Starting /dee2/code/volunteer_pipeline.sh SRR7172132 current disk space = 3085017141248 free memory = 1449381464 SRR7172132 SRAfilesize 09a6deabdcd4ca4d0c79db7ccc6cc45b SRR7172132.sra SRR7172132.sra file validated SRR7172132 is paired end SRR7172132 is conventional basespace SRR7172132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.20275 33.0 33.0 34.0 30.0 34.0 2 32.80975 33.0 33.0 34.0 32.0 34.0 3 32.90375 34.0 33.0 34.0 31.0 34.0 4 33.2075 34.0 33.0 34.0 32.0 34.0 5 33.26825 34.0 33.0 34.0 33.0 34.0 6 37.0125 38.0 37.0 38.0 36.0 38.0 7 37.36575 38.0 38.0 38.0 37.0 38.0 8 37.5855 38.0 38.0 38.0 37.0 38.0 9 37.58125 38.0 38.0 38.0 38.0 38.0 10-14 37.6391 38.0 38.0 38.0 38.0 38.0 15-19 37.603500000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.56570000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.54395 38.0 38.0 38.0 38.0 38.0 30-34 37.4799 38.0 38.0 38.0 37.6 38.0 35-39 37.521100000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.5155 38.0 38.0 38.0 37.2 38.0 45-49 37.394949999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.32280000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.217549999999996 38.0 38.0 38.0 36.2 38.0 60-64 37.138 38.0 38.0 38.0 36.0 38.0 65-69 37.070100000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.02875 38.0 38.0 38.0 36.0 38.0 75-79 36.9975 38.0 38.0 38.0 35.8 38.0 80-84 36.8942 38.0 38.0 38.0 35.0 38.0 85-89 36.77655 38.0 38.0 38.0 34.8 38.0 90-94 36.657149999999994 38.0 38.0 38.0 34.2 38.0 95-99 36.5974 38.0 38.0 38.0 34.2 38.0 100-104 36.3932 38.0 37.2 38.0 34.0 38.0 105-109 36.136250000000004 38.0 37.0 38.0 33.2 38.0 110-114 35.98375 38.0 37.0 38.0 32.8 38.0 115-119 35.917649999999995 38.0 37.0 38.0 32.6 38.0 120-124 35.79615 38.0 36.8 38.0 31.4 38.0 125-129 35.4337 38.0 36.0 38.0 30.0 38.0 130-134 35.22305 38.0 35.6 38.0 28.8 38.0 135-139 34.702200000000005 38.0 35.0 38.0 27.4 38.0 140-144 34.1177 38.0 34.4 38.0 23.6 38.0 145-149 33.43285 38.0 34.0 38.0 20.4 38.0 150-151 29.7615 36.0 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 3.0 18 0.0 19 4.0 20 2.0 21 3.0 22 3.0 23 6.0 24 5.0 25 9.0 26 15.0 27 11.0 28 17.0 29 27.0 30 44.0 31 43.0 32 69.0 33 93.0 34 184.0 35 310.0 36 924.0 37 2224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.06070203219847 19.08155186064925 14.30456584850884 36.553180258643444 2 18.15 27.3 38.5 16.05 3 17.175 32.35 26.075 24.4 4 20.025000000000002 37.775 21.525 20.674999999999997 5 19.2 39.175 23.125 18.5 6 16.275000000000002 36.825 25.874999999999996 21.025 7 11.4 21.9 46.1 20.599999999999998 8 18.35 20.549999999999997 30.175 30.925000000000004 9 18.175 22.35 30.925000000000004 28.549999999999997 10-14 20.005 29.959999999999997 26.474999999999998 23.56 15-19 19.6 29.549999999999997 27.334999999999997 23.515 20-24 19.48 29.695 27.625 23.200000000000003 25-29 19.830000000000002 30.020000000000003 27.24 22.91 30-34 20.1 28.685 27.900000000000002 23.315 35-39 19.29 29.435 27.57 23.705000000000002 40-44 19.62 29.775000000000002 27.779999999999998 22.825 45-49 20.044999999999998 29.175 27.38 23.400000000000002 50-54 19.759999999999998 29.654999999999998 27.48 23.105 55-59 19.91 29.205 27.639999999999997 23.244999999999997 60-64 19.595000000000002 29.13 27.74 23.535 65-69 20.13 28.65 27.450000000000003 23.77 70-74 19.41 29.48 27.93 23.18 75-79 20.31 28.694999999999997 27.825 23.169999999999998 80-84 20.175 28.515 27.894999999999996 23.415 85-89 20.26 28.939999999999998 27.37 23.43 90-94 19.895 28.860000000000003 27.894999999999996 23.35 95-99 19.925 29.15 27.93 22.994999999999997 100-104 20.424999999999997 29.265 27.665 22.645 105-109 20.895 29.635 27.315 22.155 110-114 20.685000000000002 29.235 27.389999999999997 22.689999999999998 115-119 20.61 28.884999999999998 27.625 22.88 120-124 20.64 28.84 27.639999999999997 22.88 125-129 20.5 29.18 27.13 23.189999999999998 130-134 20.75 29.215000000000003 26.87 23.165 135-139 20.395 28.494999999999997 27.715 23.395 140-144 20.599999999999998 28.865000000000002 27.415 23.119999999999997 145-149 20.9 29.065 26.784999999999997 23.25 150-151 21.912499999999998 28.65 26.450000000000003 22.