Starting /dee2/code/volunteer_pipeline.sh SRR7172129 current disk space = 3085111693312 free memory = 1484510504 SRR7172129 SRAfilesize 80bcd88c27a1e6c01fe776925f97388b SRR7172129.sra SRR7172129.sra file validated SRR7172129 is paired end SRR7172129 is conventional basespace SRR7172129 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172129_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59175 33.0 33.0 33.0 32.0 34.0 2 32.774 33.0 33.0 34.0 31.0 34.0 3 31.7935 33.0 31.0 33.0 29.0 34.0 4 32.2225 33.0 32.0 33.0 31.0 34.0 5 32.4695 33.0 33.0 33.0 32.0 34.0 6 36.66725 38.0 37.0 38.0 34.0 38.0 7 37.15325 38.0 38.0 38.0 36.0 38.0 8 37.2615 38.0 38.0 38.0 36.0 38.0 9 37.412 38.0 38.0 38.0 37.0 38.0 10-14 37.449749999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.44515 38.0 38.0 38.0 37.2 38.0 20-24 37.41225 38.0 38.0 38.0 37.4 38.0 25-29 37.328199999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.0543 38.0 38.0 38.0 36.0 38.0 35-39 36.866249999999994 38.0 38.0 38.0 35.4 38.0 40-44 36.9916 38.0 38.0 38.0 36.0 38.0 45-49 37.0792 38.0 38.0 38.0 36.2 38.0 50-54 37.19474999999999 38.0 38.0 38.0 36.6 38.0 55-59 37.252700000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.2586 38.0 38.0 38.0 36.8 38.0 65-69 37.2277 38.0 38.0 38.0 36.8 38.0 70-74 37.13475 38.0 38.0 38.0 36.0 38.0 75-79 36.967600000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.72935 38.0 38.0 38.0 34.6 38.0 85-89 36.6485 38.0 38.0 38.0 34.6 38.0 90-94 36.45695 38.0 38.0 38.0 34.2 38.0 95-99 36.49905 38.0 38.0 38.0 34.0 38.0 100-104 36.45525 38.0 38.0 38.0 34.0 38.0 105-109 36.4928 38.0 38.0 38.0 34.0 38.0 110-114 36.3104 38.0 37.8 38.0 34.0 38.0 115-119 36.1092 38.0 37.0 38.0 33.6 38.0 120-124 35.90815 38.0 37.0 38.0 32.2 38.0 125-129 35.517399999999995 38.0 36.6 38.0 31.0 38.0 130-134 35.2264 38.0 36.0 38.0 30.6 38.0 135-139 34.9072 38.0 35.6 38.0 29.4 38.0 140-144 34.0917 38.0 34.2 38.0 24.4 38.0 145-149 33.36835000000001 38.0 33.0 38.0 19.6 38.0 150-151 28.771250000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 2.0 16 2.0 17 3.0 18 1.0 19 2.0 20 5.0 21 1.0 22 4.0 23 8.0 24 11.0 25 14.0 26 16.0 27 27.0 28 27.0 29 41.0 30 49.0 31 56.0 32 83.0 33 101.0 34 174.0 35 287.0 36 628.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.225 16.05 14.549999999999999 37.175000000000004 2 20.210105052526263 24.637318659329665 38.26913456728364 16.883441720860432 3 17.525 30.725 25.974999999999998 25.775 4 20.025000000000002 38.2 21.25 20.525 5 20.0 38.875 24.075 17.05 6 15.9 37.55 26.025 20.525 7 12.125 19.7 46.575 21.6 8 17.974999999999998 21.95 28.15 31.924999999999997 9 18.3 21.825 30.95 28.925 10-14 19.578705093565496 29.485639947963577 26.64365055538877 24.292004403082156 15-19 19.775988799439972 28.88144407220361 28.086404320216012 23.256162808140406 20-24 19.48 28.89 28.294999999999998 23.335 25-29 19.325 29.25 28.26 23.165 30-34 19.73 28.985 28.12 23.165 35-39 19.869999999999997 28.92 28.105000000000004 23.105 40-44 19.470000000000002 29.945 27.465 23.119999999999997 45-49 19.785989299464973 29.106455322766138 27.87139356967848 23.236161808090404 50-54 19.765 28.9 27.975 23.36 55-59 19.765 