.075 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.775 0.0 0.0 0.0 0.0 130-131 3.1 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.6624999999999996 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTCC 10 0.006830828 145.0 3 GCAGTTC 10 0.006830828 145.0 2 TACTTTT 10 0.006830828 145.0 3 >>END_MODULE Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925423 spots for SRR7172126.sra Written 925423 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra Read 925419 spots for SRR7172126.sra Written 925419 spots for SRR7172126.sra SRR ids: ['SRR7172126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_la4skvlp SRR7172126.sra spots: 18508384 blocks: [[1, 925419], [925420, 1850838], [1850839, 2776257], [2776258, 3701676], [3701677, 4627095], [4627096, 5552514], [5552515, 6477933], [6477934, 7403352], [7403353, 8328771], [8328772, 9254190], [9254191, 10179609], [10179610, 11105028], [11105029, 12030447], [12030448, 12955866], [12955867, 13881285], [13881286, 14806704], [14806705, 15732123], [15732124, 16657542], [16657543, 17582961], [17582962, 18508384]] SRR7172126 file size 6250183 SRR7172126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172126 SRR7172126_1.fastq SRR7172126_2.fastq Input file: SRR7172126_1.fastq Paired file: SRR7172126_2.fastq trimmed: SRR7172126-trimmed-pair1.fastq, SRR7172126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:14:10 2025 >> started Fri Feb 14 07:14:30 2025 >> done (19.857s) 18508384 read pairs processed; of these: 15701 ( 0.08%) short read pairs filtered out after trimming by size control 13821 ( 0.07%) empty read pairs filtered out after trimming by size control 18478862 (99.84%) read pairs available; of these: 9131068 (49.41%) trimmed read pairs available after processing 9347794 (50.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 8 0.00% 21 5 0.00% 22 5 0.00% 23 8 0.00% 24 13 0.00% 25 12 0.00% 26 5 0.00% 27 10 0.00% 28 8 0.00% 29 8 0.00% 30 6 0.00% 31 4 0.00% 32 9 0.00% 33 9 0.00% 34 9 0.00% 35 3 0.00% 36 6 0.00% 37 9 0.00% 38 15 0.00% 39 7 0.00% 40 12 0.00% 41 10 0.00% 42 10 0.00% 43 20 0.00% 44 12 0.00% 45 15 0.00% 46 21 0.00% 47 12 0.00% 48 18 0.00% 49 21 0.00% 50 21 0.00% 51 34 0.00% 52 38 0.00% 53 44 0.00% 54 42 0.00% 55 49 0.00% 56 54 0.00% 57 69 0.00% 58 84 0.00% 59 109 0.00% 60 84 0.00% 61 94 0.00% 62 109 0.00% 63 119 0.00% 64 183 0.00% 65 189 0.00% 66 212 0.00% 67 210 0.00% 68 232 0.00% 69 261 0.00% 70 318 0.00% 71 336 0.00% 72 430 0.00% 73 488 0.00% 74 609 0.00% 75 627 0.00% 76 749 0.00% 77 832 0.00% 78 910 0.00% 79 1068 0.01% 80 1228 0.01% 81 1403 0.01% 82 1688 0.01% 83 2034 0.01% 84 3283 0.02% 85 3967 0.02% 86 4066 0.02% 87 4650 0.03% 88 4988 0.03% 89 4792 0.03% 90 4941 0.03% 91 5340 0.03% 92 5705 0.03% 93 6271 0.03% 94 6631 0.04% 95 6977 0.04% 96 7611 0.04% 97 8049 0.04% 98 8818 0.05% 99 9729 0.05% 100 11362 0.06% 101 11203 0.06% 102 11802 0.06% 103 12544 0.07% 104 12827 0.07% 105 13834 0.07% 106 14337 0.08% 107 15342 0.08% 108 16157 0.09% 109 17349 0.09% 110 18105 0.10% 111 19001 0.10% 112 20157 0.11% 113 21069 0.11% 114 22431 0.12% 115 23232 0.13% 116 24707 0.13% 117 25666 0.14% 118 26517 0.14% 119 28150 0.15% 120 29380 0.16% 121 30785 0.17% 122 32091 0.17% 123 33619 0.18% 124 35587 0.19% 125 37600 0.20% 126 39173 0.21% 127 40760 0.22% 128 42447 0.23% 129 45159 0.24% 130 47088 0.25% 131 49250 0.27% 132 52298 0.28% 133 56325 0.30% 134 59914 0.32% 135 64317 0.35% 136 69618 0.38% 137 73207 0.40% 138 79268 0.43% 139 87204 0.47% 140 99507 0.54% 141 106530 0.58% 142 118417 0.64% 143 134355 0.73% 144 157251 0.85% 145 188638 1.02% 146 236594 1.28% 147 321219 1.74% 148 487424 2.64% 149 960319 5.20% 150 4838839 26.19% 151 9347794 50.59% 18478862 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=27 prefix-density=0.34 prefix-fanout=2.0 sequence=GCAATGATTGTCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=33.05 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=10.2 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=15 prefix-density=0.55 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=22.24 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.7 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7172126 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:15:19 Started mapping on | Feb 14 07:15:19 Finished on | Feb 14 07:18:18 Mapping speed, Million of reads per hour | 371.64 Number of input reads | 18478862 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16876143 Uniquely mapped reads % | 91.33% Average mapped length | 294.96 Number of splices: Total | 16397633 Number of splices: Annotated (sjdb) | 16050366 Number of splices: GT/AG | 16120283 Number of splices: GC/AG | 209427 Number of splices: AT/AC | 14389 Number of splices: Non-canonical | 53534 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500373 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 51343 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.59% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1119768 1119768 1119768 N_multimapping 500373 500373 500373 N_noFeature 577744 16689717 678537 N_ambiguous 182688 1020 96536 UnstrandedReadsAssigned:16115711 PositiveStrandReadsAssigned:185406 NegativeStrandReadsAssigned:16101070 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172126-trimmed-pair1.fastq SRR7172126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,478,862 reads, 15,978,929 reads pseudoaligned [quant] estimated average fragment length: 252.805 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7172126.ke.tsv 34699 SRR7172126.se.tsv 87100 total ==> SRR7172126.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.2 1360 47.8738 Potri.005G024800.1.v4.1 1035 783.195 637 50.567 Potri.004G059700.1.v4.1 961 709.238 84 7.3635 Potri.007G009000.2.v4.1 1416 1164.2 0 0 Potri.003G141000.2.v4.1 2943 2691.2 694 16.0329 Potri.016G087400.1.v4.1 270 76.4122 827 672.884 Potri.015G069301.1.v4.1 564 318.458 0 0 Potri.010G195200.1.v4.1 1773 1521.2 444 18.1466 Potri.012G127500.1.v4.1 977 725.228 10439 894.915 ==> SRR7172126.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 63 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 554 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 840 SRR7172126 completed mapping pipeline successfully