Starting /dee2/code/volunteer_pipeline.sh SRR7172134 current disk space = 3119145918464 free memory = 1489098020 SRR7172134 SRAfilesize 1aba403142867e410e4c0a156ce99269 SRR7172134.sra SRR7172134.sra file validated SRR7172134 is paired end SRR7172134 is conventional basespace SRR7172134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.634 33.0 32.0 34.0 25.0 34.0 2 32.50925 33.0 33.0 34.0 30.0 34.0 3 32.7115 33.0 33.0 34.0 31.0 34.0 4 33.138 33.0 33.0 34.0 32.0 34.0 5 32.95275 33.0 33.0 34.0 32.0 34.0 6 36.6925 38.0 37.0 38.0 34.0 38.0 7 37.0125 38.0 37.0 38.0 35.0 38.0 8 37.23025 38.0 38.0 38.0 36.0 38.0 9 37.47 38.0 38.0 38.0 37.0 38.0 10-14 37.53825 38.0 38.0 38.0 37.0 38.0 15-19 37.5184 38.0 38.0 38.0 37.2 38.0 20-24 37.50585 38.0 38.0 38.0 37.2 38.0 25-29 37.55395 38.0 38.0 38.0 37.8 38.0 30-34 37.53465 38.0 38.0 38.0 37.2 38.0 35-39 37.532250000000005 38.0 38.0 38.0 37.6 38.0 40-44 37.50315 38.0 38.0 38.0 37.0 38.0 45-49 37.410700000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.322199999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.2336 38.0 38.0 38.0 36.2 38.0 60-64 37.09665 38.0 38.0 38.0 36.0 38.0 65-69 37.060649999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.97365 38.0 38.0 38.0 35.8 38.0 75-79 36.950300000000006 38.0 38.0 38.0 35.2 38.0 80-84 36.83149999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.733399999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.622 38.0 38.0 38.0 34.0 38.0 95-99 36.561899999999994 38.0 37.6 38.0 34.0 38.0 100-104 36.326100000000004 38.0 37.0 38.0 34.0 38.0 105-109 36.144 38.0 37.0 38.0 33.0 38.0 110-114 35.969550000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.8119 38.0 36.6 38.0 31.8 38.0 120-124 35.625350000000005 38.0 36.0 38.0 30.4 38.0 125-129 35.269400000000005 38.0 35.4 38.0 29.6 38.0 130-134 35.0791 38.0 35.4 38.0 28.2 38.0 135-139 34.66225 38.0 35.0 38.0 27.6 38.0 140-144 33.91065 38.0 34.2 38.0 23.2 38.0 145-149 33.293899999999994 38.0 34.0 38.0 20.0 38.0 150-151 29.367125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 5.0 21 4.0 22 5.0 23 3.0 24 10.0 25 9.0 26 8.0 27 19.0 28 29.0 29 27.0 30 26.0 31 41.0 32 77.0 33 91.0 34 193.0 35 362.0 36 1003.0 37 2081.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.277968791325048 18.40782861676805 16.530018513620735 35.78418407828617 2 19.4048512128032 25.081270317579396 36.6591647911978 18.854713678419603 3 17.7 30.099999999999998 26.525 25.674999999999997 4 21.875 35.375 21.95 20.8 5 19.900000000000002 38.05 22.15 19.900000000000002 6 17.175 36.275 25.55 21.0 7 12.775 19.575 47.05 20.599999999999998 8 18.55 20.275000000000002 28.299999999999997 32.875 9 17.95 22.15 30.475 29.425 10-14 19.55 29.845 26.095000000000002 24.51 15-19 20.62 28.615000000000002 27.665 23.1 20-24 20.34 28.37 27.650000000000002 23.64 25-29 20.255000000000003 28.59 27.650000000000002 23.505000000000003 30-34 19.845 28.985 27.67 23.5 35-39 20.5 28.360000000000003 27.534999999999997 23.605 40-44 20.345 29.225 27.224999999999998 23.205000000000002 45-49 20.26 28.575 27.37 23.794999999999998 50-54 20.455000000000002 28.735 27.655 23.155 55-59 20.349999999999998 28.605000000000004 27.97 23.075000000000003 60-64 20.41 28.349999999999998 27.889999999999997 23.35 65-69 20.405 28.425 27.529999999999998 23.64 70-74 20.26 28.349999999999998 27.775 23.615 75-79 19.975 28.799999999999997 27.61 23.615 80-84 20.06 28.315 27.339999999999996 24.285 85-89 20.43 28.28 27.639999999999997 23.65 90-94 20.525 28.835 27.145000000000003 23.494999999999997 95-99 20.605 28.110000000000003 27.55 23.735 100-104 20.905 28.205000000000002 27.744999999999997 23.145 105-109 20.68 28.59 27.889999999999997 22.84 110-114 21.205 28.804999999999996 27.474999999999998 22.515 115-119 21.26 28.335 27.534999999999997 