Starting /dee2/code/volunteer_pipeline.sh SRR7172136 current disk space = 3119156334592 free memory = 1485526484 SRR7172136 SRAfilesize e88f9db75eccc9342fe06a642e96e0a9 SRR7172136.sra SRR7172136.sra file validated SRR7172136 is paired end SRR7172136 is conventional basespace SRR7172136 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.17425 18.0 18.0 27.0 18.0 32.0 2 21.59775 18.0 18.0 27.0 18.0 32.0 3 23.964 25.0 18.0 27.0 18.0 29.0 4 25.44475 27.0 25.0 29.0 15.0 31.0 5 26.70475 29.0 25.0 31.0 15.0 33.0 6 30.4235 33.0 28.0 36.0 16.0 37.0 7 34.00175 36.0 33.0 37.0 28.0 38.0 8 36.3105 38.0 37.0 38.0 33.0 38.0 9 36.685 38.0 37.0 38.0 34.0 38.0 10-14 36.858050000000006 38.0 37.6 38.0 34.8 38.0 15-19 37.183 38.0 38.0 38.0 35.8 38.0 20-24 37.3411 38.0 38.0 38.0 36.6 38.0 25-29 37.372400000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.3532 38.0 38.0 38.0 37.0 38.0 35-39 37.28835 38.0 38.0 38.0 36.6 38.0 40-44 37.2204 38.0 38.0 38.0 36.0 38.0 45-49 37.2042 38.0 38.0 38.0 36.0 38.0 50-54 37.03275000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.97295 38.0 38.0 38.0 35.4 38.0 60-64 36.8485 38.0 38.0 38.0 35.0 38.0 65-69 36.823249999999994 38.0 38.0 38.0 35.0 38.0 70-74 36.76315 38.0 38.0 38.0 34.6 38.0 75-79 36.603550000000006 38.0 37.8 38.0 34.0 38.0 80-84 36.459450000000004 38.0 37.6 38.0 34.0 38.0 85-89 36.326550000000005 38.0 37.0 38.0 33.6 38.0 90-94 36.22135 38.0 37.0 38.0 33.2 38.0 95-99 36.085899999999995 38.0 37.0 38.0 32.6 38.0 100-104 35.96315 38.0 37.0 38.0 33.0 38.0 105-109 35.60850000000001 38.0 36.2 38.0 30.6 38.0 110-114 35.3778 38.0 36.0 38.0 29.0 38.0 115-119 35.244 38.0 36.0 38.0 28.6 38.0 120-124 35.0325 38.0 35.4 38.0 28.2 38.0 125-129 34.6183 38.0 35.0 38.0 26.6 38.0 130-134 34.34675 38.0 34.6 38.0 24.8 38.0 135-139 33.81135 38.0 34.0 38.0 22.6 38.0 140-144 33.162699999999994 38.0 33.6 38.0 17.4 38.0 145-149 32.39620000000001 37.6 33.0 38.0 14.0 38.0 150-151 28.480874999999997 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 3.0 18 1.0 19 4.0 20 4.0 21 6.0 22 6.0 23 7.0 24 11.0 25 9.0 26 25.0 27 22.0 28 31.0 29 49.0 30 51.0 31 78.0 32 124.0 33 186.0 34 331.0 35 600.0 36 1450.0 37 997.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.982928091050184 2.353854112778065 14.53698913605794 32.12622866011382 2 27.675 13.8 39.875 18.65 3 18.125 28.475 28.65 24.75 4 22.325 32.925 25.074999999999996 19.675 5 22.475 34.925 24.15 18.45 6 16.5 36.425000000000004 26.200000000000003 20.875 7 13.200000000000001 19.925 46.975 19.900000000000002 8 18.275 19.725 29.049999999999997 32.95 9 17.474999999999998 21.3 31.324999999999996 29.9 10-14 19.665 29.49 26.495 24.349999999999998 15-19 20.375 28.860000000000003 27.339999999999996 23.425 20-24 19.835 28.775000000000002 28.28 23.11 25-29 19.744999999999997 28.754999999999995 28.255000000000003 23.244999999999997 30-34 20.34 28.925 26.86 23.875 35-39 20.095 28.689999999999998 27.76 23.455000000000002 40-44 20.48 28.215 27.6 23.705000000000002 45-49 20.07 28.389999999999997 28.42 23.119999999999997 50-54 20.630000000000003 28.315 27.79 23.265 55-59 20.835 27.915 27.79 23.46 60-64 19.845 28.244999999999997 27.839999999999996 24.07 65-69 20.47 28.405 27.825 23.3 70-74 20.555 28.060000000000002 27.805000000000003 23.580000000000002 75-79 20.695 27.915 28.115000000000002 23.275000000000002 80-84 20.275000000000002 28.32 27.755000000000003 23.65 85-89 20.715 28.325 27.950000000000003 23.01 90-94 20.71 27.415 28.084999999999997 23.79 95-99 20.39 28.335 28.115000000000002 23.16 100-104 20.445 28.71 27.375 23.47 105-109 20.65 27.965 27.805000000000003 23.580000000000002 110-114 20.5 27.950000000000003 27.825 23.724999999999998 115-119 20.455000000000002 28.34 27.905 23.3 120-124 20.405 27.994999999999997 27.38 24.22 125-129 20.515 28.1 27.665 23.72 130-134 21.07 28.249999999999996 27.145000000000003 23.535 135-139 20.495 27.955000000000002 27.900000000000002 23.65 140-144 20.599999999999998 28.17 27.27 23.96 145-149 20.57 28.925 26.815 23.69 150-151 21.025 28.237499999999997 27.35 23.