29.275000000000002 27.644999999999996 23.315 60-64 19.88 29.549999999999997 27.615000000000002 22.955000000000002 65-69 19.825 28.83 28.215 23.13 70-74 19.869999999999997 29.38 27.24 23.51 75-79 20.055 28.689999999999998 27.744999999999997 23.51 80-84 19.655 29.48 27.375 23.49 85-89 19.79 28.895 28.075 23.24 90-94 20.397039703970396 28.61286128612861 27.402740274027405 23.587358735873586 95-99 19.955000000000002 28.845 28.005000000000003 23.195 100-104 19.585 28.835 28.165000000000003 23.415 105-109 20.05 29.235 27.48 23.235 110-114 19.997999699954995 28.769315397309597 27.56413462019303 23.66855028254238 115-119 20.81728605011754 28.459960986345223 27.314560096033613 23.408192867503626 120-124 20.23404680936187 28.445689137827568 27.30546109221844 24.014802960592117 125-129 20.370555833750625 28.002003004506758 27.971957936905355 23.655483224837255 130-134 20.54 28.575 28.060000000000002 22.825 135-139 20.71 27.99 27.450000000000003 23.849999999999998 140-144 20.82 28.244999999999997 27.255000000000003 23.68 145-149 20.5 28.67 26.900000000000002 23.93 150-151 20.7625 27.950000000000003 27.6375 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 2.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 4.0 25 7.0 26 4.5 27 5.5 28 12.0 29 16.5 30 24.0 31 36.5 32 45.0 33 58.0 34 74.0 35 86.5 36 103.5 37 121.5 38 141.0 39 185.0 40 217.0 41 237.0 42 255.5 43 265.0 44 281.5 45 287.5 46 271.5 47 242.5 48 209.0 49 175.0 50 149.5 51 113.0 52 82.5 53 69.0 54 49.0 55 33.5 56 36.0 57 30.0 58 16.0 59 14.0 60 10.5 61 5.5 62 4.0 63 2.5 64 2.5 65 2.5 66 2.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.06999999999999999 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.015 115-119 0.034999999999999996 120-124 0.02 125-129 0.15 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.5999999999999996 0.0 0.0 0.0 0.0 126-127 2.7750000000000004 0.0 0.0 0.0 0.0 128-129 3.1500000000000004 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.825 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172129 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172129_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.813 33.0 33.0 34.0 32.0 34.0 2 33.023 34.0 33.0 34.0 32.0 34.0 3 33.04775 34.0 33.0 34.0 32.0 34.0 4 33.03875 34.0 33.0 34.0 32.0 34.0 5 33.01275 34.0 33.0 34.0 32.0 34.0 6 37.1325 38.0 38.0 38.0 37.0 38.0 7 37.29625 38.0 38.0 38.0 37.0 38.0 8 37.29975 38.0 38.0 38.0 37.0 38.0 9 37.29425 38.0 38.0 38.0 37.0 38.0 10-14 37.24425 38.0 38.0 38.0 37.0 38.0 15-19 37.1443 38.0 38.0 38.0 37.0 38.0 20-24 37.0422 38.0 38.0 38.0 36.6 38.0 25-29 37.07625 38.0 38.0 38.0 36.8 38.0 30-34 37.11135 38.0 38.0 38.0 36.8 38.0 35-39 36.97395 38.0 38.0 38.0 36.2 38.0 40-44 36.9878 38.0 38.0 38.0 36.2 38.0 45-49 37.02905 38.0 38.0 38.0 36.4 38.0 50-54 37.02225 38.0 38.0 38.0 36.2 38.0 55-59 37.00695 38.0 38.0 38.0 36.0 38.0 60-64 36.9354 38.0 38.0 38.0 36.0 38.0 65-69 36.88315 38.0 38.0 38.0 36.0 38.0 70-74 36.85424999999999 38.0 38.0 38.0 35.8 38.0 75-79 36.80265 38.0 38.0 38.0 35.6 38.0 80-84 36.646100000000004 38.0 38.0 38.0 35.2 38.0 85-89 36.42905 38.0 38.0 38.0 34.2 38.0 90-94 36.32765 38.0 38.0 38.0 34.0 