Starting /dee2/code/volunteer_pipeline.sh SRR7172131 current disk space = 3118423482368 free memory = 1581134988 SRR7172131 SRAfilesize 5a4edf94a1760df36d0043fae8fb3801 SRR7172131.sra SRR7172131.sra file validated SRR7172131 is paired end SRR7172131 is conventional basespace SRR7172131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90125 33.0 33.0 34.0 32.0 34.0 2 32.88225 34.0 33.0 34.0 31.0 34.0 3 32.97975 34.0 33.0 34.0 31.0 34.0 4 32.316 33.0 33.0 33.0 31.0 34.0 5 32.9765 33.0 33.0 34.0 32.0 34.0 6 36.77275 38.0 37.0 38.0 34.0 38.0 7 37.29325 38.0 38.0 38.0 36.0 38.0 8 37.298 38.0 38.0 38.0 36.0 38.0 9 37.4475 38.0 38.0 38.0 37.0 38.0 10-14 37.432900000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.47985 38.0 38.0 38.0 37.4 38.0 20-24 37.421949999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.28915000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.07455 38.0 38.0 38.0 36.0 38.0 35-39 36.9122 38.0 38.0 38.0 35.6 38.0 40-44 37.059549999999994 38.0 38.0 38.0 36.2 38.0 45-49 37.1228 38.0 38.0 38.0 36.2 38.0 50-54 37.223200000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.24765 38.0 38.0 38.0 36.8 38.0 60-64 37.2659 38.0 38.0 38.0 37.0 38.0 65-69 37.229049999999994 38.0 38.0 38.0 36.4 38.0 70-74 37.08995 38.0 38.0 38.0 36.0 38.0 75-79 36.96395 38.0 38.0 38.0 35.8 38.0 80-84 36.75359999999999 38.0 38.0 38.0 34.8 38.0 85-89 36.68375 38.0 38.0 38.0 34.8 38.0 90-94 36.540749999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.496449999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.499199999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.406600000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.2702 38.0 37.4 38.0 34.0 38.0 115-119 36.08925 38.0 37.0 38.0 33.0 38.0 120-124 35.965050000000005 38.0 37.0 38.0 32.2 38.0 125-129 35.593 38.0 36.4 38.0 31.0 38.0 130-134 35.2478 38.0 36.0 38.0 30.4 38.0 135-139 34.89875000000001 38.0 35.4 38.0 28.2 38.0 140-144 34.28545 38.0 34.0 38.0 26.0 38.0 145-149 33.481849999999994 38.0 33.0 38.0 21.0 38.0 150-151 28.529875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 5.0 20 1.0 21 4.0 22 3.0 23 4.0 24 9.0 25 17.0 26 18.0 27 17.0 28 35.0 29 45.0 30 43.0 31 57.0 32 77.0 33 110.0 34 187.0 35 297.0 36 628.0 37 2438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.775000000000002 15.65 14.899999999999999 38.675 2 18.525 24.8 39.45 17.224999999999998 3 17.599999999999998 29.325000000000003 26.650000000000002 26.424999999999997 4 20.325 36.75 22.2 20.724999999999998 5 19.1 38.45 23.325000000000003 19.125 6 14.875 36.575 26.825 21.725 7 12.425 19.625 46.150000000000006 21.8 8 17.349999999999998 19.625 30.325000000000003 32.7 9 18.25 21.95 31.474999999999998 28.325 10-14 18.513330998949527 30.33865239357711 26.456905607523385 24.691110999949977 15-19 19.42 28.65 27.71 24.22 20-24 19.695 28.985 27.725 23.595 25-29 19.18 28.895 28.22 23.705000000000002 30-34 19.38 28.725 28.044999999999998 23.849999999999998 35-39 19.79 28.83 28.09 23.29 40-44 19.62 29.24 27.62 23.52 45-49 19.689999999999998 28.945 27.785 23.580000000000002 50-54 19.895 28.720000000000002 27.779999999999998 23.605 55-59 19.36 29.330000000000002 28.04 23.27 60-64 19.470000000000002 28.560000000000002 28.125 23.845 65-69 19.919999999999998 28.705000000000002 27.58 23.794999999999998 70-74 19.785 28.994999999999997 27.605 23.615 75-79 