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 1.0 25 4.0 26 8.0 27 9.5 28 13.0 29 21.0 30 28.5 31 33.5 32 42.0 33 56.0 34 71.5 35 94.5 36 116.5 37 121.0 38 143.0 39 193.0 40 230.5 41 246.0 42 244.5 43 254.5 44 273.5 45 267.0 46 248.5 47 236.5 48 207.0 49 170.0 50 145.0 51 116.5 52 105.0 53 89.0 54 55.5 55 38.5 56 29.0 57 23.0 58 16.5 59 12.0 60 8.5 61 3.5 62 4.5 63 3.5 64 2.5 65 3.5 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.2749999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.2125000000000004 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.1624999999999996 0.0 0.0 0.0 0.0 134-135 3.5375 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACACT 10 0.006836113 144.9625 3 CTGGAAA 10 0.006836113 144.9625 145 >>END_MODULE SRR7172132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20375 34.0 33.0 34.0 33.0 34.0 2 33.296 34.0 33.0 34.0 33.0 34.0 3 33.36275 34.0 33.0 34.0 33.0 34.0 4 33.3725 34.0 33.0 34.0 33.0 34.0 5 33.368 34.0 33.0 34.0 33.0 34.0 6 37.43375 38.0 38.0 38.0 38.0 38.0 7 37.5035 38.0 38.0 38.0 38.0 38.0 8 37.5 38.0 38.0 38.0 38.0 38.0 9 37.514 38.0 38.0 38.0 38.0 38.0 10-14 37.48635 38.0 38.0 38.0 38.0 38.0 15-19 37.4922 38.0 38.0 38.0 37.8 38.0 20-24 37.40835 38.0 38.0 38.0 37.0 38.0 25-29 37.41435 38.0 38.0 38.0 37.0 38.0 30-34 37.38565 38.0 38.0 38.0 37.0 38.0 35-39 37.351000000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.3211 38.0 38.0 38.0 37.0 38.0 45-49 37.29275 38.0 38.0 38.0 37.0 38.0 50-54 37.239999999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.21725 38.0 38.0 38.0 36.8 38.0 60-64 37.1084 38.0 38.0 38.0 36.2 38.0 65-69 37.04975 38.0 38.0 38.0 36.0 38.0 70-74 36.89354999999999 38.0 38.0 38.0 35.4 38.0 75-79 36.87375 38.0 38.0 38.0 35.4 38.0 80-84 36.76245 38.0 38.0 38.0 35.0 38.0 85-89 36.6894 38.0 38.0 38.0 34.8 38.0 90-94 36.571099999999994 38.0 38.0 38.0 34.2 38.0 95-99 36.48325 38.0 38.0 38.0 34.0 38.0 100-104 36.339349999999996 38.0 37.8 38.0 33.8 38.0 105-109 36.120400000000004 38.0 37.2 38.0 33.4 38.0 110-114 36.0088 38.0 37.0 38.0 33.0 38.0 115-119 35.741499999999995 38.0 37.0 38.0 31.2 38.0 120-124 35.53874999999999 38.0 36.2 38.0 31.0 38.0 125-129 35.169650000000004 38.0 35.8 38.0 28.8 38.0 130-134 34.823350000000005 38.0 35.0 38.0 27.8 38.0 135-139 34.557249999999996 38.0 35.0 38.0 27.0 38.0 140-144 34.1336 38.0 34.6 38.0 24.4 38.0 145-149 33.3728 38.0 34.0 38.0 19.4 38.0 150-151 29.088625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 3.0 15 2.0 16 2.0 17 3.0 18 1.0 19 2.0 20 7.0 21 5.0 22 8.0 23 7.0 24 7.0 25 15.0 26 17.0 27 19.0 28 33.0 29 30.0 30 35.0 31 48.0 32 69.0 33 94.0 34 143.0 35 306.0 36 798.0 37 2343.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.824999999999996 13.350000000000001 18.75 35.075 2 24.474999999999998 22.95 34.925 17.65 3 20.849999999999998 25.874999999999996 30.85 22.425 4 23.674999999999997 36.125 21.5 18.7 5 24.099999999999998 36.725 22.35 16.825000000000003 6 17.625 36.95 24.474999999999998 20.95 7 16.425 15.575 45.300000000000004 22.7 8 21.45 21.775 27.025 29.75 9 21.5 24.025 29.725 24.75 10-14 22.81 28.32 27.05 21.82 15-19 22.67 27.105 28.87 21.355 20-24 23.14 28.134999999999998 28.185 20.54 25-29 22.93 27.785 28.410000000000004 20.875 30-34 22.36 27.68 28.939999999999998 21.02 35-39 22.905 27.37 28.915000000000003 20.810000000000002 40-44 23.235 27.965 27.800000000000004 21.0 45-49 22.725 28.025 28.560000000000002 20.69 50-54 22.49 28.315 28.48 