Starting /dee2/code/volunteer_pipeline.sh SRR7172138 current disk space = 3110529531904 free memory = 1573884228 SRR7172138 SRAfilesize 733f6932fb56139a68e95cdc6b93fd59 SRR7172138.sra SRR7172138.sra file validated SRR7172138 is paired end SRR7172138 is conventional basespace SRR7172138 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1235 33.0 33.0 34.0 30.0 34.0 2 32.75875 33.0 33.0 34.0 32.0 34.0 3 32.878 33.0 33.0 34.0 31.0 34.0 4 32.5145 33.0 33.0 33.0 31.0 34.0 5 32.893 33.0 33.0 34.0 32.0 34.0 6 36.8425 38.0 37.0 38.0 35.0 38.0 7 37.17125 38.0 38.0 38.0 36.0 38.0 8 37.512 38.0 38.0 38.0 37.0 38.0 9 37.58775 38.0 38.0 38.0 38.0 38.0 10-14 37.561899999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.5724 38.0 38.0 38.0 38.0 38.0 20-24 37.5631 38.0 38.0 38.0 38.0 38.0 25-29 37.54915 38.0 38.0 38.0 38.0 38.0 30-34 37.4859 38.0 38.0 38.0 37.6 38.0 35-39 37.5204 38.0 38.0 38.0 37.6 38.0 40-44 37.4952 38.0 38.0 38.0 37.4 38.0 45-49 37.44445 38.0 38.0 38.0 37.0 38.0 50-54 37.356399999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.23775 38.0 38.0 38.0 36.8 38.0 60-64 37.22154999999999 38.0 38.0 38.0 36.2 38.0 65-69 37.1132 38.0 38.0 38.0 36.0 38.0 70-74 37.02225 38.0 38.0 38.0 36.0 38.0 75-79 36.98575 38.0 38.0 38.0 35.8 38.0 80-84 36.898849999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.7848 38.0 38.0 38.0 34.8 38.0 90-94 36.684749999999994 38.0 38.0 38.0 34.4 38.0 95-99 36.644349999999996 38.0 38.0 38.0 34.4 38.0 100-104 36.4851 38.0 38.0 38.0 34.0 38.0 105-109 36.2299 38.0 37.0 38.0 33.6 38.0 110-114 36.098400000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.9876 38.0 37.0 38.0 32.6 38.0 120-124 35.812250000000006 38.0 36.6 38.0 31.6 38.0 125-129 35.569900000000004 38.0 36.0 38.0 31.0 38.0 130-134 35.293749999999996 38.0 36.0 38.0 29.4 38.0 135-139 34.85260000000001 38.0 35.0 38.0 27.6 38.0 140-144 34.153000000000006 38.0 34.6 38.0 23.8 38.0 145-149 33.629200000000004 38.0 34.4 38.0 21.0 38.0 150-151 29.946 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 3.0 20 3.0 21 4.0 22 3.0 23 6.0 24 5.0 25 10.0 26 14.0 27 31.0 28 12.0 29 24.0 30 39.0 31 33.0 32 49.0 33 99.0 34 166.0 35 321.0 36 887.0 37 2283.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.913706919231778 17.784793475401212 16.28518810839253 38.01631149697448 2 17.925 25.95 37.025000000000006 19.1 3 16.85 29.875 26.6 26.674999999999997 4 19.375 36.725 22.275 21.625 5 20.45 36.4 23.9 19.25 6 16.225 36.6 25.15 22.025 7 12.875 20.3 45.824999999999996 21.0 8 16.35 21.375 30.2 32.074999999999996 9 18.425 21.65 30.975 28.95 10-14 19.53 29.959999999999997 26.279999999999998 24.23 15-19 19.775000000000002 28.485 27.905 23.835 20-24 19.605 28.99 27.58 23.825 25-29 19.785 29.14 27.375 23.7 30-34 19.645000000000003 28.939999999999998 27.800000000000004 23.615 35-39 19.575 29.21 27.950000000000003 23.265 40-44 19.86 29.304999999999996 27.38 23.455000000000002 45-49 19.81 28.744999999999997 27.644999999999996 23.799999999999997 50-54 