38.0 95-99 36.183499999999995 38.0 38.0 38.0 33.8 38.0 100-104 36.054199999999994 38.0 37.6 38.0 33.0 38.0 105-109 36.037699999999994 38.0 37.4 38.0 33.0 38.0 110-114 35.9792 38.0 37.4 38.0 33.0 38.0 115-119 35.8219 38.0 37.2 38.0 32.2 38.0 120-124 35.511199999999995 38.0 36.6 38.0 30.6 38.0 125-129 35.238800000000005 38.0 36.4 38.0 31.0 38.0 130-134 34.9724 38.0 36.0 38.0 29.0 38.0 135-139 34.36365000000001 38.0 35.2 38.0 26.4 38.0 140-144 33.888 38.0 34.2 38.0 23.4 38.0 145-149 32.987 38.0 33.2 38.0 16.0 38.0 150-151 27.42725 33.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 4.0 12 1.0 13 2.0 14 4.0 15 3.0 16 2.0 17 4.0 18 1.0 19 2.0 20 5.0 21 7.0 22 8.0 23 9.0 24 11.0 25 18.0 26 19.0 27 29.0 28 32.0 29 39.0 30 62.0 31 78.0 32 69.0 33 100.0 34 152.0 35 256.0 36 630.0 37 2441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.852278417626444 14.146219328993489 17.175763645468205 33.82573860791187 2 22.116587440580435 23.167375531648737 37.32799599699775 17.38804103077308 3 19.05952976488244 26.76338169084542 31.41570785392696 22.761380690345174 4 23.08654327163582 36.19309654827414 20.735367683841922 19.984992496248125 5 23.06153076538269 37.51875937968984 21.53576788394197 17.883941970985493 6 16.75 38.5 25.424999999999997 19.325 7 17.10855427713857 14.582291145572787 45.872936468234116 22.436218109054526 8 20.175 21.2 28.549999999999997 30.075000000000003 9 22.05 22.15 29.975 25.825 10-14 23.569427771108444 27.921168467386952 26.970788315326132 21.538615446178472 15-19 22.559663781457946 27.637964677040078 28.45349477160154 21.348876769900436 20-24 22.80456091218244 27.89057811562313 28.52070414082817 20.784156831366275 25-29 22.66 28.15 28.285 20.905 30-34 22.875 27.860000000000003 28.449999999999996 20.815 35-39 23.119999999999997 27.76 28.249999999999996 20.87 40-44 23.544999999999998 27.925 28.29 20.24 45-49 23.380000000000003 27.939999999999998 27.825 20.855 50-54 22.985 28.155 28.199999999999996 20.66 55-59 23.39 28.084999999999997 28.23 20.294999999999998 60-64 23.175 28.715000000000003 27.400000000000002 20.71 65-69 23.165 28.175 27.634999999999998 21.025 70-74 23.565 28.565 27.605 20.265 75-79 23.426171308565426 28.686434321716085 27.84639231961598 20.041002050102506 80-84 23.415 29.035 27.1 20.45 85-89 23.9 28.655 27.51 19.935 90-94 23.35 28.235 28.32 20.095 95-99 23.567356735673567 28.277827782778274 27.887788778877887 20.267026702670268 100-104 22.945 28.720000000000002 28.144999999999996 20.19 105-109 23.755000000000003 27.589999999999996 28.689999999999998 19.965 110-114 22.605 28.720000000000002 28.63 20.044999999999998 115-119 24.29 27.61 28.38 19.72 120-124 24.085 27.644999999999996 28.38 19.89 125-129 23.330000000000002 28.110000000000003 28.73 19.830000000000002 130-134 24.01 28.015 27.91 20.064999999999998 135-139 23.71 28.110000000000003 28.285 19.895 140-144 24.16 27.565 28.139999999999997 20.135 145-149 24.665 27.715 27.77 19.85 150-151 25.374999999999996 27.3625 27.8625 19.