Starting /dee2/code/volunteer_pipeline.sh SRR7172137 current disk space = 3110541840384 free memory = 1574792528 SRR7172137 SRAfilesize 81fbc0dc28cf806648d96f69dd7246b1 SRR7172137.sra SRR7172137.sra file validated SRR7172137 is paired end SRR7172137 is conventional basespace SRR7172137 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86825 33.0 33.0 34.0 32.0 34.0 2 32.909 34.0 33.0 34.0 31.0 34.0 3 33.03825 34.0 33.0 34.0 31.0 34.0 4 33.15075 34.0 33.0 34.0 32.0 34.0 5 33.203 34.0 33.0 34.0 33.0 34.0 6 36.9445 38.0 37.0 38.0 35.0 38.0 7 37.187 38.0 38.0 38.0 36.0 38.0 8 37.30375 38.0 38.0 38.0 37.0 38.0 9 37.3635 38.0 38.0 38.0 37.0 38.0 10-14 37.45345 38.0 38.0 38.0 37.2 38.0 15-19 37.4812 38.0 38.0 38.0 37.2 38.0 20-24 37.409549999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.244749999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.0313 38.0 38.0 38.0 36.0 38.0 35-39 36.70715 38.0 37.8 38.0 34.4 38.0 40-44 36.94285 38.0 38.0 38.0 35.8 38.0 45-49 37.05030000000001 38.0 38.0 38.0 36.2 38.0 50-54 37.200100000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.212199999999996 38.0 38.0 38.0 36.6 38.0 60-64 37.21365 38.0 38.0 38.0 36.4 38.0 65-69 37.1763 38.0 38.0 38.0 36.4 38.0 70-74 37.05994999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.899350000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.7408 38.0 38.0 38.0 35.2 38.0 85-89 36.66385 38.0 38.0 38.0 34.6 38.0 90-94 36.46875000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.5388 38.0 38.0 38.0 34.0 38.0 100-104 36.46445 38.0 38.0 38.0 34.0 38.0 105-109 36.3854 38.0 37.8 38.0 34.0 38.0 110-114 36.23539999999999 38.0 37.6 38.0 34.0 38.0 115-119 36.03615 38.0 37.0 38.0 33.0 38.0 120-124 35.94105 38.0 37.0 38.0 32.4 38.0 125-129 35.4927 38.0 36.4 38.0 31.0 38.0 130-134 35.1298 38.0 36.0 38.0 29.2 38.0 135-139 34.79795 38.0 35.6 38.0 28.6 38.0 140-144 33.954750000000004 38.0 33.6 38.0 23.2 38.0 145-149 33.161300000000004 38.0 33.0 38.0 17.6 38.0 150-151 28.4515 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 3.0 17 2.0 18 2.0 19 4.0 20 1.0 21 4.0 22 5.0 23 12.0 24 9.0 25 13.0 26 18.0 27 14.0 28 43.0 29 41.0 30 32.0 31 53.0 32 87.0 33 121.0 34 186.0 35 283.0 36 632.0 37 2428.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.875 15.174999999999999 16.75 38.2 2 19.975 23.275000000000002 39.65 17.1 3 18.525 29.725 27.625 24.125 4 20.375 36.425000000000004 22.85 20.349999999999998 5 21.325 36.875 23.799999999999997 18.0 6 16.125 37.875 24.9 21.099999999999998 7 12.2 19.05 47.175 21.575 8 16.175 22.45 29.15 32.225 9 18.3 21.9 30.3 29.5 10-14 19.2636686508929 30.00350157570907 27.157220749337203 23.575609024060828 15-19 19.175 29.125 28.51 23.189999999999998 20-24 18.965 28.625 28.785 23.625 25-29 19.455 28.615000000000002 28.835 23.095 30-34 19.56 28.904999999999998 27.785 23.75 35-39 19.950000000000003 28.720000000000002 27.644999999999996 23.685000000000002 40-44 19.794999999999998 28.835 27.950000000000003 23.419999999999998 45-49 19.685 28.494999999999997 27.62 24.2 50-54 19.24 28.365000000000002 28.084999999999997 24.310000000000002 55-59 20.03 28.125 28.335 23.51 60-64 19.325 28.76 28.02 23.895 65-69 19.715 28.365000000000002 28.499999999999996 