Starting /dee2/code/volunteer_pipeline.sh SRR7172133 current disk space = 3085013635072 free memory = 1014906648 SRR7172133 SRAfilesize e764646fb0a00883818a4407f751415c SRR7172133.sra SRR7172133.sra file validated SRR7172133 is paired end SRR7172133 is conventional basespace SRR7172133 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.977 33.0 33.0 34.0 32.0 34.0 2 33.22075 34.0 33.0 34.0 32.0 34.0 3 32.76925 33.0 33.0 34.0 32.0 34.0 4 32.9025 33.0 33.0 34.0 32.0 34.0 5 33.09175 34.0 33.0 34.0 32.0 34.0 6 36.74475 38.0 37.0 38.0 34.0 38.0 7 37.01725 38.0 38.0 38.0 35.0 38.0 8 37.33625 38.0 38.0 38.0 37.0 38.0 9 37.3485 38.0 38.0 38.0 37.0 38.0 10-14 37.5107 38.0 38.0 38.0 37.2 38.0 15-19 37.52605 38.0 38.0 38.0 37.6 38.0 20-24 37.45285 38.0 38.0 38.0 37.4 38.0 25-29 37.420249999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.345800000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.237 38.0 38.0 38.0 36.8 38.0 40-44 37.2205 38.0 38.0 38.0 37.0 38.0 45-49 37.2094 38.0 38.0 38.0 36.8 38.0 50-54 37.32825 38.0 38.0 38.0 37.0 38.0 55-59 37.3295 38.0 38.0 38.0 37.0 38.0 60-64 37.1846 38.0 38.0 38.0 36.2 38.0 65-69 37.2216 38.0 38.0 38.0 36.4 38.0 70-74 37.16265 38.0 38.0 38.0 36.0 38.0 75-79 36.9714 38.0 38.0 38.0 35.8 38.0 80-84 37.00325 38.0 38.0 38.0 36.0 38.0 85-89 36.924150000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.7396 38.0 38.0 38.0 35.0 38.0 95-99 36.66595 38.0 38.0 38.0 34.6 38.0 100-104 36.4859 38.0 38.0 38.0 34.0 38.0 105-109 36.469750000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.09495 38.0 37.4 38.0 33.4 38.0 115-119 36.038149999999995 38.0 37.0 38.0 33.2 38.0 120-124 35.83555 38.0 37.0 38.0 32.2 38.0 125-129 35.345299999999995 38.0 36.0 38.0 30.6 38.0 130-134 35.37895 38.0 36.0 38.0 31.0 38.0 135-139 34.89595 38.0 35.8 38.0 28.6 38.0 140-144 34.26625 38.0 34.0 38.0 26.0 38.0 145-149 33.66105 38.0 33.8 38.0 21.6 38.0 150-151 28.328125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 4.0 20 5.0 21 4.0 22 4.0 23 6.0 24 8.0 25 13.0 26 15.0 27 20.0 28 24.0 29 39.0 30 46.0 31 49.0 32 66.0 33 101.0 34 178.0 35 288.0 36 644.0 37 2479.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.775 19.075 14.299999999999999 32.85 2 20.525 25.724999999999998 35.625 18.125 3 16.650000000000002 31.3 27.0 25.05 4 20.58529264632316 36.343171585792895 22.736368184092047 20.335167583791897 5 18.925 38.5 23.25 19.325 6 15.35 37.7 24.8 22.15 7 13.25 20.575 45.725 20.45 8 17.525 23.1 27.775 31.6 9 17.178068410462778 22.635814889336018 31.463782696177063 28.722334004024148 10-14 19.786978697869788 29.862986298629863 25.95259525952595 24.3974397439744 15-19 19.89 28.660000000000004 27.900000000000002 23.549999999999997 20-24 19.765 28.32 27.950000000000003 23.965 25-29 19.491949194919492 29.252925292529252 27.81278127812781 23.442344234423445 30-34 19.7 29.049999999999997 27.665 23.585 35-39 19.720986049302468 29.13145657282864 27.931396569828493 23.2161608080404 40-44 19.52280912364946 29.601840736294516 27.44597839135654 23.42937174869948 45-49 19.800940282084625 29.08372511753526 27.87336200860258 23.241972591777532 50-54 20.04 29.285 27.52 23.155 55-59 20.04 29.23 27.560000000000002 23.169999999999998 60-64 19.64 29.205 27.62 23.535 65-69 19.825 29.42 27.785 22.97 70-74 20.192019201920193 28.817881788178816 27.317731773177318 23.672367236723673 75-79 19.867980197029556 29.47942191328699 27.19407911186678 23.45851877781667 80-84 19.86 28.275 27.639999999999997 24.224999999999998 85-89 20.184036807361473 