22.869999999999997 120-124 21.51 28.095 27.400000000000002 22.994999999999997 125-129 21.43 27.875 27.175 23.52 130-134 21.2 28.075 27.12 23.605 135-139 21.365000000000002 27.655 27.060000000000002 23.919999999999998 140-144 20.995 27.800000000000004 27.315 23.89 145-149 21.634999999999998 28.139999999999997 27.355 22.869999999999997 150-151 21.587500000000002 27.525 27.150000000000002 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.0 24 3.0 25 4.5 26 6.0 27 9.0 28 13.0 29 18.0 30 22.0 31 27.5 32 36.5 33 46.0 34 66.0 35 83.0 36 90.5 37 124.5 38 146.5 39 153.5 40 189.5 41 212.5 42 243.0 43 271.5 44 268.5 45 265.0 46 265.5 47 237.5 48 201.0 49 183.0 50 152.0 51 138.0 52 118.5 53 88.0 54 64.5 55 48.5 56 44.0 57 36.5 58 30.0 59 21.5 60 15.5 61 10.5 62 9.5 63 7.5 64 5.0 65 3.5 66 3.0 67 4.0 68 2.0 69 1.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.475 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.775 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.4875 0.0 0.0 0.0 0.0 138-139 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACAT 10 0.0060887975 150.61038 1 GAGTTCA 10 0.006836113 144.9625 3 CTGAACT 10 0.006836113 144.9625 145 ACAGGAA 10 0.006836113 144.9625 8 >>END_MODULE SRR7172134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2225 33.0 33.0 34.0 33.0 34.0 2 33.2755 34.0 33.0 34.0 33.0 34.0 3 33.3215 34.0 33.0 34.0 33.0 34.0 4 33.27825 34.0 33.0 34.0 33.0 34.0 5 33.3085 34.0 33.0 34.0 33.0 34.0 6 37.4495 38.0 38.0 38.0 37.0 38.0 7 37.50575 38.0 38.0 38.0 38.0 38.0 8 37.451 38.0 38.0 38.0 38.0 38.0 9 37.4555 38.0 38.0 38.0 38.0 38.0 10-14 37.47245 38.0 38.0 38.0 38.0 38.0 15-19 37.474 38.0 38.0 38.0 38.0 38.0 20-24 37.372249999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.342200000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.3498 38.0 38.0 38.0 37.0 38.0 35-39 37.32365 38.0 38.0 38.0 37.0 38.0 40-44 37.2673 38.0 38.0 38.0 37.0 38.0 45-49 37.22149999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.20515 38.0 38.0 38.0 37.0 38.0 55-59 37.067099999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.0846 38.0 38.0 38.0 36.2 38.0 65-69 36.971000000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.8172 38.0 38.0 38.0 35.8 38.0 75-79 36.806 38.0 38.0 38.0 35.4 38.0 80-84 36.7347 38.0 38.0 38.0 35.0 38.0 85-89 36.6845 38.0 38.0 38.0 34.8 38.0 90-94 36.594100000000005 38.0 38.0 38.0 34.2 38.0 95-99 36.47205 38.0 38.0 38.0 34.0 38.0 100-104 36.26625 38.0 37.8 38.0 33.8 38.0 105-109 36.10595 38.0 37.4 38.0 33.6 38.0 110-114 35.97325 38.0 37.0 38.0 32.8 38.0 115-119 35.712050000000005 38.0 37.0 38.0 31.0 38.0 120-124 35.4449 38.0 36.2 38.0 30.2 38.0 125-129 35.111599999999996 38.0 35.4 38.0 29.2 38.0 130-134 34.877449999999996 38.0 35.0 38.0 27.8 38.0 135-139 34.634249999999994 38.0 35.0 38.0 27.4 38.0 140-144 34.22865 38.0 34.6 38.0 25.6 38.0 145-149 33.4799 38.0 34.0 38.0 19.4 38.0 150-151 29.148375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 3.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 10.0 20 8.0 21 4.0 22 8.0 23 5.0 24 12.0 25 8.0 26 18.0 27 25.0 28 21.0 29 23.0 30 31.0 31 52.0 32 70.0 33 99.0 34 142.0 35 272.0 36 791.0 37 2382.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.449999999999996 14.975 19.225 31.35 2 24.224999999999998 21.025 35.925000000000004 18.825 3 20.825 26.075 31.175000000000004 21.925 4 23.925 33.925 21.25 20.9 5 22.725 36.825 21.675 18.775 6 17.7 36.775000000000006 25.2 20.325 7 17.175 16.275000000000002 44.15 22.400000000000002 8 20.925 21.025 27.325 30.725 9 21.099999999999998 23.599999999999998 29.575000000000003 25.724999999999998 10-14 22.634999999999998 28.189999999999998 26.255 22.919999999999998 15-19 23.175 27.435 27.450000000000003 21.94 20-24 22.445 27.93 27.810000000000002 21.815 25-29 