Starting /dee2/code/volunteer_pipeline.sh SRR7172128 current disk space = 3085240881152 free memory = 1016706468 SRR7172128 SRAfilesize b39841b921ecbb56a04791587a2ecc49 SRR7172128.sra SRR7172128.sra file validated SRR7172128 is paired end SRR7172128 is conventional basespace SRR7172128 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7545 33.0 33.0 34.0 32.0 34.0 2 33.15025 34.0 33.0 34.0 32.0 34.0 3 32.9735 34.0 33.0 34.0 32.0 34.0 4 32.5725 33.0 33.0 34.0 31.0 34.0 5 33.008 33.0 33.0 34.0 32.0 34.0 6 36.609 38.0 37.0 38.0 34.0 38.0 7 37.14675 38.0 38.0 38.0 36.0 38.0 8 37.28075 38.0 38.0 38.0 36.0 38.0 9 37.26875 38.0 38.0 38.0 37.0 38.0 10-14 37.40875 38.0 38.0 38.0 37.0 38.0 15-19 37.41095 38.0 38.0 38.0 37.0 38.0 20-24 37.387649999999994 38.0 38.0 38.0 37.2 38.0 25-29 37.3732 38.0 38.0 38.0 37.0 38.0 30-34 37.2869 38.0 38.0 38.0 37.0 38.0 35-39 37.18865 38.0 38.0 38.0 36.8 38.0 40-44 37.1854 38.0 38.0 38.0 36.8 38.0 45-49 37.15095 38.0 38.0 38.0 36.8 38.0 50-54 37.28530000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.248900000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.1163 38.0 38.0 38.0 36.2 38.0 65-69 37.118449999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.0697 38.0 38.0 38.0 36.0 38.0 75-79 36.9233 38.0 38.0 38.0 35.8 38.0 80-84 36.90410000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.786049999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.694449999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.614250000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.4613 38.0 38.0 38.0 34.0 38.0 105-109 36.36489999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.176750000000006 38.0 37.8 38.0 33.8 38.0 115-119 36.0274 38.0 37.0 38.0 33.2 38.0 120-124 35.67955 38.0 37.0 38.0 30.8 38.0 125-129 35.3868 38.0 36.0 38.0 30.6 38.0 130-134 35.236450000000005 38.0 36.0 38.0 30.6 38.0 135-139 34.9347 38.0 36.0 38.0 29.2 38.0 140-144 34.228500000000004 38.0 34.0 38.0 24.8 38.0 145-149 33.64475 38.0 33.6 38.0 21.0 38.0 150-151 28.10625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 3.0 18 2.0 19 1.0 20 1.0 21 3.0 22 5.0 23 10.0 24 13.0 25 15.0 26 16.0 27 16.0 28 31.0 29 49.0 30 43.0 31 66.0 32 84.0 33 113.0 34 144.0 35 219.0 36 615.0 37 2542.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.225 17.675 15.425 31.674999999999997 2 20.849999999999998 23.95 37.0 18.2 3 17.775 29.925 27.925 24.375 4 19.875 36.35 24.2 19.575 5 20.200000000000003 36.15 24.775 18.875 6 16.675 35.949999999999996 26.625 20.75 7 13.525 19.6 46.650000000000006 20.225 8 17.95 22.375 29.225 30.45 9 17.026619789050727 22.92817679558011 32.069311903566046 27.975891511803113 10-14 19.22192219221922 30.9030903090309 26.62766276627663 23.24732473247325 15-19 18.825 29.509999999999998 28.294999999999998 23.369999999999997 20-24 19.685 29.110000000000003 27.845 23.36 25-29 18.9 29.32 28.625 23.155 30-34 19.689999999999998 29.39 27.82 23.1 35-39 19.189999999999998 29.9 27.61 23.3 40-44 19.335 29.485 28.005000000000003 23.175 45-49 19.705000000000002 29.360000000000003 27.35 23.585 50-54 19.355 29.360000000000003 27.82 23.465 55-59 19.585 28.82 28.075 23.52 60-64 18.695 29.775000000000002 27.700000000000003 23.830000000000002 65-69 19.89 29.025000000000002 27.595 