Starting /dee2/code/volunteer_pipeline.sh SRR7172130 current disk space = 3085094895616 free memory = 1449547772 SRR7172130 SRAfilesize ba8315d491f306de2e78ae95724481f7 SRR7172130.sra SRR7172130.sra file validated SRR7172130 is paired end SRR7172130 is conventional basespace SRR7172130 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.22075 32.0 18.0 33.0 18.0 34.0 2 30.6705 31.0 29.0 33.0 27.0 34.0 3 32.17025 33.0 31.0 33.0 29.0 34.0 4 32.206 33.0 33.0 33.0 31.0 34.0 5 32.8565 33.0 33.0 34.0 32.0 34.0 6 36.99825 38.0 37.0 38.0 35.0 38.0 7 37.30275 38.0 38.0 38.0 36.0 38.0 8 37.54175 38.0 38.0 38.0 37.0 38.0 9 37.56725 38.0 38.0 38.0 38.0 38.0 10-14 37.485350000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.568650000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.598 38.0 38.0 38.0 38.0 38.0 25-29 37.47655 38.0 38.0 38.0 37.8 38.0 30-34 37.4959 38.0 38.0 38.0 37.8 38.0 35-39 37.4006 38.0 38.0 38.0 37.6 38.0 40-44 37.277750000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.3721 38.0 38.0 38.0 37.0 38.0 50-54 37.4165 38.0 38.0 38.0 37.0 38.0 55-59 37.398300000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.3754 38.0 38.0 38.0 37.0 38.0 65-69 37.33885 38.0 38.0 38.0 37.0 38.0 70-74 37.29260000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.22525 38.0 38.0 38.0 36.6 38.0 80-84 37.129450000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.9761 38.0 38.0 38.0 35.8 38.0 90-94 36.926399999999994 38.0 38.0 38.0 35.8 38.0 95-99 36.8351 38.0 38.0 38.0 35.4 38.0 100-104 36.6857 38.0 38.0 38.0 34.6 38.0 105-109 36.714800000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.331649999999996 38.0 38.0 38.0 34.2 38.0 115-119 35.87065 38.0 37.2 38.0 31.4 38.0 120-124 36.25945 38.0 38.0 38.0 34.0 38.0 125-129 35.87795 38.0 37.0 38.0 32.6 38.0 130-134 35.811249999999994 38.0 36.8 38.0 32.4 38.0 135-139 35.548449999999995 38.0 36.2 38.0 31.0 38.0 140-144 35.1136 38.0 36.0 38.0 30.4 38.0 145-149 34.4613 38.0 35.4 38.0 28.8 38.0 150-151 30.274375 35.5 28.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 0.0 17 2.0 18 0.0 19 1.0 20 3.0 21 3.0 22 4.0 23 4.0 24 6.0 25 6.0 26 19.0 27 13.0 28 13.0 29 34.0 30 29.0 31 51.0 32 60.0 33 76.0 34 148.0 35 257.0 36 603.0 37 2661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.4 18.325 15.174999999999999 35.099999999999994 2 19.25 26.224999999999998 34.449999999999996 20.075000000000003 3 17.424999999999997 32.074999999999996 27.625 22.875 4 19.75 36.575 22.900000000000002 20.775 5 19.35 36.7 23.5 20.45 6 16.125 35.85 26.900000000000002 21.125 7 11.899999999999999 20.45 45.824999999999996 21.825 8 17.849999999999998 21.825 27.825 32.5 9 17.25 23.0 31.374999999999996 28.375 10-14 19.396033653846153 30.158253205128204 26.186899038461537 24.258814102564102 15-19 19.295 29.160000000000004 27.915 23.630000000000003 20-24 19.43 28.794999999999998 27.92 23.855 25-29 19.44597229861493 29.02645132256613 27.481374068703435 24.046202310115504 30-34 19.73098654932747 29.166458322916146 27.861393069653484 23.241162058102905 35-39 19.684921230307577 29.24231057764441 27.806951737934483 23.265816454113526 40-44 19.787968195229286 29.14937240586088 28.029204380657095 23.033455018252738 45-49 19.960998049902496 28.98644932246612 27.541377068853446 23.51117555877794 50-54 19.33 28.845 28.125 23.7 55-59 