29.23084616923385 27.455491098219643 23.12962592518504 90-94 20.124024804960992 28.965793158631726 27.510502100420087 23.399679935987198 95-99 20.01 28.110000000000003 28.189999999999998 23.69 100-104 19.776977697769777 28.472847284728473 28.337833783378336 23.412341234123414 105-109 20.261013050652533 28.366418320916047 27.346367318365917 24.026201310065503 110-114 20.082193153911692 28.822733423545333 27.955695885330528 23.13937753721245 115-119 20.665 28.310000000000002 27.584999999999997 23.44 120-124 20.42042042042042 28.14814814814815 28.133133133133132 23.2982982982983 125-129 20.01402735333901 28.435449125795305 27.58378838735534 23.966735133510344 130-134 20.255000000000003 29.095 26.845000000000002 23.805 135-139 20.575 27.74 27.634999999999998 24.05 140-144 20.69517379344836 28.6271567891973 26.9567391847962 23.72093023255814 145-149 20.474999999999998 29.044999999999998 26.96 23.52 150-151 20.1125 28.1625 27.500000000000004 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 0.5 25 2.5 26 4.5 27 7.0 28 10.0 29 17.0 30 28.5 31 31.5 32 40.0 33 55.0 34 68.0 35 79.5 36 99.0 37 120.5 38 141.5 39 182.0 40 205.0 41 221.0 42 258.0 43 275.5 44 264.0 45 286.0 46 277.5 47 231.5 48 227.5 49 193.5 50 146.0 51 132.5 52 109.5 53 76.5 54 62.0 55 45.0 56 27.5 57 19.5 58 14.5 59 11.5 60 6.5 61 2.5 62 2.5 63 4.0 64 1.5 65 1.5 66 2.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.6 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.005 40-44 0.04 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.015 80-84 0.0 85-89 0.02 90-94 0.02 95-99 0.0 100-104 0.01 105-109 0.005 110-114 0.23500000000000001 115-119 0.0 120-124 0.1 125-129 0.19499999999999998 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.825 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.5875 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTTA 10 0.006830828 145.0 5 GTTTGGG 10 0.006830828 145.0 1 CACACTT 10 0.006830828 145.0 1 GTCAAAT 10 0.006830828 145.0 1 TGCGAGC 10 0.006830828 145.0 8 GGTTTAG 10 0.006830828 145.0 6 CCAAGTT 10 0.006830828 145.0 7 >>END_MODULE SRR7172133 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94875 33.0 33.0 34.0 32.0 34.0 2 33.0425 34.0 33.0 34.0 32.0 34.0 3 33.0705 34.0 33.0 34.0 33.0 34.0 4 33.09025 34.0 33.0 34.0 33.0 34.0 5 33.0515 34.0 33.0 34.0 33.0 34.0 6 37.1205 38.0 38.0 38.0 37.0 38.0 7 37.24 38.0 38.0 38.0 37.0 38.0 8 37.14325 38.0 38.0 38.0 37.0 38.0 9 37.21075 38.0 38.0 38.0 37.0 38.0 10-14 37.1856 38.0 38.0 38.0 37.0 38.0 15-19 37.1456 38.0 38.0 38.0 37.0 38.0 20-24 37.02265 38.0 38.0 38.0 36.8 38.0 25-29 37.08775000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.0783 38.0 38.0 38.0 37.0 38.0 35-39 37.01465 38.0 38.0 38.0 36.8 38.0 40-44 36.926550000000006 38.0 38.0 38.0 36.2 38.0 45-49 36.92465 38.0 38.0 38.0 36.2 38.0 50-54 37.0457 38.0 38.0 38.0 36.8 38.0 55-59 36.91825 38.0 38.0 38.0 36.2 38.0 60-64 36.89065 38.0 38.0 38.0 36.0 38.0 65-69 36.791199999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.759150000000005 38.0 38.0 38.0 35.6 38.0 75-79 36.66325 38.0 38.0 38.0 35.4 38.0 80-84 36.6019 38.0 38.0 38.0 35.0 38.0 85-89 36.46785 38.0 38.0 38.0 34.6 38.0 90-94 36.2918 38.0 38.0 38.0 34.2 38.0 95-99 36.141149999999996 38.0 38.0 38.0 33.8 38.0 100-104 36.1341 38.0 38.0 38.0 34.0 38.0 105-109 35.9316 38.0 37.6 38.0 33.0 38.0 110-114 35.660199999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.6472 38.0 37.0 38.0 31.0 38.0 120-124 35.413050000000005 38.0 37.0 38.0 30.6 38.0 125-129 