Starting /dee2/code/volunteer_pipeline.sh SRR7172135 current disk space = 3117407387648 free memory = 1582160672 SRR7172135 SRAfilesize 9e3b55ce3678edb090d6c7f7336ef047 SRR7172135.sra SRR7172135.sra file validated SRR7172135 is paired end SRR7172135 is conventional basespace SRR7172135 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38 33.0 33.0 33.0 32.0 34.0 2 28.26175 31.0 28.0 33.0 18.0 33.0 3 30.77125 31.0 29.0 33.0 27.0 33.0 4 32.17625 33.0 32.0 33.0 32.0 33.0 5 32.71925 33.0 33.0 33.0 32.0 34.0 6 36.63525 38.0 37.0 38.0 34.0 38.0 7 37.362 38.0 38.0 38.0 37.0 38.0 8 37.29325 38.0 38.0 38.0 37.0 38.0 9 37.46175 38.0 38.0 38.0 37.0 38.0 10-14 37.4773 38.0 38.0 38.0 37.4 38.0 15-19 37.4764 38.0 38.0 38.0 37.2 38.0 20-24 37.45309999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.34385 38.0 38.0 38.0 37.0 38.0 30-34 37.060550000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.7984 38.0 38.0 38.0 34.8 38.0 40-44 37.027499999999996 38.0 38.0 38.0 36.0 38.0 45-49 37.12325 38.0 38.0 38.0 36.4 38.0 50-54 37.217200000000005 38.0 38.0 38.0 36.4 38.0 55-59 37.229 38.0 38.0 38.0 36.8 38.0 60-64 37.26775 38.0 38.0 38.0 36.6 38.0 65-69 37.23525000000001 38.0 38.0 38.0 36.6 38.0 70-74 37.13095 38.0 38.0 38.0 36.0 38.0 75-79 36.99679999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.722699999999996 38.0 38.0 38.0 34.8 38.0 85-89 36.68515 38.0 38.0 38.0 34.6 38.0 90-94 36.563849999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.544799999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.55145 38.0 38.0 38.0 34.0 38.0 105-109 36.482150000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.290200000000006 38.0 37.8 38.0 34.0 38.0 115-119 36.1082 38.0 37.2 38.0 33.6 38.0 120-124 36.00695 38.0 37.0 38.0 32.8 38.0 125-129 35.58705 38.0 36.4 38.0 31.8 38.0 130-134 35.2356 38.0 36.0 38.0 30.6 38.0 135-139 34.954 38.0 35.6 38.0 29.8 38.0 140-144 34.090599999999995 38.0 34.4 38.0 24.4 38.0 145-149 33.27575 38.0 33.0 38.0 19.0 38.0 150-151 28.24775 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 3.0 18 2.0 19 3.0 20 3.0 21 4.0 22 5.0 23 6.0 24 6.0 25 16.0 26 15.0 27 29.0 28 29.0 29 46.0 30 48.0 31 64.0 32 64.0 33 132.0 34 169.0 35 305.0 36 643.0 37 2407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.15 14.875 16.275000000000002 40.699999999999996 2 17.2 27.0 39.675 16.125 3 18.925 30.65 25.275 25.15 4 19.900000000000002 39.175 20.05 20.875 5 20.375 38.824999999999996 22.275 18.525 6 16.150000000000002 37.824999999999996 24.575 21.45 7 12.625 19.925 45.425 22.025 8 17.525 20.925 30.349999999999998 31.2 9 17.075000000000003 21.925 31.5 29.5 10-14 19.392453207887097 30.367330597537784 26.41377239515564 23.82644379941948 15-19 19.635981799089954 29.211460573028653 27.991399569978498 23.161158057902895 20-24 19.74 29.275000000000002 27.615000000000002 23.369999999999997 25-29 19.67 28.665000000000003 28.144999999999996 23.52 30-34 20.31 28.65 27.72 23.32 35-39 19.75 29.445 27.43 23.375 40-44 19.88 29.459999999999997 27.505000000000003 23.155 45-49 19.66 29.285 27.439999999999998 23.615 50-54 19.759999999999998 29.89 27.395000000000003 