19.81 29.080000000000002 27.339999999999996 23.77 60-64 19.759999999999998 28.96 27.095000000000002 24.185000000000002 65-69 19.689999999999998 28.435 27.68 24.195 70-74 20.45 29.270000000000003 26.945000000000004 23.335 75-79 19.835 28.955 27.85 23.36 80-84 19.55195519551955 28.877887788778878 27.567756775677566 24.002400240024002 85-89 19.720916274882462 29.238771631489445 27.508252475742722 23.532059617885366 90-94 19.86397279455891 28.750750150030008 27.620524104820966 23.76475295059012 95-99 19.695 28.505000000000003 27.785 24.015 100-104 20.121036310893267 28.963689106732023 27.598279483845158 23.31699509852956 105-109 20.03400680136027 28.255651130226045 27.955591118223644 23.754750950190036 110-114 20.030165912518854 28.808446455505276 27.727501256913023 23.433886375062844 115-119 20.253608660785886 28.63372093023256 27.826784282277465 23.28588612670409 120-124 20.19903980796159 28.435687137427486 27.575515103020603 23.789757951590317 125-129 19.922872740021035 28.55211098312215 27.570491310662593 23.95452496619422 130-134 20.15100755037752 28.61143057152858 27.346367318365917 23.891194559727985 135-139 20.835 28.265 26.76 24.14 140-144 20.446133840152044 29.203761128338503 26.748024407322195 23.602080624187256 145-149 20.829373217948078 28.447801510679803 27.392326546946126 23.33049872442599 150-151 20.625 28.6375 26.924999999999997 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 4.5 25 6.0 26 6.0 27 8.0 28 12.5 29 17.0 30 18.5 31 25.0 32 37.0 33 51.5 34 59.0 35 79.5 36 106.5 37 123.0 38 154.5 39 177.0 40 204.5 41 233.5 42 249.0 43 263.0 44 277.0 45 263.0 46 246.0 47 246.0 48 229.0 49 203.5 50 169.0 51 133.5 52 108.0 53 83.5 54 57.5 55 45.0 56 32.0 57 17.5 58 10.5 59 6.5 60 7.0 61 8.0 62 4.5 63 2.0 64 2.0 65 3.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.16 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.025 40-44 0.015 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.03 90-94 0.02 95-99 0.0 100-104 0.03 105-109 0.02 110-114 0.5499999999999999 115-119 0.24 120-124 0.02 125-129 0.165 130-134 0.005 135-139 0.0 140-144 0.03 145-149 0.045 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.1500000000000004 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.7125 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172130 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.029 33.0 33.0 34.0 32.0 34.0 2 33.1055 34.0 33.0 34.0 33.0 34.0 3 33.102 34.0 33.0 34.0 33.0 34.0 4 32.9775 34.0 33.0 34.0 33.0 34.0 5 32.9535 34.0 33.0 34.0 32.0 34.0 6 37.135 38.0 38.0 38.0 37.0 38.0 7 37.0575 38.0 38.0 38.0 37.0 38.0 8 37.0965 38.0 38.0 38.0 37.0 38.0 9 37.13525 38.0 38.0 38.0 37.0 38.0 10-14 37.18985 38.0 38.0 38.0 37.0 38.0 15-19 37.04705 38.0 38.0 38.0 37.0 38.0 20-24 37.0282 38.0 38.0 38.0 37.0 38.0 25-29 37.1026 38.0 38.0 38.0 37.0 38.0 30-34 37.0826 38.0 38.0 38.0 37.0 38.0 35-39 37.068799999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.9427 38.0 38.0 38.0 36.8 38.0 45-49 37.00675 38.0 38.0 38.0 37.0 38.0 50-54 37.00939999999999 38.0 38.0 38.0 37.0 38.0 55-59 36.9248 38.0 38.0 38.0 36.8 38.0 60-64 36.90045 38.0 38.0 38.0 36.2 38.0 65-69 36.8337 38.0 38.0 38.0 36.2 38.0 70-74 36.85845 38.0 38.0 38.0 36.2 38.0 75-79 36.7906 38.0 38.0 38.0 36.0 38.0 80-84 36.719100000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.4533 