19.845 28.999999999999996 27.55 23.605 80-84 19.64 28.96 27.99 23.41 85-89 20.185 28.345 27.91 23.56 90-94 19.66 28.435 28.115000000000002 23.79 95-99 20.0 28.754999999999995 28.02 23.225 100-104 20.1 28.345 28.28 23.275000000000002 105-109 19.13 29.060000000000002 28.095 23.715 110-114 19.82396479295859 28.875775155031008 28.000600120024004 23.299659931986398 115-119 19.68598429921496 28.87644382219111 27.43637181859093 24.001200060003 120-124 19.824956239059766 28.392098024506122 28.392098024506122 23.390847711927982 125-129 20.22944742247382 28.19498021141225 28.435449125795305 23.140123240318623 130-134 20.560000000000002 28.155 27.98 23.305 135-139 20.645 28.21 27.615000000000002 23.53 140-144 20.745 28.615000000000002 26.939999999999998 23.7 145-149 20.23 28.925 27.675 23.169999999999998 150-151 20.525 27.6875 28.025 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 1.0 23 0.5 24 2.0 25 3.5 26 4.5 27 7.0 28 10.5 29 18.5 30 23.0 31 27.5 32 43.0 33 53.0 34 62.0 35 85.0 36 108.0 37 127.5 38 151.0 39 184.5 40 217.0 41 231.0 42 250.5 43 274.0 44 273.0 45 264.0 46 266.0 47 242.0 48 201.5 49 173.0 50 144.5 51 121.0 52 104.5 53 84.0 54 61.0 55 44.5 56 37.5 57 26.0 58 17.0 59 16.0 60 8.0 61 3.5 62 4.0 63 5.5 64 5.5 65 3.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.045 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.005 120-124 0.025 125-129 0.19499999999999998 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2875 0.0125 0.0 0.0 0.0 102-103 0.375 0.025 0.0 0.0 0.0 104-105 0.525 0.025 0.0 0.0 0.0 106-107 0.6125 0.025 0.0 0.0 0.0 108-109 0.6875 0.025 0.0 0.0 0.0 110-111 0.825 0.025 0.0 0.0 0.0 112-113 0.925 0.025 0.0 0.0 0.0 114-115 1.15 0.025 0.0 0.0 0.0 116-117 1.3375 0.025 0.0 0.0 0.0 118-119 1.6 0.025 0.0 0.0 0.0 120-121 1.775 0.025 0.0 0.0 0.0 122-123 1.975 0.025 0.0 0.0 0.0 124-125 2.1625 0.025 0.0 0.0 0.0 126-127 2.4125 0.025 0.0 0.0 0.0 128-129 2.5999999999999996 0.025 0.0 0.0 0.0 130-131 2.8125 0.025 0.0 0.0 0.0 132-133 3.175 0.025 0.0 0.0 0.0 134-135 3.4375 0.025 0.0 0.0 0.0 136-137 3.775 0.025 0.0 0.0 0.0 138-139 4.1625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTCC 10 0.0068519996 144.85 5 GCTCGAG 10 0.0068519996 144.85 5 >>END_MODULE SRR7172131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82425 33.0 33.0 34.0 32.0 34.0 2 32.999 34.0 33.0 34.0 32.0 34.0 3 33.02075 34.0 33.0 34.0 32.0 34.0 4 33.01725 34.0 33.0 34.0 32.0 34.0 5 33.06125 34.0 33.0 34.0 32.0 34.0 6 37.212 38.0 38.0 38.0 37.0 38.0 7 37.292 38.0 38.0 38.0 37.0 38.0 8 37.2715 38.0 38.0 38.0 37.0 38.0 9 37.3015 38.0 38.0 38.0 37.0 38.0 10-14 37.256449999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.16435 38.0 38.0 38.0 37.0 38.0 20-24 37.079800000000006 38.0 38.0 38.0 36.4 38.0 25-29 37.11555 38.0 38.0 38.0 36.8 38.0 30-34 37.16180000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.06155 38.0 38.0 38.0 36.4 38.0 40-44 37.007000000000005 38.0 38.0 38.0 36.0 38.0 45-49 37.08175000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.08695 38.0 38.0 38.0 36.4 38.0 55-59 36.993300000000005 38.0 38.0 38.0 36.2 38.0 60-64 36.98665 38.0 38.0 38.0 36.0 38.0 65-69 36.9471 38.0 38.0 38.0 36.0 38.0 70-74 36.8694 38.0 38.0 38.0 36.0 38.0 75-79 36.8207 38.0 38.0 38.0 36.0 38.0 80-84 36.69885000000001 38.0 38.0 38.0 35.6 38.0 85-89 36.4891 38.0 38.0 38.0 34.2 38.0 90-94 