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 3.5 26 6.0 27 8.5 28 12.0 29 15.5 30 17.5 31 24.0 32 34.0 33 43.5 34 55.0 35 69.0 36 87.0 37 105.5 38 120.0 39 149.5 40 187.5 41 211.5 42 245.5 43 278.5 44 282.5 45 270.0 46 258.0 47 261.5 48 239.5 49 200.0 50 171.0 51 142.5 52 119.5 53 97.5 54 73.5 55 55.0 56 36.5 57 24.0 58 22.5 59 17.0 60 11.5 61 7.0 62 6.5 63 7.0 64 5.5 65 3.0 66 1.0 67 0.5 68 1.0 69 1.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.5249999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138-139 3.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTCG 10 0.0068343505 144.975 3 AAAGTCA 10 0.0068343505 144.975 4 TTGCTCC 10 0.0068343505 144.975 3 >>END_MODULE SRR7172136 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.939 33.0 33.0 34.0 32.0 34.0 2 32.99 33.0 33.0 34.0 32.0 34.0 3 33.1015 33.0 33.0 34.0 32.0 34.0 4 33.08825 34.0 33.0 34.0 32.0 34.0 5 32.9875 33.0 33.0 34.0 32.0 34.0 6 37.15175 38.0 38.0 38.0 36.0 38.0 7 37.343 38.0 38.0 38.0 37.0 38.0 8 37.26725 38.0 38.0 38.0 37.0 38.0 9 37.289 38.0 38.0 38.0 37.0 38.0 10-14 37.3007 38.0 38.0 38.0 37.0 38.0 15-19 37.281 38.0 38.0 38.0 37.0 38.0 20-24 37.2504 38.0 38.0 38.0 37.0 38.0 25-29 37.1917 38.0 38.0 38.0 36.2 38.0 30-34 37.1928 38.0 38.0 38.0 36.6 38.0 35-39 37.06255 38.0 38.0 38.0 35.8 38.0 40-44 37.126599999999996 38.0 38.0 38.0 36.2 38.0 45-49 37.061949999999996 38.0 38.0 38.0 36.0 38.0 50-54 37.007600000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.95875 38.0 38.0 38.0 35.8 38.0 60-64 36.887600000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.789049999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.77715 38.0 38.0 38.0 35.0 38.0 75-79 36.6 38.0 38.0 38.0 34.0 38.0 80-84 36.46125 38.0 38.0 38.0 34.0 38.0 85-89 36.42355 38.0 37.8 38.0 34.0 38.0 90-94 36.241249999999994 38.0 37.0 38.0 33.8 38.0 95-99 36.0554 38.0 37.0 38.0 33.0 38.0 100-104 35.9743 38.0 37.0 38.0 32.8 38.0 105-109 35.706700000000005 38.0 37.0 38.0 31.0 38.0 110-114 35.4895 38.0 36.0 38.0 30.2 38.0 115-119 35.26424999999999 38.0 36.0 38.0 29.0 38.0 120-124 35.009 38.0 35.2 38.0 28.0 38.0 125-129 34.435500000000005 38.0 35.0 38.0 24.6 38.0 130-134 34.231199999999994 38.0 34.4 38.0 23.8 38.0 135-139 33.802049999999994 38.0 34.0 38.0 22.6 38.0 140-144 33.0779 38.0 33.0 38.0 17.0 38.0 145-149 32.0532 37.6 31.8 38.0 11.2 38.0 150-151 27.547875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 3.0 17 5.0 18 3.0 19 3.0 20 6.0 21 6.0 22 11.0 23 7.0 24 13.0 25 13.0 26 14.0 27 30.0 28 29.0 29 51.0 30 52.0 31 82.0 32 101.0 33 120.0 34 244.0 35 377.0 36 938.0 37 1886.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6 13.875000000000002 16.725 32.800000000000004 2 22.7 22.325 36.199999999999996 18.775 3 20.8 26.224999999999998 30.7 22.275 4 24.925 35.625 19.950000000000003 19.5 5 23.7 37.724999999999994 21.45 17.125 6 17.575 38.95 22.95 20.525 7 15.8 15.725 46.2 22.275 8 20.825 21.475 28.525 29.175 9 22.35 23.7 27.150000000000002 26.8 10-14 22.68 28.88 26.77 21.67 15-19 22.86 28.455000000000002 27.54 21.145 20-24 22.895 28.63 27.425 21.05 25-29 22.95 28.415000000000003 27.375 21.26 30-34 22.98 28.794999999999998 27.175 21.05 35-39 22.939999999999998 28.04 27.97 21.05 40-44 23.04 27.815 28.235 20.91 45-49 23.07 27.82 28.03 21.08 50-54 23.115 28.005000000000003 28.21 20.669999999999998 