23.49 70-74 19.88 28.95 27.839999999999996 23.330000000000002 75-79 19.545 29.18 27.43 23.845 80-84 19.79 28.804999999999996 28.000000000000004 23.405 85-89 19.885 29.04 27.71 23.365 90-94 20.200000000000003 29.354999999999997 27.345000000000002 23.1 95-99 19.97 28.605000000000004 27.744999999999997 23.68 100-104 20.544999999999998 28.16 27.189999999999998 24.104999999999997 105-109 19.90599529976499 28.911445572278616 27.366368318415923 23.816190809540476 110-114 20.83896480953096 29.073434449617057 27.47159233118086 22.61600840967112 115-119 20.625 28.410000000000004 27.455000000000002 23.51 120-124 20.361198659262595 28.445645104807642 27.780279153534444 23.412877082395315 125-129 20.489587505006007 28.15879054865839 27.51802162595114 23.833600320384463 130-134 20.805 28.425 27.1 23.669999999999998 135-139 20.895 28.38 27.11 23.615 140-144 20.794999999999998 28.175 27.229999999999997 23.799999999999997 145-149 21.015 28.49 26.735 23.76 150-151 21.025 27.6875 27.1375 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 3.0 22 2.5 23 2.0 24 2.0 25 2.5 26 6.0 27 11.5 28 13.5 29 15.5 30 22.5 31 34.5 32 52.5 33 69.0 34 85.0 35 101.5 36 122.0 37 148.5 38 167.0 39 190.5 40 215.0 41 226.0 42 242.5 43 255.5 44 246.5 45 234.5 46 234.5 47 224.5 48 198.0 49 166.0 50 147.5 51 131.5 52 102.5 53 77.0 54 60.5 55 48.0 56 33.5 57 24.0 58 19.0 59 12.0 60 9.5 61 7.0 62 7.5 63 7.5 64 2.0 65 0.5 66 0.5 67 2.5 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.44999999999999996 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.11499999999999999 115-119 0.0 120-124 0.055 125-129 0.12 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2422328870927 98.225 2 0.5809547865622632 1.15 3 0.1262945188178833 0.375 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.15 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCATT 10 0.006830828 145.0 2 CCCTGTC 10 0.006830828 145.0 7 >>END_MODULE SRR7172128 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86 33.0 33.0 34.0 32.0 34.0 2 32.9725 34.0 33.0 34.0 32.0 34.0 3 33.01225 34.0 33.0 34.0 32.0 34.0 4 32.99825 34.0 33.0 34.0 32.0 34.0 5 32.993 34.0 33.0 34.0 32.0 34.0 6 37.01475 38.0 38.0 38.0 37.0 38.0 7 37.08525 38.0 38.0 38.0 37.0 38.0 8 37.0385 38.0 38.0 38.0 37.0 38.0 9 37.0265 38.0 38.0 38.0 37.0 38.0 10-14 37.0038 38.0 38.0 38.0 37.0 38.0 15-19 36.9688 38.0 38.0 38.0 36.8 38.0 20-24 36.8941 38.0 38.0 38.0 36.4 38.0 25-29 36.871449999999996 38.0 38.0 38.0 36.6 38.0 30-34 36.879650000000005 38.0 38.0 38.0 36.6 38.0 35-39 36.7858 38.0 38.0 38.0 36.0 38.0 40-44 36.756150000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.724599999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.7923 38.0 38.0 38.0 36.2 38.0 55-59 36.718399999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.65585 38.0 38.0 38.0 36.0 38.0 65-69 36.581100000000006 38.0 38.0 38.0 35.2 38.0 70-74 36.54755 38.0 38.0 38.0 35.2 38.0 75-79 36.51685 38.0 38.0 38.0 35.2 38.0 80-84 36.4625 38.0 38.0 38.0 34.8 38.0 85-89 36.36435 38.0 38.0 38.0 34.2 38.0 90-94 36.1476 38.0 38.0 38.0 33.8 38.0 95-99 35.916399999999996 38.0 38.0 38.0 33.0 38.0 100-104 35.9718 38.0 38.0 38.0 33.4 38.0 105-109 35.87785 38.0 38.0 38.0 33.4 38.0 110-114 35.6974 38.0 37.8 38.0 31.8 38.0 115-119 35.6274 