38.0 38.0 38.0 34.6 38.0 90-94 36.28585 38.0 38.0 38.0 34.0 38.0 95-99 36.267849999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.1868 38.0 38.0 38.0 34.0 38.0 105-109 36.15075 38.0 38.0 38.0 34.0 38.0 110-114 35.89404999999999 38.0 38.0 38.0 33.4 38.0 115-119 35.80715 38.0 38.0 38.0 33.0 38.0 120-124 35.669 38.0 37.8 38.0 32.0 38.0 125-129 35.3411 38.0 37.0 38.0 31.0 38.0 130-134 34.9765 38.0 36.2 38.0 29.6 38.0 135-139 34.51165 38.0 36.0 38.0 27.2 38.0 140-144 34.01835 38.0 35.4 38.0 24.0 38.0 145-149 33.037349999999996 38.0 33.4 38.0 14.0 38.0 150-151 27.57075 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 2.0 5 4.0 6 0.0 7 1.0 8 2.0 9 1.0 10 4.0 11 3.0 12 2.0 13 4.0 14 3.0 15 3.0 16 4.0 17 4.0 18 5.0 19 1.0 20 3.0 21 10.0 22 10.0 23 14.0 24 14.0 25 11.0 26 20.0 27 23.0 28 21.0 29 31.0 30 30.0 31 54.0 32 71.0 33 87.0 34 126.0 35 231.0 36 548.0 37 2636.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.00900225056264 15.003750937734434 18.37959489872468 30.607651912978245 2 25.10627656914228 22.455613903475868 34.68367091772943 17.75443860965241 3 20.80520130032508 25.6064016004001 32.98324581145287 20.605151287821954 4 23.217413059794847 35.27645734300726 21.441080810607957 20.06504878658994 5 24.724724724724727 36.03603603603604 21.12112112112112 18.11811811811812 6 17.748809225369765 38.154926046628226 25.04387064427175 19.05239408373026 7 17.14787848355511 15.842329902083858 45.21717298518704 21.79261862917399 8 20.170383362565772 22.60085191681283 28.71460786770233 28.514156852919072 9 21.954887218045112 24.285714285714285 28.721804511278194 25.03759398496241 10-14 22.786458333333336 28.856169871794872 26.637620192307693 21.719751602564102 15-19 22.580806815334505 28.053119518917562 28.053119518917562 21.312954146830368 20-24 22.615530966805185 28.608621639212938 28.153006558854454 20.622840835127423 25-29 22.694538907781556 28.34066813362672 28.190638127625522 20.774154830966193 30-34 22.830000000000002 28.105000000000004 28.425 20.64 35-39 22.825 28.7 28.29 20.185 40-44 22.939999999999998 28.215 28.255000000000003 20.59 45-49 22.80456091218244 27.920584116823367 28.735747149429887 20.53910782156431 50-54 23.24 27.855 28.235 20.669999999999998 55-59 23.465 27.74 28.225 20.57 60-64 23.35 27.805000000000003 28.46 20.385 65-69 23.674999999999997 27.57 28.305000000000003 20.45 70-74 24.07 27.93 27.560000000000002 20.44 75-79 22.89 28.15 28.975 19.985 80-84 23.34 27.529999999999998 28.645 20.485 85-89 23.71 28.32 27.805000000000003 20.165 90-94 23.25 28.095 28.285 20.369999999999997 95-99 23.1 28.555000000000003 28.67 19.675 100-104 23.79 28.07 27.944999999999997 20.195 105-109 23.674999999999997 27.99 28.26 20.075000000000003 110-114 24.154999999999998 27.689999999999998 28.155 20.0 115-119 23.9 28.110000000000003 28.48 19.509999999999998 120-124 24.62 27.58 28.175 19.625 125-129 24.34 28.205000000000002 27.855 19.6 130-134 24.375 27.275 28.694999999999997 19.655 135-139 24.325 27.474999999999998 28.205000000000002 19.994999999999997 140-144 25.019999999999996 27.889999999999997 27.925 19.165 145-149 24.945 28.134999999999998 27.900000000000002 19.02 150-151 25.374999999999996 27.35 27.2625 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 2.5 25 3.5 26 3.5 27 3.5 28 6.5 29 10.0 30 12.5 31 14.0 32 20.0 33 31.5 34 41.5 35 64.5 36 93.0 37 123.5 38 157.5 39 200.5 40 219.5 41 229.5 42 270.5 43 303.0 44 289.5 45 286.5 46 282.0 47 242.5 48 217.5 49 187.0 50 148.0 51 125.0 52 103.5 53 72.5 54 47.0 55 36.0 56 34.5 57 31.5 58 24.0 59 13.0 60 8.0 61 8.5 62 9.0 63 5.0 64 3.5 65 4.5 66 3.