22.955000000000002 55-59 20.0 29.475 26.93 23.595 60-64 20.474999999999998 28.615000000000002 27.845 23.064999999999998 65-69 20.005 29.275000000000002 27.565 23.155 70-74 20.52 29.26 27.224999999999998 22.994999999999997 75-79 20.415 29.01 27.015 23.56 80-84 20.29 29.215000000000003 27.275 23.22 85-89 19.935 28.54 27.825 23.7 90-94 20.4 29.310000000000002 27.150000000000002 23.14 95-99 19.85 28.87 28.22 23.06 100-104 19.939999999999998 28.865000000000002 27.74 23.455000000000002 105-109 20.424999999999997 28.625 27.615000000000002 23.335 110-114 20.218032704905735 29.35940391058659 27.35410311546732 23.068460269040354 115-119 20.651195358607584 28.353506051815547 27.628288486545966 23.367010103030907 120-124 20.86417283456691 28.720744148829763 27.525505101020205 22.889577915583118 125-129 21.083462674610725 28.047864617233266 27.156661493015573 23.71201121514044 130-134 20.96 28.22 27.779999999999998 23.04 135-139 21.095 28.335 26.924999999999997 23.645 140-144 21.044999999999998 28.825 26.905 23.225 145-149 21.395 28.27 27.13 23.205000000000002 150-151 22.1375 27.075 26.8375 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 3.0 25 4.0 26 6.0 27 11.5 28 12.0 29 16.0 30 28.0 31 38.5 32 43.0 33 55.0 34 81.5 35 106.5 36 105.5 37 106.5 38 139.5 39 171.0 40 200.5 41 222.0 42 230.5 43 256.5 44 268.5 45 267.5 46 272.0 47 243.5 48 215.5 49 191.5 50 153.5 51 130.0 52 114.5 53 81.0 54 55.5 55 47.0 56 32.0 57 23.0 58 17.0 59 9.5 60 5.5 61 4.5 62 5.5 63 4.5 64 3.0 65 3.0 66 2.5 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.09 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.015 115-119 0.03 120-124 0.02 125-129 0.135 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.137499999999999 0.0 0.0 0.0 0.0 132-133 4.4625 0.0 0.0 0.0 0.0 134-135 4.762499999999999 0.0 0.0 0.0 0.0 136-137 5.074999999999999 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTTC 10 0.006830828 145.0 9 TTAGCTT 10 0.006830828 145.0 8 >>END_MODULE SRR7172135 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94 33.0 33.0 34.0 32.0 34.0 2 33.08075 34.0 33.0 34.0 32.0 34.0 3 33.0835 34.0 33.0 34.0 32.0 34.0 4 33.0315 34.0 33.0 34.0 32.0 34.0 5 33.07025 34.0 33.0 34.0 32.0 34.0 6 37.175 38.0 38.0 38.0 37.0 38.0 7 37.24025 38.0 38.0 38.0 37.0 38.0 8 37.28825 38.0 38.0 38.0 37.0 38.0 9 37.34075 38.0 38.0 38.0 37.0 38.0 10-14 37.26965 38.0 38.0 38.0 37.0 38.0 15-19 37.19715000000001 38.0 38.0 38.0 36.8 38.0 20-24 37.13525 38.0 38.0 38.0 36.8 38.0 25-29 37.099900000000005 38.0 38.0 38.0 36.6 38.0 30-34 37.16605 38.0 38.0 38.0 37.0 38.0 35-39 37.057399999999994 38.0 38.0 38.0 36.6 38.0 40-44 37.022749999999995 38.0 38.0 38.0 36.4 38.0 45-49 37.0625 38.0 38.0 38.0 36.6 38.0 50-54 37.05649999999999 38.0 38.0 38.0 36.6 38.0 55-59 37.016 38.0 38.0 38.0 36.0 38.0 60-64 36.97575 38.0 38.0 38.0 36.0 38.0 65-69 36.9304 38.0 38.0 38.0 36.0 38.0 70-74 36.833749999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.824349999999995 38.0 38.0 38.0 35.4 38.0 80-84 36.6611 38.0 38.0 38.0 35.0 38.0 85-89 36.471199999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.292049999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.17635 