23.419999999999998 70-74 20.19 28.015 28.275 23.52 75-79 20.080000000000002 28.345 28.16 23.415 80-84 19.905 28.225 28.655 23.215 85-89 20.145 28.18 28.285 23.39 90-94 20.035 27.96 28.384999999999998 23.62 95-99 20.11 28.725 27.51 23.655 100-104 19.725 28.53 28.615000000000002 23.13 105-109 20.195 28.599999999999998 27.915 23.29 110-114 20.06901380276055 28.790758151630325 28.180636127225444 22.959591918383676 115-119 20.957095709570957 27.912791279127912 28.06780678067807 23.06230623062306 120-124 19.85393427042169 28.34775649042069 27.85253364013806 23.94577559901956 125-129 20.078187650360864 28.24278267842823 28.29290296712109 23.386126704089815 130-134 20.695 28.625 27.310000000000002 23.369999999999997 135-139 20.46 28.910000000000004 27.025 23.605 140-144 20.025000000000002 29.099999999999998 27.150000000000002 23.724999999999998 145-149 20.57 28.465 27.52 23.445 150-151 20.8625 28.1375 28.0625 22.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 5.5 25 5.5 26 5.0 27 8.5 28 12.5 29 18.5 30 20.0 31 28.5 32 41.5 33 55.0 34 68.5 35 76.5 36 102.5 37 126.0 38 151.5 39 189.5 40 216.5 41 234.0 42 247.5 43 266.0 44 280.5 45 277.0 46 250.0 47 243.5 48 224.0 49 164.0 50 143.5 51 130.0 52 87.5 53 67.5 54 53.0 55 40.0 56 37.0 57 27.5 58 19.0 59 15.0 60 14.5 61 10.0 62 7.0 63 4.5 64 2.0 65 2.0 66 2.5 67 2.5 68 1.0 69 0.0 70 1.0 71 2.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.045 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.01 120-124 0.045 125-129 0.24 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.2125000000000004 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAATTA 10 0.006830828 145.0 3 AGATAAC 10 0.006830828 145.0 5 >>END_MODULE SRR7172137 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7705 33.0 33.0 34.0 32.0 34.0 2 32.92425 34.0 33.0 34.0 32.0 34.0 3 32.96475 34.0 33.0 34.0 32.0 34.0 4 32.9085 34.0 33.0 34.0 32.0 34.0 5 32.9555 34.0 33.0 34.0 32.0 34.0 6 37.03725 38.0 38.0 38.0 36.0 38.0 7 37.1775 38.0 38.0 38.0 37.0 38.0 8 37.16775 38.0 38.0 38.0 37.0 38.0 9 37.16975 38.0 38.0 38.0 37.0 38.0 10-14 37.14275 38.0 38.0 38.0 37.0 38.0 15-19 37.04755 38.0 38.0 38.0 36.8 38.0 20-24 37.005449999999996 38.0 38.0 38.0 36.6 38.0 25-29 37.014 38.0 38.0 38.0 36.6 38.0 30-34 37.03775 38.0 38.0 38.0 36.8 38.0 35-39 36.9615 38.0 38.0 38.0 36.0 38.0 40-44 36.8669 38.0 38.0 38.0 36.0 38.0 45-49 36.96874999999999 38.0 38.0 38.0 36.2 38.0 50-54 37.010149999999996 38.0 38.0 38.0 36.6 38.0 55-59 36.9034 38.0 38.0 38.0 36.0 38.0 60-64 36.898649999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.76559999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.69025 38.0 38.0 38.0 35.4 38.0 75-79 36.592200000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.56665 38.0 38.0 38.0 34.8 38.0 85-89 36.3388 38.0 38.0 38.0 34.0 38.0 90-94 36.256099999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.093849999999996 38.0 37.8 38.0 33.6 38.0 100-104 36.033 38.0 38.0 38.0 33.4 38.0 105-109 35.95865 38.0 37.8 38.0 33.0 38.0 110-114 35.793499999999995 38.0 37.8 38.0 32.6 38.0 115-119 35.591150000000006 38.0 37.0 38.0 31.0 38.0 120-124 35.31595 38.0 36.6 38.0 30.4 38.0 125-129 35.071299999999994 38.0 36.2 38.0 29.6 38.0 130-134 34.788799999999995 