23.205000000000002 28.000000000000004 27.834999999999997 20.96 30-34 22.93 27.634999999999998 27.93 21.505 35-39 23.055 28.075 27.85 21.02 40-44 23.32 27.779999999999998 27.900000000000002 21.0 45-49 23.28 27.985 27.725 21.01 50-54 22.755 27.694999999999997 27.825 21.725 55-59 23.285 27.544999999999998 28.389999999999997 20.78 60-64 22.66 28.015 28.105000000000004 21.22 65-69 23.505000000000003 27.805000000000003 27.495000000000005 21.195 70-74 23.395 28.335 27.105 21.165 75-79 23.04 28.23 28.050000000000004 20.68 80-84 23.575 27.32 27.939999999999998 21.165 85-89 23.200000000000003 27.455000000000002 28.215 21.13 90-94 22.994999999999997 27.77 28.1 21.135 95-99 23.215 28.48 27.544999999999998 20.76 100-104 23.419999999999998 28.485 27.68 20.415 105-109 23.125 28.035 27.915 20.925 110-114 23.115 27.74 28.384999999999998 20.76 115-119 23.695 27.425 28.055000000000003 20.825 120-124 24.18 27.415 27.800000000000004 20.605 125-129 24.02 28.025 27.405 20.549999999999997 130-134 23.835 27.529999999999998 27.98 20.655 135-139 24.46 27.73 27.765 20.044999999999998 140-144 25.430000000000003 27.36 27.47 19.74 145-149 24.81 27.750000000000004 27.415 20.025000000000002 150-151 24.6 27.975 27.474999999999998 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 3.0 26 3.5 27 4.5 28 9.0 29 9.0 30 12.5 31 21.0 32 24.5 33 30.0 34 44.5 35 63.5 36 83.0 37 99.5 38 125.5 39 154.0 40 173.0 41 214.5 42 257.0 43 267.0 44 273.5 45 277.5 46 282.0 47 259.5 48 225.5 49 210.0 50 178.5 51 137.0 52 117.0 53 103.0 54 75.0 55 62.5 56 49.5 57 37.0 58 27.5 59 15.5 60 14.0 61 13.5 62 8.5 63 5.5 64 5.5 65 4.5 66 2.0 67 2.0 68 3.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.225 0.0 0.0 0.0 0.0 132-133 3.65 0.0 0.0 0.0 0.0 134-135 3.9625 0.0 0.0 0.0 0.0 136-137 4.3875 0.0 0.0 0.0 0.0 138-139 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTCCA 10 0.006830828 145.0 8 TAGGGAA 10 0.006830828 145.0 145 >>END_MODULE Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra Read 535563 spots for SRR7172134.sra Written 535563 spots for SRR7172134.sra Read 535550 spots for SRR7172134.sra Written 535550 spots for SRR7172134.sra SRR ids: ['SRR7172134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c4_v2tyb SRR7172134.sra spots: 10711013 blocks: [[1, 535550], [535551, 1071100], [1071101, 1606650], [1606651, 2142200], [2142201, 2677750], [2677751, 3213300], [3213301, 3748850], [3748851, 4284400], [4284401, 4819950], [4819951, 5355500], [5355501, 5891050], [5891051, 6426600], [6426601, 6962150], [6962151, 7497700], [7497701, 8033250], [8033251, 8568800], [8568801, 9104350], [9104351, 9639900], [9639901, 10175450], [10175451, 10711013]] SRR7172134 file size 3607910 SRR7172134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172134 SRR7172134_1.fastq SRR7172134_2.fastq Input file: SRR7172134_1.fastq Paired file: SRR7172134_2.fastq trimmed: SRR7172134-trimmed-pair1.fastq, SRR7172134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:42:32 2025 >> started Fri Feb 14 07:42:43 2025 >> done (11.290s) 10711013 read pairs processed; of these: 6980 ( 0.07%) short read pairs filtered out after trimming by size control 3925 ( 0.04%) empty read pairs filtered out after trimming by size control 10700108 (99.90%) read pairs available; of these: 6296376 (58.84%) trimmed read pairs available after processing 4403732 (41.