20.715 55-59 22.945 27.889999999999997 27.839999999999996 21.325 60-64 22.14 28.17 28.599999999999998 21.09 65-69 23.36 27.12 28.804999999999996 20.715 70-74 23.18 27.860000000000003 28.610000000000003 20.349999999999998 75-79 22.975 27.834999999999997 28.37 20.82 80-84 23.035 27.694999999999997 28.835 20.435 85-89 23.35 28.139999999999997 28.470000000000002 20.04 90-94 23.419999999999998 28.09 28.67 19.82 95-99 23.119999999999997 27.900000000000002 28.165000000000003 20.815 100-104 23.275000000000002 27.74 28.425 20.560000000000002 105-109 23.044999999999998 27.915 28.775000000000002 20.265 110-114 23.244999999999997 28.225 28.035 20.495 115-119 23.145 27.325 28.720000000000002 20.810000000000002 120-124 22.825 28.28 28.435 20.46 125-129 23.505000000000003 27.725 28.305000000000003 20.465 130-134 23.544999999999998 28.105000000000004 28.49 19.86 135-139 23.875 27.884999999999998 28.275 19.965 140-144 23.97 28.455000000000002 27.67 19.905 145-149 24.12 28.28 27.589999999999996 20.01 150-151 24.212500000000002 27.85 27.725 20.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.0 25 1.5 26 3.0 27 5.0 28 9.0 29 12.0 30 12.0 31 15.5 32 25.0 33 32.5 34 50.0 35 67.0 36 98.5 37 123.5 38 135.0 39 165.5 40 208.5 41 232.5 42 260.5 43 291.0 44 281.0 45 273.0 46 268.0 47 255.0 48 236.0 49 209.0 50 170.0 51 130.0 52 106.0 53 86.5 54 64.5 55 46.5 56 28.0 57 21.5 58 21.5 59 14.5 60 9.0 61 8.0 62 4.0 63 2.5 64 4.5 65 2.5 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.45294413688978363 0.8999999999999999 3 0.025163563160543533 0.075 4 0.050327126321087066 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.9500000000000002 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.5375 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAAAG 10 0.006830828 145.0 6 CCTTGAT 10 0.006830828 145.0 7 AGCTGGG 10 0.006830828 145.0 6 >>END_MODULE Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578948 spots for SRR7172132.sra Written 578948 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra Read 578946 spots for SRR7172132.sra Written 578946 spots for SRR7172132.sra SRR ids: ['SRR7172132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e2dqrs3f SRR7172132.sra spots: 11578922 blocks: [[1, 578946], [578947, 1157892], [1157893, 1736838], [1736839, 2315784], [2315785, 2894730], [2894731, 3473676], [3473677, 4052622], [4052623, 4631568], [4631569, 5210514], [5210515, 5789460], [5789461, 6368406], [6368407, 6947352], [6947353, 7526298], [7526299, 8105244], [8105245, 8684190], [8684191, 9263136], [9263137, 9842082], [9842083, 10421028], [10421029, 10999974], [10999975, 11578922]] SRR7172132 file size 3902016 SRR7172132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172132 SRR7172132_1.fastq SRR7172132_2.fastq Input file: SRR7172132_1.fastq Paired file: SRR7172132_2.fastq trimmed: SRR7172132-trimmed-pair1.fastq, SRR7172132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:02:12 2025 >> started Fri Feb 14 07:02:25 2025 >> done (12.751s) 11578922 read pairs processed; of these: 4200 ( 0.04%) short read pairs filtered out after trimming by size control 3496 ( 0.03%) empty read pairs filtered out after trimming by size control 11571226 (99.93%) read pairs available; of these: 6603488 (57.07%) trimmed read pairs available after processing 4967738 (42.