38.0 38.0 38.0 33.6 38.0 100-104 36.06015 38.0 37.8 38.0 33.2 38.0 105-109 36.0543 38.0 37.6 38.0 33.4 38.0 110-114 35.98635 38.0 37.6 38.0 33.2 38.0 115-119 35.78529999999999 38.0 37.0 38.0 32.0 38.0 120-124 35.541199999999996 38.0 36.6 38.0 31.0 38.0 125-129 35.242000000000004 38.0 36.2 38.0 30.6 38.0 130-134 34.93885 38.0 36.0 38.0 28.8 38.0 135-139 34.31425 38.0 35.0 38.0 25.2 38.0 140-144 33.64190000000001 38.0 33.0 38.0 21.8 38.0 145-149 32.67594999999999 38.0 33.0 38.0 12.8 38.0 150-151 27.287 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 5.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 1.0 12 2.0 13 2.0 14 2.0 15 2.0 16 2.0 17 3.0 18 2.0 19 3.0 20 2.0 21 6.0 22 8.0 23 20.0 24 10.0 25 20.0 26 22.0 27 28.0 28 42.0 29 35.0 30 50.0 31 64.0 32 66.0 33 122.0 34 172.0 35 279.0 36 569.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.887359198998748 12.365456821026283 18.423028785982478 39.32415519399249 2 22.080520130032507 22.155538884721178 38.85971492873218 16.90422605651413 3 20.80520130032508 24.63115778944736 30.532633158289574 24.031007751937985 4 24.456114028507127 34.808702175543885 20.530132533133283 20.205051262815704 5 23.680920230057513 37.034258564641156 22.05551387846962 17.22930732683171 6 16.525000000000002 38.925 24.825 19.725 7 17.079269817454364 14.453613403350838 46.26156539134784 22.20555138784696 8 19.3 21.675 28.075 30.95 9 20.65 23.799999999999997 29.375 26.174999999999997 10-14 22.572900515180315 28.029810433651782 26.93942880008003 22.45786025108788 15-19 22.68293902866003 27.974791176911918 27.849747411594056 21.492522382833993 20-24 22.452245224522454 28.137813781378142 28.002800280028 21.407140714071407 25-29 22.33 27.965 27.93 21.775 30-34 22.645 27.87 28.455000000000002 21.029999999999998 35-39 22.220000000000002 27.97 28.384999999999998 21.425 40-44 22.985 27.88 28.084999999999997 21.05 45-49 22.84 28.095 28.199999999999996 20.865000000000002 50-54 22.675 27.884999999999998 28.32 21.12 55-59 22.975 27.339999999999996 28.59 21.095 60-64 22.919999999999998 28.505000000000003 28.395 20.18 65-69 23.35 27.810000000000002 27.915 20.925 70-74 23.200000000000003 27.57 28.389999999999997 20.84 75-79 22.939999999999998 27.779999999999998 28.575 20.705000000000002 80-84 23.355 27.189999999999998 28.53 20.925 85-89 23.330000000000002 27.91 27.98 20.78 90-94 22.82 27.939999999999998 28.77 20.47 95-99 23.775 27.675 27.944999999999997 20.605 100-104 23.595 28.01 28.189999999999998 20.205000000000002 105-109 23.64 27.98 28.115000000000002 20.265 110-114 23.48 27.83 28.299999999999997 20.39 115-119 23.46 27.99 28.415000000000003 20.135 120-124 23.52 27.845 28.335 20.3 125-129 23.849999999999998 28.27 28.050000000000004 19.830000000000002 130-134 24.08 27.63 27.810000000000002 20.48 135-139 23.97 27.83 28.189999999999998 20.01 140-144 24.585 28.000000000000004 27.72 19.695 145-149 24.625 28.01 27.74 19.625 150-151 25.35 26.674999999999997 28.075 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.0 23 0.5 24 4.0 25 5.5 26 2.5 27 4.0 28 6.5 29 10.5 30 16.5 31 16.5 32 22.0 33 36.0 34 48.0 35 58.5 36 75.0 37 110.0 38 141.0 39 161.5 40 190.0 41 219.5 42 262.5 43 300.0 44 299.5 45 289.5 46 285.0 47 267.5 48 230.5 49 184.5 50 158.0 51 128.5 52 104.0 53 96.0 54 72.5 55 53.0 56 39.0 57 29.5 58 19.5 59 9.5 60 10.5 61 7.0 62 4.0 63 6.0 64 5.0 65 3.