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 3 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 3 0.00% 28 2 0.00% 29 5 0.00% 30 4 0.00% 31 2 0.00% 32 1 0.00% 33 4 0.00% 34 3 0.00% 35 6 0.00% 36 7 0.00% 37 5 0.00% 38 6 0.00% 39 8 0.00% 40 5 0.00% 41 6 0.00% 42 10 0.00% 43 3 0.00% 44 6 0.00% 45 7 0.00% 46 6 0.00% 47 10 0.00% 48 7 0.00% 49 10 0.00% 50 17 0.00% 51 21 0.00% 52 17 0.00% 53 27 0.00% 54 32 0.00% 55 27 0.00% 56 33 0.00% 57 42 0.00% 58 45 0.00% 59 39 0.00% 60 45 0.00% 61 65 0.00% 62 69 0.00% 63 75 0.00% 64 68 0.00% 65 101 0.00% 66 87 0.00% 67 108 0.00% 68 143 0.00% 69 144 0.00% 70 161 0.00% 71 181 0.00% 72 200 0.00% 73 234 0.00% 74 248 0.00% 75 321 0.00% 76 435 0.00% 77 427 0.00% 78 481 0.00% 79 559 0.01% 80 582 0.01% 81 698 0.01% 82 807 0.01% 83 999 0.01% 84 1323 0.01% 85 1555 0.01% 86 1798 0.02% 87 2091 0.02% 88 2266 0.02% 89 2380 0.02% 90 2373 0.02% 91 2578 0.02% 92 2928 0.03% 93 3116 0.03% 94 3314 0.03% 95 3776 0.04% 96 4034 0.04% 97 4359 0.04% 98 4527 0.04% 99 4997 0.05% 100 5381 0.05% 101 5797 0.05% 102 6506 0.06% 103 6805 0.06% 104 7299 0.07% 105 7982 0.07% 106 8565 0.08% 107 9013 0.08% 108 9629 0.09% 109 10323 0.10% 110 11001 0.10% 111 11675 0.11% 112 12252 0.11% 113 12891 0.12% 114 13967 0.13% 115 14757 0.14% 116 15546 0.15% 117 16404 0.15% 118 17145 0.16% 119 17835 0.17% 120 19033 0.18% 121 20078 0.19% 122 20860 0.19% 123 22140 0.21% 124 23393 0.22% 125 24884 0.23% 126 26177 0.24% 127 27896 0.26% 128 29468 0.28% 129 31681 0.30% 130 33619 0.31% 131 35667 0.33% 132 37970 0.35% 133 40964 0.38% 134 43926 0.41% 135 46608 0.44% 136 50094 0.47% 137 54848 0.51% 138 59426 0.56% 139 64726 0.60% 140 72481 0.68% 141 82130 0.77% 142 93933 0.88% 143 110817 1.04% 144 133882 1.25% 145 165772 1.55% 146 218029 2.04% 147 312350 2.92% 148 492015 4.60% 149 903229 8.44% 150 2722412 25.44% 151 4403732 41.16% 10700108 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=27 prefix-density=0.26 prefix-fanout=2.5 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=72.10 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.0 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACAT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=66.01 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=17.4 sequence=TTGTTGGTGATGG SRR7172134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:43:32 Started mapping on | Feb 14 07:43:33 Finished on | Feb 14 07:46:01 Mapping speed, Million of reads per hour | 260.27 Number of input reads | 10700108 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9415150 Uniquely mapped reads % | 87.99% Average mapped length | 294.18 Number of splices: Total | 8963327 Number of splices: Annotated (sjdb) | 8789536 Number of splices: GT/AG | 8818494 Number of splices: GC/AG | 112093 Number of splices: AT/AC | 7259 Number of splices: Non-canonical | 25481 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296005 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 31689 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.81% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 996639 996639 996639 N_multimapping 296005 296005 296005 N_noFeature 284590 9332166 320352 N_ambiguous 102049 357 54679 UnstrandedReadsAssigned:9028511 PositiveStrandReadsAssigned:82627 NegativeStrandReadsAssigned:9040119 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172134-trimmed-pair1.fastq SRR7172134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,700,108 reads, 8,975,833 reads pseudoaligned [quant] estimated average fragment length: 248.695 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7172134.ke.tsv 34699 SRR7172134.se.tsv 87100 total ==> SRR7172134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.31 1248 76.7503 Potri.005G024800.1.v4.1 1035 787.305 305 42.1765 Potri.004G059700.1.v4.1 961 713.311 16 2.44205 Potri.007G009000.2.v4.1 1416 1168.31 0 0 Potri.003G141000.2.v4.1 2943 2695.31 258.291 10.4331 Potri.016G087400.1.v4.1 270 76.4149 425 605.515 Potri.015G069301.1.v4.1 564 320.709 0 0 Potri.010G195200.1.v4.1 1773 1525.31 228 16.2739 Potri.012G127500.1.v4.1 977 729.305 6179 922.407 ==> SRR7172134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 64 SRR7172134 completed mapping pipeline successfully