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 1.0 26 2.5 27 5.0 28 7.0 29 12.0 30 16.0 31 25.0 32 31.5 33 39.5 34 57.0 35 66.0 36 78.0 37 105.5 38 139.5 39 165.0 40 201.5 41 228.0 42 248.0 43 280.0 44 300.0 45 293.5 46 277.5 47 256.0 48 222.0 49 199.5 50 167.0 51 129.0 52 102.0 53 80.0 54 61.5 55 45.5 56 36.0 57 29.5 58 25.0 59 18.5 60 13.5 61 11.0 62 5.5 63 4.5 64 3.0 65 1.0 66 0.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.075 3 0.05 4 0.05 5 0.05 6 0.0 7 0.05 8 0.0 9 0.0 10-14 0.04 15-19 0.065 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 3.075 0.0 0.0 0.0 0.0 130-131 3.4125 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAAAT 10 0.006830828 145.0 9 AGCTGGA 10 0.006830828 145.0 4 >>END_MODULE Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756156 spots for SRR7172129.sra Written 756156 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra Read 756152 spots for SRR7172129.sra Written 756152 spots for SRR7172129.sra SRR ids: ['SRR7172129.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pzstnn8j SRR7172129.sra spots: 15123044 blocks: [[1, 756152], [756153, 1512304], [1512305, 2268456], [2268457, 3024608], [3024609, 3780760], [3780761, 4536912], [4536913, 5293064], [5293065, 6049216], [6049217, 6805368], [6805369, 7561520], [7561521, 8317672], [8317673, 9073824], [9073825, 9829976], [9829977, 10586128], [10586129, 11342280], [11342281, 12098432], [12098433, 12854584], [12854585, 13610736], [13610737, 14366888], [14366889, 15123044]] SRR7172129 file size 5103003 SRR7172129 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172129 SRR7172129_1.fastq SRR7172129_2.fastq Input file: SRR7172129_1.fastq Paired file: SRR7172129_2.fastq trimmed: SRR7172129-trimmed-pair1.fastq, SRR7172129-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:45:16 2025 >> started Fri Feb 14 06:45:33 2025 >> done (17.088s) 15123044 read pairs processed; of these: 9376 ( 0.06%) short read pairs filtered out after trimming by size control 9389 ( 0.06%) empty read pairs filtered out after trimming by size control 15104279 (99.88%) read pairs available; of these: 8662365 (57.35%) trimmed read pairs available after processing 6441914 (42.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 6 0.00% 24 4 0.00% 25 5 0.00% 26 2 0.00% 27 6 0.00% 28 7 0.00% 29 1 0.00% 30 5 0.00% 31 2 0.00% 32 5 0.00% 33 6 0.00% 34 9 0.00% 35 8 0.00% 36 11 0.00% 37 4 0.00% 38 4 0.00% 39 5 0.00% 40 5 0.00% 41 8 0.00% 42 7 0.00% 43 10 0.00% 44 8 0.00% 45 12 0.00% 46 10 0.00% 47 18 0.00% 48 13 0.00% 49 14 0.00% 50 12 0.00% 51 21 0.00% 52 22 0.00% 53 13 0.00% 54 21 0.00% 55 37 0.00% 56 78 0.00% 57 424 0.00% 58 226 0.00% 59 197 0.00% 60 158 0.00% 61 85 0.00% 62 127 0.00% 63 131 0.00% 64 126 0.00% 65 140 0.00% 66 164 0.00% 67 236 0.00% 68 246 0.00% 69 266 0.00% 70 265 0.00% 71 297 0.00% 72 358 0.00% 73 467 0.00% 74 484 0.00% 75 582 0.00% 76 681 0.00% 77 997 0.01% 78 1423 0.01% 79 1099 0.01% 80 1233 0.01% 81 1320 0.01% 82 1426 0.01% 83 2021 0.01% 84 3853 0.03% 85 3909 0.03% 86 3754 0.02% 87 3546 0.02% 88 3641 0.02% 89 3915 0.03% 90 4141 0.03% 91 4427 0.03% 92 4807 0.03% 93 5455 0.04% 94 5927 0.04% 95 6349 0.04% 96 7107 0.05% 97 7915 0.05% 98 8341 0.06% 99 8720 0.06% 100 9223 0.06% 101 10332 0.07% 102 10811 0.07% 103 11309 0.07% 104 12280 0.08% 105 13237 0.09% 106 13949 0.09% 107 