38.0 36.0 38.0 28.2 38.0 135-139 34.0908 38.0 34.4 38.0 23.6 38.0 140-144 33.5095 38.0 33.2 38.0 20.6 38.0 145-149 32.72239999999999 38.0 33.0 38.0 13.6 38.0 150-151 27.3265 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 0.0 5 2.0 6 1.0 7 2.0 8 2.0 9 2.0 10 1.0 11 3.0 12 2.0 13 3.0 14 1.0 15 2.0 16 1.0 17 4.0 18 2.0 19 6.0 20 7.0 21 11.0 22 13.0 23 13.0 24 19.0 25 13.0 26 26.0 27 23.0 28 23.0 29 49.0 30 50.0 31 63.0 32 86.0 33 105.0 34 152.0 35 263.0 36 605.0 37 2434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.09375783404362 14.189019804462271 19.00225620456255 32.71496615693156 2 22.76707530647986 22.86715036277208 37.65323992994746 16.7125344008006 3 21.31598699024268 25.869402051538653 30.92319239429572 21.891418563922944 4 25.03125781445361 33.48337084271068 22.20555138784696 19.279819954988746 5 24.88122030507627 37.184296074018505 20.630157539384847 17.30432608152038 6 17.175 38.35 24.6 19.875 7 16.779194798699677 16.35408852213053 46.41160290072518 20.455113778444613 8 20.3 22.85 27.500000000000004 29.349999999999998 9 22.175 24.4 28.325 25.1 10-14 22.819832891379395 29.539200480312207 26.312102866863462 21.32886376144494 15-19 22.85328262610088 28.012409927942354 28.3226581265012 20.811649319455565 20-24 23.178476771515726 28.55428314247137 28.004200630094516 20.26303945591839 25-29 22.61 28.22 28.384999999999998 20.785 30-34 22.46 28.084999999999997 28.68 20.775 35-39 23.205000000000002 28.084999999999997 28.125 20.585 40-44 23.43 28.249999999999996 27.66 20.66 45-49 23.055 28.68 27.74 20.525 50-54 22.73 28.499999999999996 28.71 20.06 55-59 23.03 28.43 27.955000000000002 20.585 60-64 23.145 27.779999999999998 28.244999999999997 20.830000000000002 65-69 23.575 28.025 28.105000000000004 20.294999999999998 70-74 23.325000000000003 28.244999999999997 27.88 20.549999999999997 75-79 23.36 27.785 29.04 19.814999999999998 80-84 23.61 27.339999999999996 28.439999999999998 20.61 85-89 23.72 28.194999999999997 28.139999999999997 19.945 90-94 23.330000000000002 27.915 27.98 20.775 95-99 23.52 28.175 27.884999999999998 20.419999999999998 100-104 23.375 27.750000000000004 28.199999999999996 20.674999999999997 105-109 23.07 27.76 28.525 20.645 110-114 23.830000000000002 28.64 27.534999999999997 19.994999999999997 115-119 24.67 28.744999999999997 26.99 19.595000000000002 120-124 23.65 28.199999999999996 28.33 19.82 125-129 24.26 28.110000000000003 27.435 20.195 130-134 23.945 27.815 28.355000000000004 19.885 135-139 23.9 28.7 27.855 19.545 140-144 24.715 28.78 27.095000000000002 19.41 145-149 24.7 28.465 27.61 19.225 150-151 25.3125 28.4 27.462500000000002 18.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 2.5 25 3.0 26 4.5 27 5.5 28 9.0 29 10.0 30 14.5 31 22.5 32 26.0 33 34.5 34 54.0 35 68.0 36 80.5 37 119.0 38 139.5 39 154.0 40 215.0 41 260.5 42 277.5 43 282.5 44 294.5 45 295.5 46 277.5 47 236.5 48 193.0 49 193.0 50 163.0 51 122.0 52 104.5 53 82.5 54 62.5 55 47.5 56 37.0 57 26.0 58 16.5 59 13.5 60 9.0 61 6.0 62 7.0 63 6.0 64 3.5 65 2.5 66 1.5 67 2.0 68 2.0 69 1.5 70 2.