36.374649999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.186049999999994 38.0 38.0 38.0 33.6 38.0 100-104 36.153 38.0 38.0 38.0 33.6 38.0 105-109 36.149300000000004 38.0 38.0 38.0 33.8 38.0 110-114 36.05864999999999 38.0 37.8 38.0 33.6 38.0 115-119 35.854949999999995 38.0 37.4 38.0 32.2 38.0 120-124 35.571 38.0 37.0 38.0 31.0 38.0 125-129 35.29545 38.0 36.6 38.0 31.0 38.0 130-134 34.9894 38.0 36.0 38.0 30.0 38.0 135-139 34.426249999999996 38.0 35.6 38.0 26.8 38.0 140-144 33.88295000000001 38.0 34.2 38.0 22.6 38.0 145-149 33.171350000000004 38.0 33.4 38.0 17.4 38.0 150-151 27.69525 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 2.0 5 2.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 2.0 14 2.0 15 2.0 16 2.0 17 4.0 18 4.0 19 8.0 20 5.0 21 10.0 22 10.0 23 13.0 24 10.0 25 13.0 26 11.0 27 27.0 28 35.0 29 37.0 30 50.0 31 62.0 32 73.0 33 97.0 34 154.0 35 256.0 36 596.0 37 2502.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.335086401202105 14.124718256949661 17.756073127973952 33.78412221387428 2 23.20580145036259 22.85571392848212 37.50937734433609 16.429107276819206 3 20.605151287821954 25.881470367591895 30.732683170792697 22.780695173793447 4 24.10602650662666 34.45861465366342 21.48037009252313 19.954988747186796 5 22.3 37.925 21.8 17.974999999999998 6 16.900000000000002 38.625 23.95 20.525 7 16.129032258064516 16.079019754938734 46.0865216304076 21.705426356589147 8 20.974999999999998 20.424999999999997 28.199999999999996 30.4 9 22.400000000000002 22.525000000000002 29.525000000000002 25.55 10-14 22.695212845780603 28.722925316392377 26.466910109549296 22.114951728277724 15-19 23.006503251625812 27.373686843421712 28.174087043521762 21.445722861430717 20-24 22.766138306915344 28.48642432121606 27.74638731936597 21.001050052502627 25-29 22.495 28.52 28.345 20.64 30-34 22.97 27.805000000000003 28.305000000000003 20.919999999999998 35-39 22.86 28.63 27.939999999999998 20.57 40-44 22.78 28.48 27.775 20.965 45-49 23.01 27.534999999999997 28.725 20.73 50-54 23.380000000000003 28.555000000000003 27.439999999999998 20.625 55-59 23.235 28.26 28.205000000000002 20.3 60-64 22.75 28.34 28.035 20.875 65-69 23.03 28.360000000000003 27.705000000000002 20.905 70-74 23.595 28.485 27.705000000000002 20.215 75-79 23.525 27.785 28.235 20.455000000000002 80-84 23.235 28.62 28.294999999999998 19.85 85-89 23.375 28.050000000000004 28.815 19.759999999999998 90-94 23.925 28.144999999999996 28.015 19.915 95-99 23.49 28.185 27.74 20.585 100-104 23.830000000000002 28.335 27.705000000000002 20.13 105-109 23.64 27.705000000000002 28.310000000000002 20.345 110-114 24.195 28.025 28.23 19.55 115-119 24.240000000000002 27.839999999999996 28.035 19.885 120-124 24.104999999999997 27.97 28.24 19.685 125-129 24.185000000000002 28.189999999999998 27.529999999999998 20.095 130-134 23.990000000000002 28.144999999999996 27.755000000000003 20.11 135-139 24.65 27.92 28.000000000000004 19.43 140-144 24.16 28.715000000000003 27.705000000000002 19.42 145-149 24.9 28.46 27.205000000000002 19.435 150-151 24.5 27.6625 27.525 20.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.5 24 2.5 25 1.5 26 2.5 27 5.5 28 9.5 29 12.5 30 13.5 31 17.5 32 24.0 33 36.5 34 51.5 35 68.5 36 88.0 37 106.0 38 140.5 39 179.5 40 211.5 41 233.5 42 255.5 43 276.5 44 289.0 45 287.5 46 268.0 47 250.0 48 226.5 49 200.0 50 159.5 51 127.0 52 107.0 53 92.0 54 70.0 55 40.5 56 34.5 57 30.0 58 22.0 59 14.5 60 11.0 61 8.5 62 5.5 63 3.5 64 1.5 65 2.5 66 2.