35.013099999999994 38.0 36.0 38.0 29.0 38.0 130-134 34.67729999999999 38.0 36.0 38.0 27.6 38.0 135-139 34.16949999999999 38.0 35.4 38.0 24.0 38.0 140-144 33.40985 38.0 33.4 38.0 20.2 38.0 145-149 32.85600000000001 38.0 33.0 38.0 12.0 38.0 150-151 27.66325 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 2.0 5 0.0 6 4.0 7 2.0 8 2.0 9 0.0 10 1.0 11 3.0 12 0.0 13 1.0 14 2.0 15 3.0 16 4.0 17 3.0 18 11.0 19 9.0 20 6.0 21 4.0 22 11.0 23 11.0 24 8.0 25 18.0 26 17.0 27 23.0 28 30.0 29 37.0 30 53.0 31 67.0 32 81.0 33 100.0 34 182.0 35 250.0 36 562.0 37 2482.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.24310776942356 14.887218045112782 16.99248120300752 30.87719298245614 2 24.036054081121684 23.43515272909364 35.17776664997496 17.351026539809713 3 20.95643465197797 27.491236855282924 31.146720080120183 20.40560841261893 4 23.83575363044567 34.777165748622934 21.657486229344016 19.729594391587383 5 23.00951427140711 36.78017025538308 21.732598898347522 18.477716574862292 6 18.432256448785374 37.540696218382166 23.916854495366895 20.110192837465565 7 17.580766341096922 15.652391685449537 44.97871274730779 21.788129226145756 8 20.330495743615423 21.507260891337005 26.81522283425138 31.347020530796193 9 19.779669504256383 24.161241862794192 29.86980470706059 26.189283925888834 10-14 22.74024738344434 29.185237117532175 26.40592919024488 21.668586308778607 15-19 22.91280613011469 27.675664846997545 28.171482946862326 21.240046076025443 20-24 22.547056467761315 27.778334000800964 28.083700440528638 21.59090909090909 25-29 22.734546909381876 28.160632126425284 28.240648129625924 20.86417283456691 30-34 23.169999999999998 27.589999999999996 28.425 20.815 35-39 23.075000000000003 27.985 28.360000000000003 20.580000000000002 40-44 23.345 27.93 27.725 21.0 45-49 22.455 28.505000000000003 27.810000000000002 21.23 50-54 22.399479895979198 28.125625125025007 28.580716143228646 20.894178835767153 55-59 23.846923461730864 27.848924462231118 27.693846923461727 20.610305152576288 60-64 22.941470735367684 28.189094547273637 28.25912956478239 20.610305152576288 65-69 23.73254591862269 28.02662529402933 27.4911165607327 20.749712226615287 70-74 23.550017514887656 28.15393084121503 27.918730921283093 20.377320722614222 75-79 23.201681934224357 28.132352205035794 28.50277819492416 20.163187665815688 80-84 23.15431202762901 28.034436157965864 27.889283747935334 20.92196806646979 85-89 23.7563807426684 28.120308277449706 27.5397858072265 20.58352517265539 90-94 23.757320919056916 27.47659808780097 28.70300845972869 20.063072533413425 95-99 23.14467297202622 27.953760696592106 28.309062703297805 20.592503628083872 100-104 23.760940235058765 28.02200550137534 27.71692923230808 20.500125031257816 105-109 23.62 27.3 28.425 20.655 110-114 23.21 27.685 28.754999999999995 20.349999999999998 115-119 23.477043112933877 28.053416024807444 27.80334100230069 20.666199859957988 120-124 23.290138590083554 28.1532996447691 28.108270375744233 20.44829138940311 125-129 23.323658927141715 28.52281825460368 28.30264211369095 19.85088070456365 130-134 24.350568096501327 27.654036738575506 28.119525501776867 19.875869663146304 135-139 24.331898708837954 28.155339805825243 27.860074066659994 19.65268741867681 140-144 23.811430287258535 28.470623561205084 27.734961465318786 19.982984686217595 145-149 24.351087771942986 27.54688672168042 27.97199299824956 20.130032508127034 150-151 24.587500000000002 27.3875 27.85 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 1.0 23 1.5 24 2.5 25 1.5 26 1.5 27 3.5 28 6.0 29 7.5 30 9.5 31 14.5 32 22.0 33 37.0 34 55.0 35 68.5 36 73.5 37 87.0 38 128.0 39 163.5 40 197.5 41 242.0 42 282.0 43 298.5 44 303.0 45 297.0 46 273.0 47 244.5 48 216.5 49 202.5 50 181.5 51 149.5 52 105.5 53 71.0 54 62.5 55 51.0 56 37.0 57 28.5 58 18.0 59 14.0 60 10.0 61 5.5 62 6.5 63 4.0 64 1.5 65 1.0 66 3.0 67 2.