38.0 37.4 38.0 31.8 38.0 120-124 35.251850000000005 38.0 37.0 38.0 29.6 38.0 125-129 34.939699999999995 38.0 36.2 38.0 28.2 38.0 130-134 34.70275 38.0 36.0 38.0 27.2 38.0 135-139 34.2219 38.0 35.8 38.0 24.2 38.0 140-144 33.42815 38.0 33.6 38.0 18.8 38.0 145-149 32.7505 38.0 33.0 38.0 10.8 38.0 150-151 27.725250000000003 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 8.0 4 4.0 5 1.0 6 1.0 7 2.0 8 5.0 9 3.0 10 4.0 11 0.0 12 4.0 13 2.0 14 1.0 15 4.0 16 5.0 17 3.0 18 7.0 19 9.0 20 6.0 21 5.0 22 13.0 23 19.0 24 17.0 25 19.0 26 23.0 27 29.0 28 29.0 29 35.0 30 40.0 31 72.0 32 70.0 33 116.0 34 153.0 35 198.0 36 497.0 37 2586.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.84856070087609 16.670838548185234 17.07133917396746 27.40926157697122 2 25.93148287071768 21.48037009252313 34.15853963490873 18.42960740185046 3 21.50537634408602 26.206551637909474 31.38284571142786 20.905226306576644 4 24.55613903475869 34.733683420855215 21.005251312828207 19.70492623155789 5 23.50587646911728 37.259314828707176 21.305326331582897 17.92948237059265 6 19.829957489372344 36.25906476619154 23.95598899724931 19.954988747186796 7 17.27931982995749 16.579144786196547 43.3858464616154 22.755688922230558 8 20.655163790947736 23.15578894723681 26.581645411352838 29.607401850462615 9 22.425 25.674999999999997 27.200000000000003 24.7 10-14 23.20464092818564 28.570714142828567 26.555311062212443 21.669333866773353 15-19 23.465866466616657 27.9869967491873 27.901975493873472 20.64516129032258 20-24 23.801190059502975 28.006400320016 27.49137456872844 20.701035051752587 25-29 23.465 28.165000000000003 27.894999999999996 20.474999999999998 30-34 23.185 27.744999999999997 28.299999999999997 20.77 35-39 23.635 27.884999999999998 27.715 20.765 40-44 23.49 28.15 27.775 20.585 45-49 23.380000000000003 28.615000000000002 27.425 20.580000000000002 50-54 22.965 28.395 27.845 20.794999999999998 55-59 23.625 27.994999999999997 27.779999999999998 20.599999999999998 60-64 23.895 28.09 28.134999999999998 19.88 65-69 24.279999999999998 28.055000000000003 27.37 20.294999999999998 70-74 23.305 28.050000000000004 28.57 20.075000000000003 75-79 23.89 28.01 27.99 20.11 80-84 24.12 28.095 27.67 20.115 85-89 23.794999999999998 27.3 28.53 20.375 90-94 23.494999999999997 28.105000000000004 28.51 19.89 95-99 23.72 28.505000000000003 27.82 19.955000000000002 100-104 23.44 28.299999999999997 28.535 19.725 105-109 24.315 27.815 27.725 20.145 110-114 24.185000000000002 28.01 28.15 19.655 115-119 24.224999999999998 27.76 28.499999999999996 19.515 120-124 24.185000000000002 28.285 27.67 19.86 125-129 24.67 27.6 28.115000000000002 19.615 130-134 24.035 28.355000000000004 28.060000000000002 19.55 135-139 24.36 28.285 28.01 19.345000000000002 140-144 25.119999999999997 27.87 27.865000000000002 19.145 145-149 25.124999999999996 27.57 27.555000000000003 19.75 150-151 25.687500000000004 27.875 27.9375 18.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 2.0 24 3.5 25 2.0 26 3.0 27 5.0 28 6.0 29 11.0 30 12.5 31 16.5 32 26.0 33 35.0 34 43.0 35 64.5 36 89.5 37 115.5 38 140.5 39 158.5 40 188.5 41 216.0 42 247.5 43 277.0 44 277.0 45 269.5 46 280.5 47 262.0 48 221.5 49 206.0 50 174.0 51 134.0 52 116.5 53 92.0 54 68.5 55 60.5 56 41.5 57 26.5 58 28.0 59 22.0 60 16.5 61 13.0 62 6.5 63 5.0 64 4.