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.075 3 0.075 4 0.025 5 0.025 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.065 15-19 0.08 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6749999999999998 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.15 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGGTA 10 0.006830828 145.0 2 CCCCCCC 25 4.977651E-4 29.0 90-94 >>END_MODULE Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925406 spots for SRR7172137.sra Written 925406 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra Read 925393 spots for SRR7172137.sra Written 925393 spots for SRR7172137.sra SRR ids: ['SRR7172137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_64jwk2xg SRR7172137.sra spots: 18507873 blocks: [[1, 925393], [925394, 1850786], [1850787, 2776179], [2776180, 3701572], [3701573, 4626965], [4626966, 5552358], [5552359, 6477751], [6477752, 7403144], [7403145, 8328537], [8328538, 9253930], [9253931, 10179323], [10179324, 11104716], [11104717, 12030109], [12030110, 12955502], [12955503, 13880895], [13880896, 14806288], [14806289, 15731681], [15731682, 16657074], [16657075, 17582467], [17582468, 18507873]] SRR7172137 file size 6250010 SRR7172137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172137 SRR7172137_1.fastq SRR7172137_2.fastq Input file: SRR7172137_1.fastq Paired file: SRR7172137_2.fastq trimmed: SRR7172137-trimmed-pair1.fastq, SRR7172137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:09:25 2025 >> started Fri Feb 14 19:09:56 2025 >> done (30.332s) 18507873 read pairs processed; of these: 14911 ( 0.08%) short read pairs filtered out after trimming by size control 13743 ( 0.07%) empty read pairs filtered out after trimming by size control 18479219 (99.85%) read pairs available; of these: 10646257 (57.61%) trimmed read pairs available after processing 7832962 (42.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 7 0.00% 23 9 0.00% 24 4 0.00% 25 4 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 4 0.00% 30 2 0.00% 31 7 0.00% 32 4 0.00% 33 3 0.00% 34 9 0.00% 35 9 0.00% 36 8 0.00% 37 8 0.00% 38 8 0.00% 39 8 0.00% 40 8 0.00% 41 8 0.00% 42 11 0.00% 43 11 0.00% 44 10 0.00% 45 12 0.00% 46 13 0.00% 47 14 0.00% 48 19 0.00% 49 25 0.00% 50 27 0.00% 51 33 0.00% 52 36 0.00% 53 44 0.00% 54 39 0.00% 55 51 0.00% 56 79 0.00% 57 483 0.00% 58 232 0.00% 59 247 0.00% 60 206 0.00% 61 102 0.00% 62 188 0.00% 63 183 0.00% 64 168 0.00% 65 184 0.00% 66 187 0.00% 67 294 0.00% 68 356 0.00% 69 325 0.00% 70 343 0.00% 71 426 0.00% 72 454 0.00% 73 653 0.00% 74 653 0.00% 75 765 0.00% 76 935 0.01% 77 1332 0.01% 78 1861 0.01% 79 1440 0.01% 80 1636 0.01% 81 1740 0.01% 82 1903 0.01% 83 2606 0.01% 84 4864 0.03% 85 5055 0.03% 86 4974 0.03% 87 4669 0.03% 88 4818 0.03% 89 4944 0.03% 90 5098 0.03% 91 5761 0.03% 92 6284 0.03% 93 6722 0.04% 94 7434 0.04% 95 7840 0.04% 96 8895 0.05% 97 9620 0.05% 98 9991 0.05% 99 10904 0.06% 100 11561 0.06% 101 12745 0.07% 102 13018 0.07% 103 13759 0.07% 104 14841 0.08% 105 16126 0.09% 106 16572 0.09% 107 17643 0.10% 108 18728 0.10% 109 19966 0.11% 110 21021 0.11% 111 22061 0.12% 112 23403 0.13% 113 24698 0.13% 114 26199 0.14% 115 27362 0.15% 116 28741 0.16% 117 30550 0.17% 118 32019 0.17% 119 34141 0.18% 120 35632 0.19% 121 37627 0.20% 122 39249 0.21% 123 41683 0.23% 124 44191 0.24% 125 46373 0.25% 126 49114 0.27% 127 51986 0.28% 128 54841 0.30% 