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.15 3 0.15 4 0.15 5 0.15 6 0.17500000000000002 7 0.17500000000000002 8 0.15 9 0.15 10-14 0.155 15-19 0.165 20-24 0.12 25-29 0.02 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.02 55-59 0.05 60-64 0.05 65-69 0.095 70-74 0.08499999999999999 75-79 0.11499999999999999 80-84 0.105 85-89 0.09 90-94 0.11499999999999999 95-99 0.08499999999999999 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.03 120-124 0.065 125-129 0.08 130-134 0.105 135-139 0.09 140-144 0.09 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.6500000000000004 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.8375000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra Read 952502 spots for SRR7172133.sra Written 952502 spots for SRR7172133.sra Read 952494 spots for SRR7172133.sra Written 952494 spots for SRR7172133.sra SRR ids: ['SRR7172133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qx5rbjlp SRR7172133.sra spots: 19049888 blocks: [[1, 952494], [952495, 1904988], [1904989, 2857482], [2857483, 3809976], [3809977, 4762470], [4762471, 5714964], [5714965, 6667458], [6667459, 7619952], [7619953, 8572446], [8572447, 9524940], [9524941, 10477434], [10477435, 11429928], [11429929, 12382422], [12382423, 13334916], [13334917, 14287410], [14287411, 15239904], [15239905, 16192398], [16192399, 17144892], [17144893, 18097386], [18097387, 19049888]] SRR7172133 file size 6433681 SRR7172133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172133 SRR7172133_1.fastq SRR7172133_2.fastq Input file: SRR7172133_1.fastq Paired file: SRR7172133_2.fastq trimmed: SRR7172133-trimmed-pair1.fastq, SRR7172133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:55:56 2025 >> started Fri Feb 14 06:56:20 2025 >> done (24.260s) 19049888 read pairs processed; of these: 16536 ( 0.09%) short read pairs filtered out after trimming by size control 12641 ( 0.07%) empty read pairs filtered out after trimming by size control 19020711 (99.85%) read pairs available; of these: 11007591 (57.87%) trimmed read pairs available after processing 8013120 (42.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 8 0.00% 21 7 0.00% 22 7 0.00% 23 3 0.00% 24 6 0.00% 25 6 0.00% 26 3 0.00% 27 6 0.00% 28 11 0.00% 29 7 0.00% 30 8 0.00% 31 5 0.00% 32 9 0.00% 33 5 0.00% 34 9 0.00% 35 22 0.00% 36 15 0.00% 37 9 0.00% 38 9 0.00% 39 11 0.00% 40 8 0.00% 41 13 0.00% 42 15 0.00% 43 12 0.00% 44 17 0.00% 45 8 0.00% 46 13 0.00% 47 18 0.00% 48 18 0.00% 49 23 0.00% 50 17 0.00% 51 23 0.00% 52 33 0.00% 53 41 0.00% 54 40 0.00% 55 37 0.00% 56 57 0.00% 57 64 0.00% 58 205 0.00% 59 354 0.00% 60 231 0.00% 61 141 0.00% 62 132 0.00% 63 120 0.00% 64 137 0.00% 65 138 0.00% 66 166 0.00% 67 209 0.00% 68 227 0.00% 69 252 0.00% 70 298 0.00% 71 303 0.00% 72 372 0.00% 73 449 0.00% 74 540 0.00% 75 614 0.00% 76 744 0.00% 77 826 0.00% 78 1042 0.01% 79 1219 0.01% 80 1331 0.01% 81 1337 0.01% 82 1791 0.01% 83 3016 0.02% 84 4584 0.02% 85 4819 0.03% 86 4897 0.03% 87 5078 0.03% 88 5125 0.03% 89 4973 0.03% 90 4971 0.03% 91 5296 0.03% 92 5566 0.03% 93 6217 0.03% 94 6612 0.03% 95 6982 0.04% 96 7496 0.04% 97 8127 0.04% 98 8538 0.04% 99 9635 