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.0 10-14 0.02 15-19 0.025 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80982527222082 97.55 2 1.1142061281337048 2.1999999999999997 3 0.05064573309698658 0.15 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.7875 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAAC 10 0.006830828 145.0 1 >>END_MODULE Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798017 spots for SRR7172128.sra Written 798017 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra Read 798004 spots for SRR7172128.sra Written 798004 spots for SRR7172128.sra SRR ids: ['SRR7172128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_efo5bhhb SRR7172128.sra spots: 15960093 blocks: [[1, 798004], [798005, 1596008], [1596009, 2394012], [2394013, 3192016], [3192017, 3990020], [3990021, 4788024], [4788025, 5586028], [5586029, 6384032], [6384033, 7182036], [7182037, 7980040], [7980041, 8778044], [8778045, 9576048], [9576049, 10374052], [10374053, 11172056], [11172057, 11970060], [11970061, 12768064], [12768065, 13566068], [13566069, 14364072], [14364073, 15162076], [15162077, 15960093]] SRR7172128 file size 5386651 SRR7172128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172128 SRR7172128_1.fastq SRR7172128_2.fastq Input file: SRR7172128_1.fastq Paired file: SRR7172128_2.fastq trimmed: SRR7172128-trimmed-pair1.fastq, SRR7172128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:32:42 2025 >> started Fri Feb 14 06:33:03 2025 >> done (20.343s) 15960093 read pairs processed; of these: 20648 ( 0.13%) short read pairs filtered out after trimming by size control 14097 ( 0.09%) empty read pairs filtered out after trimming by size control 15925348 (99.78%) read pairs available; of these: 9153631 (57.48%) trimmed read pairs available after processing 6771717 (42.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 11 0.00% 22 7 0.00% 23 5 0.00% 24 11 0.00% 25 12 0.00% 26 22 0.00% 27 17 0.00% 28 9 0.00% 29 13 0.00% 30 18 0.00% 31 19 0.00% 32 11 0.00% 33 7 0.00% 34 14 0.00% 35 27 0.00% 36 11 0.00% 37 8 0.00% 38 14 0.00% 39 18 0.00% 40 10 0.00% 41 22 0.00% 42 15 0.00% 43 20 0.00% 44 21 0.00% 45 19 0.00% 46 25 0.00% 47 28 0.00% 48 32 0.00% 49 26 0.00% 50 44 0.00% 51 48 0.00% 52 47 0.00% 53 47 0.00% 54 56 0.00% 55 68 0.00% 56 70 0.00% 57 105 0.00% 58 191 0.00% 59 314 0.00% 60 226 0.00% 61 180 0.00% 62 168 0.00% 63 172 0.00% 64 209 0.00% 65 216 0.00% 66 245 0.00% 67 264 0.00% 68 282 0.00% 69 306 0.00% 70 411 0.00% 71 463 0.00% 72 469 0.00% 73 583 0.00% 74 718 0.00% 75 822 0.01% 76 990 0.01% 77 1112 0.01% 78 1271 0.01% 79 1510 0.01% 80 1655 0.01% 81 1719 0.01% 82 2158 0.01% 83 3348 0.02% 84 5132 0.03% 85 5818 0.04% 86 6130 0.04% 87 6788 0.04% 88 6960 0.04% 89 6668 0.04% 90 6685 0.04% 91 7031 0.04% 92 7155 0.04% 93 7553 0.05% 94 8183 0.05% 95 8728 0.05% 96 9092 0.06% 97 9781 0.06% 98 10200 0.06% 99 11450 0.07% 100 12434 0.08% 101 13109 0.08% 102 13758 0.09% 103 14576 0.09% 104 15310 0.10% 105 16536 0.10% 106 17201 0.11% 107 18126 0.11% 108 19322 0.12% 109 20302 0.13% 110 20967 0.13% 111 22169 0.14% 112 23494 0.15% 113 24991 0.16% 114 26429 0.17% 115 27387 0.17% 116 29072 0.18% 117 30036 0.19% 118 31848 0.20% 