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.075 5 0.1 6 0.27499999999999997 7 0.42500000000000004 8 0.22499999999999998 9 0.25 10-14 0.16 15-19 0.22499999999999998 20-24 0.135 25-29 0.02 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7566204287515763 1.5 3 0.025220680958385876 0.075 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.3250000000000002 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.7750000000000004 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.7125 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTCA 10 0.006830828 145.0 4 >>END_MODULE Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775965 spots for SRR7172130.sra Written 775965 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra Read 775947 spots for SRR7172130.sra Written 775947 spots for SRR7172130.sra SRR ids: ['SRR7172130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m6i4j77z SRR7172130.sra spots: 15518958 blocks: [[1, 775947], [775948, 1551894], [1551895, 2327841], [2327842, 3103788], [3103789, 3879735], [3879736, 4655682], [4655683, 5431629], [5431630, 6207576], [6207577, 6983523], [6983524, 7759470], [7759471, 8535417], [8535418, 9311364], [9311365, 10087311], [10087312, 10863258], [10863259, 11639205], [11639206, 12415152], [12415153, 13191099], [13191100, 13967046], [13967047, 14742993], [14742994, 15518958]] SRR7172130 file size 5237165 SRR7172130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172130 SRR7172130_1.fastq SRR7172130_2.fastq Input file: SRR7172130_1.fastq Paired file: SRR7172130_2.fastq trimmed: SRR7172130-trimmed-pair1.fastq, SRR7172130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:54:10 2025 >> started Fri Feb 14 06:54:37 2025 >> done (27.225s) 15518958 read pairs processed; of these: 11349 ( 0.07%) short read pairs filtered out after trimming by size control 10753 ( 0.07%) empty read pairs filtered out after trimming by size control 15496856 (99.86%) read pairs available; of these: 8034351 (51.85%) trimmed read pairs available after processing 7462505 (48.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 5 0.00% 23 8 0.00% 24 1 0.00% 25 6 0.00% 26 8 0.00% 27 2 0.00% 28 5 0.00% 29 5 0.00% 30 3 0.00% 31 3 0.00% 32 5 0.00% 33 4 0.00% 34 2 0.00% 35 8 0.00% 36 7 0.00% 37 4 0.00% 38 4 0.00% 39 9 0.00% 40 7 0.00% 41 10 0.00% 42 11 0.00% 43 12 0.00% 44 9 0.00% 45 8 0.00% 46 10 0.00% 47 8 0.00% 48 16 0.00% 49 15 0.00% 50 20 0.00% 51 23 0.00% 52 20 0.00% 53 27 0.00% 54 29 0.00% 55 27 0.00% 56 34 0.00% 57 34 0.00% 58 63 0.00% 59 61 0.00% 60 73 0.00% 61 79 0.00% 62 102 0.00% 63 132 0.00% 64 124 0.00% 65 152 0.00% 66 145 0.00% 67 172 0.00% 68 239 0.00% 69 235 0.00% 70 286 0.00% 71 309 0.00% 72 387 0.00% 73 412 0.00% 74 492 0.00% 75 556 0.00% 76 683 0.00% 77 784 0.01% 78 884 0.01% 79 1002 0.01% 80 1173 0.01% 81 1251 0.01% 82 1501 0.01% 83 1857 0.01% 84 2799 0.02% 85 3191 0.02% 86 3577 0.02% 87 3907 0.03% 88 4042 0.03% 89 4295 0.03% 90 4513 0.03% 91 4767 0.03% 92 5121 0.03% 93 5612 0.04% 94 5980 0.04% 95 6258 0.04% 96 6842 0.04% 97 7201 