55-59 22.78 28.04 28.139999999999997 21.04 60-64 23.085 27.985 27.82 21.11 65-69 23.195 27.41 28.29 21.105 70-74 22.805 27.665 27.425 22.105 75-79 23.59 27.634999999999998 27.894999999999996 20.880000000000003 80-84 23.415 27.73 27.825 21.029999999999998 85-89 22.965 28.62 27.755000000000003 20.66 90-94 23.03 28.275 27.900000000000002 20.794999999999998 95-99 23.02 28.415000000000003 27.54 21.025 100-104 23.53 27.735 27.950000000000003 20.785 105-109 24.345 27.73 27.935 19.99 110-114 23.015 27.975 28.415000000000003 20.595 115-119 23.74 27.665 27.725 20.87 120-124 23.544999999999998 27.794999999999998 27.845 20.815 125-129 23.51 27.694999999999997 28.110000000000003 20.685000000000002 130-134 24.240000000000002 27.715 27.36 20.685000000000002 135-139 23.875 28.08 27.884999999999998 20.16 140-144 24.060000000000002 27.750000000000004 27.76 20.43 145-149 24.57 28.215 26.915 20.3 150-151 23.962500000000002 28.799999999999997 26.424999999999997 20.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.5 24 2.5 25 0.5 26 1.5 27 4.0 28 6.5 29 10.0 30 13.0 31 21.0 32 27.5 33 34.0 34 43.0 35 58.5 36 72.0 37 97.0 38 139.5 39 166.5 40 202.5 41 238.0 42 237.0 43 253.0 44 275.0 45 282.5 46 277.0 47 257.0 48 240.0 49 220.5 50 198.5 51 152.0 52 118.0 53 93.5 54 59.5 55 44.0 56 41.0 57 30.0 58 20.5 59 17.5 60 14.5 61 9.5 62 4.5 63 3.5 64 2.5 65 2.0 66 2.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.5249999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0250000000000004 0.0 0.0 0.0 0.0 126-127 2.2125000000000004 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 2.9749999999999996 0.0 0.0 0.0 0.0 136-137 3.1625 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563929 spots for SRR7172136.sra Written 563929 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra Read 563915 spots for SRR7172136.sra Written 563915 spots for SRR7172136.sra SRR ids: ['SRR7172136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rjh2h4e9 SRR7172136.sra spots: 11278314 blocks: [[1, 563915], [563916, 1127830], [1127831, 1691745], [1691746, 2255660], [2255661, 2819575], [2819576, 3383490], [3383491, 3947405], [3947406, 4511320], [4511321, 5075235], [5075236, 5639150], [5639151, 6203065], [6203066, 6766980], [6766981, 7330895], [7330896, 7894810], [7894811, 8458725], [8458726, 9022640], [9022641, 9586555], [9586556, 10150470], [10150471, 10714385], [10714386, 11278314]] SRR7172136 file size 3800150 SRR7172136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172136 SRR7172136_1.fastq SRR7172136_2.fastq Input file: SRR7172136_1.fastq Paired file: SRR7172136_2.fastq trimmed: SRR7172136-trimmed-pair1.fastq, SRR7172136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:43:11 2025 >> started Fri Feb 14 07:43:24 2025 >> done (12.591s) 11278314 read pairs processed; of these: 4808 ( 0.04%) short read pairs filtered out after trimming by size control 4715 ( 0.04%) empty read pairs filtered out after trimming by size control 11268791 (99.92%) read pairs available; of these: 7310429 (64.87%) trimmed read pairs available after processing 3958362 (35.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 4 0.00% 22 3 0.00% 23 3 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 1 0.00% 28 2 0.00% 29 4 0.00% 30 2 0.00% 31 6 0.00% 32 3 0.00% 33 7 0.00% 34 5 0.00% 35 7 0.00% 36 4 0.00% 37 9 0.00% 38 6 0.00% 39 3 0.00% 40 9 0.00% 41 6 0.00% 42 9 0.00% 43 7 0.00% 44 6 0.00% 45 8 0.00% 46 9 0.00% 47 18 0.00% 48 24 0.00% 49 16 0.00% 50 26 0.00% 51 24 0.00% 52 28 0.00% 53 30 0.00% 54 47 0.00% 55 37 0.00% 56 57 0.00% 57 42 0.00% 58 56 0.00% 59 73 0.00% 60 74 0.00% 61 57 0.00% 62 105 0.00% 63 113 0.00% 64 112 0.00% 65 117 0.00% 66 