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.034999999999999996 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.137499999999999 0.0 0.0 0.0 0.0 132-133 4.487500000000001 0.0 0.0 0.0 0.0 134-135 4.737500000000001 0.0 0.0 0.0 0.0 136-137 5.050000000000001 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTTCA 10 0.006830828 145.0 145 >>END_MODULE Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra Read 792027 spots for SRR7172135.sra Written 792027 spots for SRR7172135.sra SRR ids: ['SRR7172135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lfq7ja5f SRR7172135.sra spots: 15840540 blocks: [[1, 792027], [792028, 1584054], [1584055, 2376081], [2376082, 3168108], [3168109, 3960135], [3960136, 4752162], [4752163, 5544189], [5544190, 6336216], [6336217, 7128243], [7128244, 7920270], [7920271, 8712297], [8712298, 9504324], [9504325, 10296351], [10296352, 11088378], [11088379, 11880405], [11880406, 12672432], [12672433, 13464459], [13464460, 14256486], [14256487, 15048513], [15048514, 15840540]] SRR7172135 file size 5346138 SRR7172135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172135 SRR7172135_1.fastq SRR7172135_2.fastq Input file: SRR7172135_1.fastq Paired file: SRR7172135_2.fastq trimmed: SRR7172135-trimmed-pair1.fastq, SRR7172135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:49:39 2025 >> started Fri Feb 14 08:49:55 2025 >> done (16.588s) 15840540 read pairs processed; of these: 7492 ( 0.05%) short read pairs filtered out after trimming by size control 8027 ( 0.05%) empty read pairs filtered out after trimming by size control 15825021 (99.90%) read pairs available; of these: 9154298 (57.85%) trimmed read pairs available after processing 6670723 (42.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 7 0.00% 23 3 0.00% 24 3 0.00% 25 1 0.00% 26 11 0.00% 27 2 0.00% 28 1 0.00% 29 5 0.00% 30 7 0.00% 31 4 0.00% 32 7 0.00% 33 4 0.00% 34 8 0.00% 35 6 0.00% 36 8 0.00% 37 7 0.00% 38 8 0.00% 39 10 0.00% 40 8 0.00% 41 9 0.00% 42 9 0.00% 43 7 0.00% 44 10 0.00% 45 10 0.00% 46 12 0.00% 47 20 0.00% 48 22 0.00% 49 24 0.00% 50 28 0.00% 51 27 0.00% 52 26 0.00% 53 31 0.00% 54 35 0.00% 55 41 0.00% 56 91 0.00% 57 432 0.00% 58 193 0.00% 59 210 0.00% 60 160 0.00% 61 95 0.00% 62 161 0.00% 63 139 0.00% 64 165 0.00% 65 171 0.00% 66 203 0.00% 67 259 0.00% 68 304 0.00% 69 316 0.00% 70 355 0.00% 71 381 0.00% 72 395 0.00% 73 587 0.00% 74 556 0.00% 75 676 0.00% 76 820 0.01% 77 1108 0.01% 78 1533 0.01% 79 1339 0.01% 80 1408 0.01% 81 1520 0.01% 82 1641 0.01% 83 2248 0.01% 84 3963 0.03% 85 4231 0.03% 86 4139 0.03% 87 3848 0.02% 88 3909 0.02% 89 4282 0.03% 90 4502 0.03% 91 4951 0.03% 92 5392 0.03% 93 6079 0.04% 94 6618 0.04% 95 6978 0.04% 96 7824 0.05% 97 8487 0.05% 98 9097 0.06% 99 9664 0.06% 100 10305 0.07% 101 11766 0.07% 102 12073 0.08% 103 12510 0.08% 104 13435 0.08% 105 14366 0.09% 106 15319 0.10% 107 