0.05% 98 7676 0.05% 99 8275 0.05% 100 9094 0.06% 101 9744 0.06% 102 10425 0.07% 103 10964 0.07% 104 11652 0.08% 105 12464 0.08% 106 13375 0.09% 107 13818 0.09% 108 14251 0.09% 109 15046 0.10% 110 15958 0.10% 111 16859 0.11% 112 17508 0.11% 113 18571 0.12% 114 19321 0.12% 115 20322 0.13% 116 21692 0.14% 117 22493 0.15% 118 23421 0.15% 119 24353 0.16% 120 25158 0.16% 121 26719 0.17% 122 27690 0.18% 123 29801 0.19% 124 30578 0.20% 125 32523 0.21% 126 33737 0.22% 127 35523 0.23% 128 37337 0.24% 129 39690 0.26% 130 41410 0.27% 131 43575 0.28% 132 46567 0.30% 133 49972 0.32% 134 53091 0.34% 135 57840 0.37% 136 63491 0.41% 137 65590 0.42% 138 70594 0.46% 139 76363 0.49% 140 81745 0.53% 141 88978 0.57% 142 97999 0.63% 143 111275 0.72% 144 130178 0.84% 145 153207 0.99% 146 192624 1.24% 147 265173 1.71% 148 406033 2.62% 149 815824 5.26% 150 4385111 28.30% 151 7462505 48.15% 15496856 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=23 prefix-density=0.72 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=18.81 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=TTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=19 prefix-density=0.73 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=48.76 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=7.5 sequence=GAAGATGTTAGGCTGGGAGCTAACAGGTTCAATGAGAGGCAGCCAATTGGCACGGCAGCTCA SRR7172130 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:55:26 Started mapping on | Feb 14 06:55:27 Finished on | Feb 14 06:57:38 Mapping speed, Million of reads per hour | 425.87 Number of input reads | 15496856 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14542580 Uniquely mapped reads % | 93.84% Average mapped length | 294.94 Number of splices: Total | 14199418 Number of splices: Annotated (sjdb) | 13933562 Number of splices: GT/AG | 13976265 Number of splices: GC/AG | 175655 Number of splices: AT/AC | 9910 Number of splices: Non-canonical | 37588 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394981 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 35804 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 572815 572815 572815 N_multimapping 394981 394981 394981 N_noFeature 394538 14396646 456308 N_ambiguous 157194 772 72582 UnstrandedReadsAssigned:13990848 PositiveStrandReadsAssigned:145162 NegativeStrandReadsAssigned:14013690 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172130-trimmed-pair1.fastq SRR7172130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,496,856 reads, 13,864,876 reads pseudoaligned [quant] estimated average fragment length: 252.319 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR7172130.ke.tsv 34699 SRR7172130.se.tsv 87100 total ==> SRR7172130.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.68 1284 48.6772 Potri.005G024800.1.v4.1 1035 783.681 676 57.7732 Potri.004G059700.1.v4.1 961 709.711 6 0.566225 Potri.007G009000.2.v4.1 1416 1164.68 0 0 Potri.003G141000.2.v4.1 2943 2691.68 747.218 18.5927 Potri.016G087400.1.v4.1 270 77.0745 1034.61 899.055 Potri.015G069301.1.v4.1 564 318.779 0 0 Potri.010G195200.1.v4.1 1773 1521.68 458 20.1586 Potri.012G127500.1.v4.1 977 725.681 2688 248.086 ==> SRR7172130.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 457 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 310 SRR7172130 completed mapping pipeline successfully