131 0.00% 67 147 0.00% 68 185 0.00% 69 212 0.00% 70 240 0.00% 71 252 0.00% 72 330 0.00% 73 352 0.00% 74 398 0.00% 75 441 0.00% 76 482 0.00% 77 528 0.00% 78 568 0.01% 79 741 0.01% 80 819 0.01% 81 978 0.01% 82 1067 0.01% 83 1204 0.01% 84 1598 0.01% 85 1795 0.02% 86 2053 0.02% 87 2271 0.02% 88 2441 0.02% 89 2601 0.02% 90 2759 0.02% 91 3063 0.03% 92 3316 0.03% 93 3707 0.03% 94 3976 0.04% 95 4182 0.04% 96 4604 0.04% 97 4762 0.04% 98 5234 0.05% 99 5562 0.05% 100 6024 0.05% 101 6426 0.06% 102 7182 0.06% 103 7476 0.07% 104 8084 0.07% 105 8702 0.08% 106 9311 0.08% 107 9777 0.09% 108 10392 0.09% 109 10920 0.10% 110 11693 0.10% 111 12436 0.11% 112 13094 0.12% 113 14112 0.13% 114 15013 0.13% 115 15879 0.14% 116 16862 0.15% 117 18007 0.16% 118 18934 0.17% 119 19608 0.17% 120 20877 0.19% 121 22371 0.20% 122 23854 0.21% 123 25306 0.22% 124 27318 0.24% 125 29204 0.26% 126 31169 0.28% 127 33101 0.29% 128 35105 0.31% 129 37974 0.34% 130 40663 0.36% 131 44302 0.39% 132 47783 0.42% 133 52073 0.46% 134 56970 0.51% 135 62182 0.55% 136 67696 0.60% 137 74471 0.66% 138 82896 0.74% 139 92543 0.82% 140 103302 0.92% 141 117876 1.05% 142 137181 1.22% 143 160200 1.42% 144 194077 1.72% 145 241438 2.14% 146 311251 2.76% 147 422982 3.75% 148 628188 5.57% 149 1061855 9.42% 150 2720096 24.14% 151 3958362 35.13% 11268791 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=23 prefix-density=0.61 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=77.90 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=16.2 sequence=TCCTTCTTCTCCACGCTCTTGATAACTCCCACAGCAACGGTCTGGCGCATGTCCCTCACAGCAAAACGACCAAG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=22 prefix-density=0.61 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=26.69 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=3.5 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:44:08 Started mapping on | Feb 14 07:44:09 Finished on | Feb 14 07:45:48 Mapping speed, Million of reads per hour | 409.77 Number of input reads | 11268791 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10513501 Uniquely mapped reads % | 93.30% Average mapped length | 292.77 Number of splices: Total | 10734134 Number of splices: Annotated (sjdb) | 10550209 Number of splices: GT/AG | 10566801 Number of splices: GC/AG | 131973 Number of splices: AT/AC | 7482 Number of splices: Non-canonical | 27878 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316497 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 35084 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 444278 444278 444278 N_multimapping 316497 316497 316497 N_noFeature 271247 10396443 334369 N_ambiguous 119913 567 65732 UnstrandedReadsAssigned:10122341 PositiveStrandReadsAssigned:116491 NegativeStrandReadsAssigned:10113400 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172136-trimmed-pair1.fastq SRR7172136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,268,791 reads, 9,979,470 reads pseudoaligned [quant] estimated average fragment length: 253.658 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7172136.ke.tsv 34699 SRR7172136.se.tsv 87100 total ==> SRR7172136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.34 603 31.0664 Potri.005G024800.1.v4.1 1035 782.342 181 21.0419 Potri.004G059700.1.v4.1 961 708.362 49 6.29134 Potri.007G009000.2.v4.1 1416 1163.34 0 0 Potri.003G141000.2.v4.1 2943 2690.34 378.333 12.79 Potri.016G087400.1.v4.1 270 74.913 631.941 767.224 Potri.015G069301.1.v4.1 564 316.921 0 0 Potri.010G195200.1.v4.1 1773 1520.34 158 9.45189 Potri.012G127500.1.v4.1 977 724.352 1903 238.942 ==> SRR7172136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 156 SRR7172136 completed mapping pipeline successfully