14789 0.10% 108 15567 0.10% 109 16508 0.11% 110 17421 0.12% 111 18184 0.12% 112 19531 0.13% 113 20949 0.14% 114 21651 0.14% 115 23432 0.16% 116 24642 0.16% 117 25665 0.17% 118 27465 0.18% 119 28740 0.19% 120 29823 0.20% 121 31651 0.21% 122 33467 0.22% 123 35495 0.23% 124 37542 0.25% 125 39221 0.26% 126 41639 0.28% 127 43832 0.29% 128 45561 0.30% 129 48511 0.32% 130 50683 0.34% 131 52667 0.35% 132 55791 0.37% 133 59309 0.39% 134 62841 0.42% 135 66579 0.44% 136 71703 0.47% 137 76837 0.51% 138 82459 0.55% 139 90261 0.60% 140 99134 0.66% 141 109063 0.72% 142 123226 0.82% 143 138405 0.92% 144 162815 1.08% 145 197905 1.31% 146 248312 1.64% 147 332920 2.20% 148 499023 3.30% 149 965946 6.40% 150 4272666 28.29% 151 6441914 42.65% 15104279 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=23 prefix-density=0.35 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=25.81 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.4 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=19 prefix-density=0.43 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=28.30 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.6 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172129 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:46:19 Started mapping on | Feb 14 06:46:20 Finished on | Feb 14 06:48:32 Mapping speed, Million of reads per hour | 411.93 Number of input reads | 15104279 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14030505 Uniquely mapped reads % | 92.89% Average mapped length | 293.91 Number of splices: Total | 13593334 Number of splices: Annotated (sjdb) | 13351904 Number of splices: GT/AG | 13370692 Number of splices: GC/AG | 173811 Number of splices: AT/AC | 9845 Number of splices: Non-canonical | 38986 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414428 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 43770 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 669909 669909 669909 N_multimapping 414428 414428 414428 N_noFeature 423511 13878738 502578 N_ambiguous 142032 892 68829 UnstrandedReadsAssigned:13464962 PositiveStrandReadsAssigned:150875 NegativeStrandReadsAssigned:13459098 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172129 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172129-trimmed-pair1.fastq SRR7172129-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,104,279 reads, 13,358,718 reads pseudoaligned [quant] estimated average fragment length: 240.539 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7172129.ke.tsv 34699 SRR7172129.se.tsv 87100 total ==> SRR7172129.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.46 1012 40.8705 Potri.005G024800.1.v4.1 1035 795.461 206 18.6004 Potri.004G059700.1.v4.1 961 721.461 22 2.1902 Potri.007G009000.2.v4.1 1416 1176.46 2 0.122103 Potri.003G141000.2.v4.1 2943 2703.46 474 12.5931 Potri.016G087400.1.v4.1 270 79.2538 926 839.199 Potri.015G069301.1.v4.1 564 328.114 0 0 Potri.010G195200.1.v4.1 1773 1533.46 345 16.1592 Potri.012G127500.1.v4.1 977 737.461 8994 875.967 ==> SRR7172129.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 122 SRR7172129 completed mapping pipeline successfully