0.05% 100 11028 0.06% 101 11341 0.06% 102 11779 0.06% 103 12406 0.07% 104 13289 0.07% 105 14023 0.07% 106 14854 0.08% 107 15645 0.08% 108 16401 0.09% 109 17519 0.09% 110 18555 0.10% 111 19905 0.10% 112 21006 0.11% 113 22506 0.12% 114 23518 0.12% 115 24903 0.13% 116 26912 0.14% 117 28285 0.15% 118 29341 0.15% 119 31617 0.17% 120 33146 0.17% 121 35362 0.19% 122 37183 0.20% 123 39910 0.21% 124 42433 0.22% 125 45588 0.24% 126 48165 0.25% 127 51406 0.27% 128 54711 0.29% 129 57753 0.30% 130 60263 0.32% 131 64161 0.34% 132 68393 0.36% 133 71534 0.38% 134 76631 0.40% 135 81989 0.43% 136 87589 0.46% 137 92637 0.49% 138 99543 0.52% 139 109073 0.57% 140 123129 0.65% 141 134219 0.71% 142 152093 0.80% 143 175195 0.92% 144 208574 1.10% 145 245561 1.29% 146 320080 1.68% 147 439493 2.31% 148 647328 3.40% 149 1278210 6.72% 150 5525668 29.05% 151 8013120 42.13% 19020711 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=37 prefix-density=0.18 prefix-fanout=2.0 sequence=TGCCAACGGTGACATTAAGCAATGAACCGAGCAAATCAGCACATACACCTAATTTAAGTGCATCCTTTGGGCACTTTCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=338.38 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=34.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=30 prefix-density=0.25 prefix-fanout=2.4 sequence=CATCACTTGCTCTCTTTCTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=124.09 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.5 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172133 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:57:09 Started mapping on | Feb 14 06:57:09 Finished on | Feb 14 06:59:15 Mapping speed, Million of reads per hour | 543.45 Number of input reads | 19020711 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18070977 Uniquely mapped reads % | 95.01% Average mapped length | 294.15 Number of splices: Total | 18177030 Number of splices: Annotated (sjdb) | 17894286 Number of splices: GT/AG | 17885322 Number of splices: GC/AG | 228587 Number of splices: AT/AC | 12711 Number of splices: Non-canonical | 50410 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 536901 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 46792 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.84% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 432701 432701 432701 N_multimapping 536901 536901 536901 N_noFeature 403579 17891136 497243 N_ambiguous 172067 1028 85174 UnstrandedReadsAssigned:17495331 PositiveStrandReadsAssigned:178813 NegativeStrandReadsAssigned:17488560 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172133-trimmed-pair1.fastq SRR7172133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,020,711 reads, 17,292,877 reads pseudoaligned [quant] estimated average fragment length: 250.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 984 rounds 52401 SRR7172133.ke.tsv 34699 SRR7172133.se.tsv 87100 total ==> SRR7172133.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.08 798 23.9543 Potri.005G024800.1.v4.1 1035 785.075 158 10.6814 Potri.004G059700.1.v4.1 961 711.095 28 2.08983 Potri.007G009000.2.v4.1 1416 1166.08 0 0 Potri.003G141000.2.v4.1 2943 2693.08 465.11 9.16618 Potri.016G087400.1.v4.1 270 75.581 1104.33 775.477 Potri.015G069301.1.v4.1 564 319.207 0 0 Potri.010G195200.1.v4.1 1773 1523.08 113 3.93766 Potri.012G127500.1.v4.1 977 727.086 3212 234.461 ==> SRR7172133.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 404 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 161 SRR7172133 completed mapping pipeline successfully