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.025 3 0.025 4 0.025 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.045 15-19 0.05 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.6375 0.0 0.0 0.0 0.0 120-121 1.7999999999999998 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCT 10 0.006577216 146.82278 1 CATACTT 10 0.006832588 144.9875 7 >>END_MODULE Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774536 spots for SRR7172131.sra Written 774536 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra Read 774531 spots for SRR7172131.sra Written 774531 spots for SRR7172131.sra SRR ids: ['SRR7172131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_skuchwwn SRR7172131.sra spots: 15490625 blocks: [[1, 774531], [774532, 1549062], [1549063, 2323593], [2323594, 3098124], [3098125, 3872655], [3872656, 4647186], [4647187, 5421717], [5421718, 6196248], [6196249, 6970779], [6970780, 7745310], [7745311, 8519841], [8519842, 9294372], [9294373, 10068903], [10068904, 10843434], [10843435, 11617965], [11617966, 12392496], [12392497, 13167027], [13167028, 13941558], [13941559, 14716089], [14716090, 15490625]] SRR7172131 file size 5227564 SRR7172131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172131 SRR7172131_1.fastq SRR7172131_2.fastq Input file: SRR7172131_1.fastq Paired file: SRR7172131_2.fastq trimmed: SRR7172131-trimmed-pair1.fastq, SRR7172131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:08:21 2025 >> started Fri Feb 14 08:08:37 2025 >> done (15.956s) 15490625 read pairs processed; of these: 8251 ( 0.05%) short read pairs filtered out after trimming by size control 7512 ( 0.05%) empty read pairs filtered out after trimming by size control 15474862 (99.90%) read pairs available; of these: 8781982 (56.75%) trimmed read pairs available after processing 6692880 (43.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 8 0.00% 27 3 0.00% 28 3 0.00% 29 8 0.00% 30 6 0.00% 31 7 0.00% 32 9 0.00% 33 2 0.00% 34 14 0.00% 35 8 0.00% 36 10 0.00% 37 8 0.00% 38 9 0.00% 39 6 0.00% 40 4 0.00% 41 6 0.00% 42 3 0.00% 43 8 0.00% 44 11 0.00% 45 3 0.00% 46 9 0.00% 47 11 0.00% 48 14 0.00% 49 19 0.00% 50 14 0.00% 51 18 0.00% 52 13 0.00% 53 26 0.00% 54 34 0.00% 55 29 0.00% 56 62 0.00% 57 423 0.00% 58 191 0.00% 59 194 0.00% 60 170 0.00% 61 78 0.00% 62 128 0.00% 63 82 0.00% 64 117 0.00% 65 105 0.00% 66 183 0.00% 67 190 0.00% 68 218 0.00% 69 245 0.00% 70 214 0.00% 71 240 0.00% 72 321 0.00% 73 441 0.00% 74 357 0.00% 75 419 0.00% 76 535 0.00% 77 892 0.01% 78 1260 0.01% 79 900 0.01% 80 1057 0.01% 81 1043 0.01% 82 1138 0.01% 83 1659 0.01% 84 3330 0.02% 85 3334 0.02% 86 3159 0.02% 87 2898 0.02% 88 2965 0.02% 89 3054 0.02% 90 3272 0.02% 91 3536 0.02% 92 3833 0.02% 93 4152 0.03% 94 4578 0.03% 95 4947 0.03% 96 5503 0.04% 97 6382 0.04% 98 6476 0.04% 99 6806 0.04% 100 7274 0.05% 101 8347 0.05% 102 8376 0.05% 103 8876 0.06% 104 9789 0.06% 105 10490 0.07% 106 10942 0.07% 107 12153 0.08% 108 12369 0.08% 109 13238 0.09% 110 14084 0.09% 111 15133 0.10% 112 15916 0.10% 113 16951 0.11% 114 18006 0.12% 115 19042 0.12% 116 20146 0.13% 117 21526 0.14% 118 22666 0.15% 119 23797 0.15% 120 25188 0.16% 121 27179 0.18% 122 28365 0.18% 123 29958 0.19% 124 32399 0.21% 125 34177 0.22% 126 