20.13 29.049999999999997 27.62 23.200000000000003 55-59 19.98 27.91 28.37 23.74 60-64 19.57 29.185 27.62 23.625 65-69 20.22 28.565 27.500000000000004 23.715 70-74 20.405 28.749999999999996 27.845 23.0 75-79 19.895 28.255000000000003 28.405 23.445 80-84 19.965 28.435 27.97 23.630000000000003 85-89 19.869999999999997 28.595 28.365000000000002 23.169999999999998 90-94 19.63 28.875 28.28 23.215 95-99 19.830000000000002 28.49 28.51 23.169999999999998 100-104 20.665 28.105000000000004 27.705000000000002 23.525 105-109 20.235 28.139999999999997 27.955000000000002 23.669999999999998 110-114 20.419999999999998 28.92 28.1 22.56 115-119 20.47 29.025000000000002 27.450000000000003 23.055 120-124 20.025000000000002 28.305000000000003 27.925 23.745 125-129 20.735 28.485 27.43 23.35 130-134 20.465 28.585 27.639999999999997 23.31 135-139 20.49 28.37 27.700000000000003 23.44 140-144 20.72 29.07 26.91 23.3 145-149 20.93 28.735 27.060000000000002 23.275000000000002 150-151 21.2 28.5625 27.0625 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 5.0 26 6.5 27 8.5 28 11.0 29 15.0 30 25.5 31 34.5 32 36.5 33 37.5 34 55.5 35 82.5 36 109.0 37 126.0 38 150.0 39 186.5 40 217.0 41 235.5 42 246.0 43 259.0 44 265.5 45 277.5 46 276.5 47 245.0 48 210.5 49 182.5 50 159.0 51 142.0 52 105.5 53 71.0 54 57.5 55 39.0 56 29.0 57 21.5 58 14.0 59 12.5 60 11.0 61 9.0 62 7.0 63 5.5 64 1.5 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.7874999999999996 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTACA 10 0.006843168 144.91249 9 TCACTAC 10 0.006843168 144.91249 8 >>END_MODULE SRR7172138 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172138_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.141 33.0 33.0 34.0 33.0 34.0 2 33.2405 34.0 33.0 34.0 33.0 34.0 3 33.277 34.0 33.0 34.0 33.0 34.0 4 33.205 34.0 33.0 34.0 33.0 34.0 5 33.2285 34.0 33.0 34.0 33.0 34.0 6 37.3345 38.0 38.0 38.0 37.0 38.0 7 37.4275 38.0 38.0 38.0 37.0 38.0 8 37.492 38.0 38.0 38.0 38.0 38.0 9 37.4515 38.0 38.0 38.0 38.0 38.0 10-14 37.410700000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.382349999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.357899999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.31155 38.0 38.0 38.0 37.0 38.0 30-34 37.277300000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.210249999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.260000000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.19255 38.0 38.0 38.0 36.8 38.0 50-54 37.19325 38.0 38.0 38.0 36.8 38.0 55-59 37.02325 38.0 38.0 38.0 36.2 38.0 60-64 37.061 38.0 38.0 38.0 36.0 38.0 65-69 36.896049999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.7761 38.0 38.0 38.0 35.4 38.0 75-79 36.7197 38.0 38.0 38.0 35.0 38.0 80-84 36.655249999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.57075 38.0 38.0 38.0 34.6 38.0 90-94 36.42094999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.24385 38.0 38.0 38.0 33.6 38.0 100-104 36.1091 38.0 37.8 38.0 33.4 38.0 105-109 