119 33515 0.21% 120 34495 0.22% 121 36743 0.23% 122 37723 0.24% 123 39778 0.25% 124 42455 0.27% 125 44675 0.28% 126 46930 0.29% 127 48980 0.31% 128 51491 0.32% 129 53331 0.33% 130 55652 0.35% 131 57709 0.36% 132 61179 0.38% 133 64293 0.40% 134 67877 0.43% 135 72332 0.45% 136 76133 0.48% 137 79373 0.50% 138 84714 0.53% 139 91950 0.58% 140 101962 0.64% 141 109599 0.69% 142 123302 0.77% 143 140587 0.88% 144 164617 1.03% 145 191281 1.20% 146 246631 1.55% 147 337387 2.12% 148 491499 3.09% 149 986287 6.19% 150 4537764 28.49% 151 6771717 42.52% 15925348 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=24 prefix-density=0.83 prefix-fanout=1.7 sequence=TTCTCAGCACCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=126.55 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.2 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=4.73 fanout-score-rank=16 prefix-density=0.60 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=31.64 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=1.4 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCAGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7172128 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:33:57 Started mapping on | Feb 14 06:33:58 Finished on | Feb 14 06:38:17 Mapping speed, Million of reads per hour | 221.36 Number of input reads | 15925348 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13949475 Uniquely mapped reads % | 87.59% Average mapped length | 293.03 Number of splices: Total | 12321781 Number of splices: Annotated (sjdb) | 12042206 Number of splices: GT/AG | 12110844 Number of splices: GC/AG | 156730 Number of splices: AT/AC | 11155 Number of splices: Non-canonical | 43052 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.05% Deletion average length | 2.25 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412813 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 77726 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.13% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1586780 1586780 1586780 N_multimapping 412813 412813 412813 N_noFeature 413387 13780760 478563 N_ambiguous 173356 847 69365 UnstrandedReadsAssigned:13362732 PositiveStrandReadsAssigned:167868 NegativeStrandReadsAssigned:13401547 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172128-trimmed-pair1.fastq SRR7172128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,925,348 reads, 13,317,258 reads pseudoaligned [quant] estimated average fragment length: 236.473 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7172128.ke.tsv 34699 SRR7172128.se.tsv 87100 total ==> SRR7172128.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.53 1117 37.9965 Potri.005G024800.1.v4.1 1035 799.527 493 37.3887 Potri.004G059700.1.v4.1 961 725.537 18 1.50432 Potri.007G009000.2.v4.1 1416 1180.53 0 0 Potri.003G141000.2.v4.1 2943 2707.53 399 8.93566 Potri.016G087400.1.v4.1 270 80.2334 983 742.891 Potri.015G069301.1.v4.1 564 331.579 0 0 Potri.010G195200.1.v4.1 1773 1537.53 547 21.572 Potri.012G127500.1.v4.1 977 741.537 17433 1425.5 ==> SRR7172128.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 786 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 467 Potri.001G452600.v4.1 647 SRR7172128 completed mapping pipeline successfully