16623 0.11% 108 17459 0.11% 109 18228 0.12% 110 19326 0.12% 111 20329 0.13% 112 21465 0.14% 113 23053 0.15% 114 24368 0.15% 115 25821 0.16% 116 26837 0.17% 117 28555 0.18% 118 30139 0.19% 119 31551 0.20% 120 33069 0.21% 121 35032 0.22% 122 36876 0.23% 123 38447 0.24% 124 40810 0.26% 125 43238 0.27% 126 45363 0.29% 127 48060 0.30% 128 50192 0.32% 129 52881 0.33% 130 55446 0.35% 131 57562 0.36% 132 60940 0.39% 133 64429 0.41% 134 68219 0.43% 135 71911 0.45% 136 76670 0.48% 137 81993 0.52% 138 88605 0.56% 139 96773 0.61% 140 106416 0.67% 141 115993 0.73% 142 131873 0.83% 143 147355 0.93% 144 173013 1.09% 145 210663 1.33% 146 263726 1.67% 147 352505 2.23% 148 526623 3.33% 149 1019945 6.45% 150 4454286 28.15% 151 6670723 42.15% 15825021 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=44.72 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.4 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.76 fanout-score-rank=16 prefix-density=0.29 prefix-fanout=4.1 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=182.06 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.2 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATT SRR7172135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:51:01 Started mapping on | Feb 14 08:51:06 Finished on | Feb 14 08:52:52 Mapping speed, Million of reads per hour | 537.45 Number of input reads | 15825021 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 13881419 Uniquely mapped reads % | 87.72% Average mapped length | 285.82 Number of splices: Total | 13494113 Number of splices: Annotated (sjdb) | 13272578 Number of splices: GT/AG | 13272175 Number of splices: GC/AG | 173061 Number of splices: AT/AC | 10386 Number of splices: Non-canonical | 38491 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433448 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 37316 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.24% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1520932 1520932 1520932 N_multimapping 433448 433448 433448 N_noFeature 334459 13746167 399397 N_ambiguous 219537 1553 148098 UnstrandedReadsAssigned:13327423 PositiveStrandReadsAssigned:133699 NegativeStrandReadsAssigned:13333924 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172135-trimmed-pair1.fastq SRR7172135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,825,021 reads, 14,270,235 reads pseudoaligned [quant] estimated average fragment length: 230.494 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR7172135.ke.tsv 34699 SRR7172135.se.tsv 87100 total ==> SRR7172135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.51 871 35.6286 Potri.005G024800.1.v4.1 1035 805.506 257 23.3419 Potri.004G059700.1.v4.1 961 731.506 13 1.30016 Potri.007G009000.2.v4.1 1416 1186.51 0 0 Potri.003G141000.2.v4.1 2943 2713.51 387.241 10.4405 Potri.016G087400.1.v4.1 270 85.2568 733.771 629.655 Potri.015G069301.1.v4.1 564 337.609 0 0 Potri.010G195200.1.v4.1 1773 1543.51 140.511 6.65996 Potri.012G127500.1.v4.1 977 747.506 4075 398.826 ==> SRR7172135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 172 SRR7172135 completed mapping pipeline successfully