35.98945 38.0 37.0 38.0 33.0 38.0 110-114 35.88495 38.0 37.0 38.0 32.6 38.0 115-119 35.6824 38.0 37.0 38.0 31.0 38.0 120-124 35.3329 38.0 36.2 38.0 30.0 38.0 125-129 35.04715 38.0 35.6 38.0 28.6 38.0 130-134 34.7056 38.0 35.0 38.0 27.4 38.0 135-139 34.3257 38.0 35.0 38.0 24.2 38.0 140-144 33.8651 38.0 34.6 38.0 23.0 38.0 145-149 33.16160000000001 38.0 34.0 38.0 17.2 38.0 150-151 28.793750000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 6.0 14 4.0 15 3.0 16 1.0 17 2.0 18 5.0 19 2.0 20 6.0 21 4.0 22 11.0 23 12.0 24 8.0 25 14.0 26 20.0 27 23.0 28 32.0 29 30.0 30 44.0 31 65.0 32 77.0 33 88.0 34 160.0 35 275.0 36 711.0 37 2390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.75 14.000000000000002 20.1 33.15 2 22.400000000000002 23.05 38.0 16.55 3 21.5 26.950000000000003 30.575000000000003 20.974999999999998 4 24.5 33.2 21.85 20.45 5 24.0 35.625 22.425 17.95 6 16.85 38.475 25.5 19.175 7 16.075 15.875 45.675 22.375 8 19.45 21.425 29.45 29.675 9 22.5 25.224999999999998 26.55 25.724999999999998 10-14 22.64 28.310000000000002 27.015 22.035 15-19 21.97 28.095 28.375 21.560000000000002 20-24 22.535 28.384999999999998 28.165000000000003 20.915 25-29 22.55 28.345 27.889999999999997 21.215 30-34 22.509999999999998 28.455000000000002 28.03 21.005 35-39 22.445 29.13 27.415 21.01 40-44 22.64 28.189999999999998 28.125 21.044999999999998 45-49 22.79 28.53 27.915 20.765 50-54 22.785 28.199999999999996 28.21 20.805 55-59 23.03 28.235 28.16 20.575 60-64 22.830000000000002 27.925 28.37 20.875 65-69 22.865 28.475 28.08 20.580000000000002 70-74 23.165 28.215 28.07 20.549999999999997 75-79 23.9 28.485 27.389999999999997 20.225 80-84 23.21 27.965 28.384999999999998 20.44 85-89 23.555 27.725 28.51 20.21 90-94 23.895 28.04 27.67 20.395 95-99 22.895 28.025 28.415000000000003 20.665 100-104 23.735 28.025 27.71 20.53 105-109 23.235 28.065 28.660000000000004 20.04 110-114 23.615 28.01 27.685 20.69 115-119 23.64 28.060000000000002 27.725 20.575 120-124 23.68 28.78 27.810000000000002 19.73 125-129 24.02 28.455000000000002 27.87 19.655 130-134 23.775 27.97 27.889999999999997 20.365 135-139 24.63 27.865000000000002 27.57 19.935 140-144 24.58 28.275 27.384999999999998 19.759999999999998 145-149 24.175 27.634999999999998 27.93 20.26 150-151 24.462500000000002 27.9125 27.400000000000002 20.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 2.0 23 2.0 24 1.5 25 0.5 26 1.5 27 6.0 28 10.0 29 15.5 30 12.5 31 11.0 32 21.5 33 31.5 34 44.0 35 60.5 36 89.5 37 124.5 38 154.0 39 184.5 40 217.5 41 245.5 42 252.5 43 269.0 44 293.0 45 281.0 46 276.5 47 264.0 48 228.5 49 186.0 50 146.0 51 127.5 52 116.5 53 88.0 54 52.5 55 37.5 56 39.0 57 38.5 58 21.5 59 8.5 60 6.0 61 7.0 62 5.0 63 2.5 64 4.5 65 4.5 66 1.