129 57416 0.31% 130 60159 0.33% 131 62255 0.34% 132 65812 0.36% 133 70436 0.38% 134 74459 0.40% 135 79436 0.43% 136 84569 0.46% 137 91363 0.49% 138 98769 0.53% 139 108530 0.59% 140 118848 0.64% 141 132100 0.71% 142 150315 0.81% 143 169389 0.92% 144 201043 1.09% 145 245302 1.33% 146 306951 1.66% 147 413259 2.24% 148 620322 3.36% 149 1204508 6.52% 150 5276839 28.56% 151 7832962 42.39% 18479219 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=71.24 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.6 sequence=AACAGCACCACACAAATAAAACTTGTAGAGTAGATGACACACAAATTAAACCAGCACACTGGGCTTGTCGCTCTTCTCAGCTAGCGCACATTATTGAGCACACATTTTTTTTTGGGCTACACGAATTTATAAACAGGAGATAAGTCTTTCAAGGAGGACTTCCAGCAATAGGAAAGATTGTCTCTTCTTTCCATTATTATGCCTTCGTAAGACTTGCATCGATATCTTTGGTAACAGTTATCATGAAATCCATGTACTTGTCTGGGACTGGGATATTCTCGTTCAGTTTCTCATATTCAATGATCAGCCTGGCCAAGCTTCCATCATCTTTTGGTGTA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=32 prefix-density=0.56 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=266.39 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=15.5 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7172137 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:11:51 Started mapping on | Feb 14 19:11:52 Finished on | Feb 14 19:15:56 Mapping speed, Million of reads per hour | 272.64 Number of input reads | 18479219 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16583915 Uniquely mapped reads % | 89.74% Average mapped length | 293.98 Number of splices: Total | 15873629 Number of splices: Annotated (sjdb) | 15490152 Number of splices: GT/AG | 15585529 Number of splices: GC/AG | 222063 Number of splices: AT/AC | 15320 Number of splices: Non-canonical | 50717 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.34 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449661 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 65683 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.34% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1461236 1461236 1461236 N_multimapping 449661 449661 449661 N_noFeature 654638 16431913 720124 N_ambiguous 174452 1107 87456 UnstrandedReadsAssigned:15754825 PositiveStrandReadsAssigned:150895 NegativeStrandReadsAssigned:15776335 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172137-trimmed-pair1.fastq SRR7172137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,479,219 reads, 15,668,797 reads pseudoaligned [quant] estimated average fragment length: 245.08 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7172137.ke.tsv 34699 SRR7172137.se.tsv 87100 total ==> SRR7172137.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.92 1794 62.2861 Potri.005G024800.1.v4.1 1035 790.92 518 40.3367 Potri.004G059700.1.v4.1 961 716.93 37 3.17854 Potri.007G009000.2.v4.1 1416 1171.92 0 0 Potri.003G141000.2.v4.1 2943 2698.92 834.299 19.0386 Potri.016G087400.1.v4.1 270 77.199 948 756.31 Potri.015G069301.1.v4.1 564 323.639 0 0 Potri.010G195200.1.v4.1 1773 1528.92 1056.9 42.5746 Potri.012G127500.1.v4.1 977 732.93 16561 1391.64 ==> SRR7172137.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 410 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 383 Potri.001G452600.v4.1 754 SRR7172137 completed mapping pipeline successfully