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 3 0.00% 30 1 0.00% 31 3 0.00% 32 3 0.00% 33 7 0.00% 34 2 0.00% 35 6 0.00% 36 3 0.00% 37 7 0.00% 38 2 0.00% 39 3 0.00% 40 4 0.00% 41 4 0.00% 42 7 0.00% 43 6 0.00% 44 6 0.00% 45 7 0.00% 46 12 0.00% 47 12 0.00% 48 16 0.00% 49 9 0.00% 50 15 0.00% 51 14 0.00% 52 30 0.00% 53 14 0.00% 54 24 0.00% 55 24 0.00% 56 21 0.00% 57 37 0.00% 58 37 0.00% 59 25 0.00% 60 46 0.00% 61 55 0.00% 62 67 0.00% 63 71 0.00% 64 79 0.00% 65 82 0.00% 66 115 0.00% 67 147 0.00% 68 144 0.00% 69 138 0.00% 70 172 0.00% 71 220 0.00% 72 243 0.00% 73 265 0.00% 74 301 0.00% 75 381 0.00% 76 443 0.00% 77 476 0.00% 78 527 0.00% 79 609 0.01% 80 700 0.01% 81 789 0.01% 82 959 0.01% 83 1010 0.01% 84 1369 0.01% 85 1661 0.01% 86 1665 0.01% 87 1947 0.02% 88 2245 0.02% 89 2279 0.02% 90 2580 0.02% 91 2781 0.02% 92 3148 0.03% 93 3275 0.03% 94 3713 0.03% 95 3929 0.03% 96 4402 0.04% 97 4709 0.04% 98 4980 0.04% 99 5322 0.05% 100 5954 0.05% 101 6426 0.06% 102 6884 0.06% 103 7340 0.06% 104 7924 0.07% 105 8505 0.07% 106 9052 0.08% 107 9919 0.09% 108 10243 0.09% 109 11078 0.10% 110 11506 0.10% 111 12376 0.11% 112 12861 0.11% 113 13654 0.12% 114 14935 0.13% 115 15638 0.14% 116 16570 0.14% 117 17353 0.15% 118 17961 0.16% 119 18928 0.16% 120 19844 0.17% 121 20916 0.18% 122 22078 0.19% 123 23426 0.20% 124 24874 0.21% 125 26066 0.23% 126 27979 0.24% 127 29969 0.26% 128 31018 0.27% 129 33430 0.29% 130 35078 0.30% 131 37564 0.32% 132 39891 0.34% 133 43034 0.37% 134 45885 0.40% 135 48687 0.42% 136 53165 0.46% 137 56976 0.49% 138 62213 0.54% 139 67069 0.58% 140 73435 0.63% 141 82892 0.72% 142 95333 0.82% 143 110459 0.95% 144 133810 1.16% 145 165483 1.43% 146 217864 1.88% 147 311352 2.69% 148 493496 4.26% 149 932505 8.06% 150 2944153 25.44% 151 4967738 42.93% 11571226 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=25 prefix-density=0.61 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=73.60 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.7 sequence=TCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=102.89 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=12.9 sequence=GATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGGGGAAGCCGGGCACTGTAATCTGCTGGAGTTATGTACATGATGGGGTTGCTAAGACTGC SRR7172132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:03:15 Started mapping on | Feb 14 07:03:15 Finished on | Feb 14 07:05:07 Mapping speed, Million of reads per hour | 371.93 Number of input reads | 11571226 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10773569 Uniquely mapped reads % | 93.11% Average mapped length | 294.32 Number of splices: Total | 10214499 Number of splices: Annotated (sjdb) | 10029119 Number of splices: GT/AG | 10052833 Number of splices: GC/AG | 123433 Number of splices: AT/AC | 9379 Number of splices: Non-canonical | 28854 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.25 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 325879 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 27684 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 476615 476615 476615 N_multimapping 325879 325879 325879 N_noFeature 309540 10651035 373607 N_ambiguous 122955 738 64146 UnstrandedReadsAssigned:10341074 PositiveStrandReadsAssigned:121796 NegativeStrandReadsAssigned:10335816 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172132-trimmed-pair1.fastq SRR7172132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,571,226 reads, 10,207,458 reads pseudoaligned [quant] estimated average fragment length: 247.294 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7172132.ke.tsv 34699 SRR7172132.se.tsv 87100 total ==> SRR7172132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.71 788 41.0732 Potri.005G024800.1.v4.1 1035 788.706 228 26.6959 Potri.004G059700.1.v4.1 961 714.741 33 4.26373 Potri.007G009000.2.v4.1 1416 1169.71 0 0 Potri.003G141000.2.v4.1 2943 2696.71 505 17.2935 Potri.016G087400.1.v4.1 270 75.9483 575 699.156 Potri.015G069301.1.v4.1 564 321.89 0 0 Potri.010G195200.1.v4.1 1773 1526.71 210 12.7025 Potri.012G127500.1.v4.1 977 730.731 3050 385.449 ==> SRR7172132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 448 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 180 SRR7172132 completed mapping pipeline successfully