36112 0.23% 127 38023 0.25% 128 40512 0.26% 129 43127 0.28% 130 44989 0.29% 131 46976 0.30% 132 50596 0.33% 133 53356 0.34% 134 57109 0.37% 135 61277 0.40% 136 66262 0.43% 137 71563 0.46% 138 77742 0.50% 139 85316 0.55% 140 94698 0.61% 141 105789 0.68% 142 120517 0.78% 143 137470 0.89% 144 163657 1.06% 145 200517 1.30% 146 255680 1.65% 147 345817 2.23% 148 523175 3.38% 149 1025891 6.63% 150 4487994 29.00% 151 6692880 43.25% 15474862 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=30 prefix-density=0.17 prefix-fanout=2.6 sequence=GCATCTCTCATTGCCTTCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=511.34 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=27.6 sequence=AGCAGCAGCATGCACGCATATGATACTGACCGATCATTCATGCCTGTGCTGTTGGTAGCTGGGTAAGGTGATGATCCTCAATGTCTTTGCTGCAATGGATGCAAAACTCAAGCAACGTTTGAGGATCTGGAACGTTCTCATTTAGCTTCTCATATTCAAAAGTCCAGTGAGCCAAGCAGCTGCCCTCTCCTTTGGGAGTAGCTTGAACGATAATTATGAAATTCTTGTACTCCGTGGTGATGTCTCCTTCAATCACTTTGAAGGTGGTTGACAGCTTCTCATCGTCTATAGCTTCAATAACCTCCTTAGCAGTCTTAGCAACCCCATCATGTACATAACTCCAGCAGATTACAGTGCCCGGCTTCCCCCATTCACCTTCATGCAGATCAACATTCTGTATCTTGGCAGGGCTCATATTGGAAACGTGGTGTGGTCTGCAGCTGAAGATATCATGAAATGTTTCAGCAGAAACTTTGATCTCTACTTCAGCCTCCATCTTACCAAAGAGTGT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=41 prefix-density=0.13 prefix-fanout=2.2 sequence=TCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=425.98 fanout-score-rank=1 prefix-density=1.18 prefix-fanout=32.1 sequence=AAGAAGAAGAAA SRR7172131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:09:23 Started mapping on | Feb 14 08:09:23 Finished on | Feb 14 08:11:20 Mapping speed, Million of reads per hour | 476.15 Number of input reads | 15474862 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14543731 Uniquely mapped reads % | 93.98% Average mapped length | 294.82 Number of splices: Total | 15235396 Number of splices: Annotated (sjdb) | 14992453 Number of splices: GT/AG | 14988684 Number of splices: GC/AG | 196506 Number of splices: AT/AC | 10263 Number of splices: Non-canonical | 39943 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399552 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 40384 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541472 541472 541472 N_multimapping 399552 399552 399552 N_noFeature 378825 14407037 448304 N_ambiguous 143860 834 76184 UnstrandedReadsAssigned:14021046 PositiveStrandReadsAssigned:135860 NegativeStrandReadsAssigned:14019243 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172131-trimmed-pair1.fastq SRR7172131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,474,862 reads, 13,876,156 reads pseudoaligned [quant] estimated average fragment length: 250.918 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7172131.ke.tsv 34699 SRR7172131.se.tsv 87100 total ==> SRR7172131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.08 694 27.4346 Potri.005G024800.1.v4.1 1035 785.082 106 9.43697 Potri.004G059700.1.v4.1 961 711.098 29 2.85043 Potri.007G009000.2.v4.1 1416 1166.08 0 0 Potri.003G141000.2.v4.1 2943 2693.08 354 9.18746 Potri.016G087400.1.v4.1 270 74.9118 925 863.045 Potri.015G069301.1.v4.1 564 318.624 0 0 Potri.010G195200.1.v4.1 1773 1523.08 188 8.62733 Potri.012G127500.1.v4.1 977 727.098 3205 308.09 ==> SRR7172131.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 248 SRR7172131 completed mapping pipeline successfully