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.7375 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCAAG 10 0.006830828 145.0 5 CAACACT 10 0.006830828 145.0 1 >>END_MODULE Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra Read 573698 spots for SRR7172138.sra Written 573698 spots for SRR7172138.sra Read 573690 spots for SRR7172138.sra Written 573690 spots for SRR7172138.sra SRR ids: ['SRR7172138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lrma8ffg SRR7172138.sra spots: 11473808 blocks: [[1, 573690], [573691, 1147380], [1147381, 1721070], [1721071, 2294760], [2294761, 2868450], [2868451, 3442140], [3442141, 4015830], [4015831, 4589520], [4589521, 5163210], [5163211, 5736900], [5736901, 6310590], [6310591, 6884280], [6884281, 7457970], [7457971, 8031660], [8031661, 8605350], [8605351, 9179040], [9179041, 9752730], [9752731, 10326420], [10326421, 10900110], [10900111, 11473808]] SRR7172138 file size 3866396 SRR7172138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172138 SRR7172138_1.fastq SRR7172138_2.fastq Input file: SRR7172138_1.fastq Paired file: SRR7172138_2.fastq trimmed: SRR7172138-trimmed-pair1.fastq, SRR7172138-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:45:35 2025 >> started Fri Feb 14 18:45:54 2025 >> done (18.351s) 11473808 read pairs processed; of these: 5705 ( 0.05%) short read pairs filtered out after trimming by size control 4319 ( 0.04%) empty read pairs filtered out after trimming by size control 11463784 (99.91%) read pairs available; of these: 6477598 (56.50%) trimmed read pairs available after processing 4986186 (43.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 9 0.00% 23 9 0.00% 24 2 0.00% 25 6 0.00% 26 11 0.00% 27 4 0.00% 28 4 0.00% 29 4 0.00% 30 4 0.00% 31 4 0.00% 32 7 0.00% 33 2 0.00% 34 5 0.00% 35 4 0.00% 36 9 0.00% 37 5 0.00% 38 5 0.00% 39 13 0.00% 40 4 0.00% 41 5 0.00% 42 6 0.00% 43 10 0.00% 44 7 0.00% 45 17 0.00% 46 7 0.00% 47 14 0.00% 48 13 0.00% 49 14 0.00% 50 22 0.00% 51 23 0.00% 52 21 0.00% 53 27 0.00% 54 24 0.00% 55 38 0.00% 56 38 0.00% 57 33 0.00% 58 41 0.00% 59 41 0.00% 60 54 0.00% 61 58 0.00% 62 56 0.00% 63 89 0.00% 64 91 0.00% 65 115 0.00% 66 121 0.00% 67 126 0.00% 68 133 0.00% 69 170 0.00% 70 155 0.00% 71 197 0.00% 72 236 0.00% 73 293 0.00% 74 305 0.00% 75 351 0.00% 76 457 0.00% 77 502 0.00% 78 463 0.00% 79 535 0.00% 80 655 0.01% 81 678 0.01% 82 831 0.01% 83 1014 0.01% 84 1290 0.01% 85 1620 0.01% 86 1810 0.02% 87 1976 0.02% 88 2226 0.02% 89 2435 0.02% 90 2546 0.02% 91 2720 0.02% 92 3020 0.03% 93 3350 0.03% 94 3524 0.03% 95 3804 0.03% 96 4222 0.04% 97 4457 0.04% 98 4866 0.04% 99 5160 0.05% 100 5728 0.05% 101 6181 0.05% 102 6629 0.06% 103 7122 0.06% 104 7545 0.07% 105 8240 0.07% 106 9005 0.08% 107 9567 0.08% 108 10295 0.09% 109 10739 0.09% 110 11532 0.10% 111 12142 0.11% 112 12693 0.11% 113 13512 0.12% 114 14375 0.13% 115 15376 0.13% 116 16144 0.14% 117 17035 0.15% 118 17756 0.15% 119 18622 0.16% 120 19634 0.17% 121 20646 0.18% 122 21791 0.19% 123 22834 0.20% 124 24578 0.21% 125 25621 0.22% 126 27175 0.24% 127 29119 0.25% 128 30909 0.27% 129 32620 0.28% 130 34496 0.30% 131 36705 0.32% 132 39530 0.34% 133 42782 0.37% 134 45291 0.40% 135 48156 0.42% 136 52237 0.46% 137 56345 0.49% 138 61233 0.53% 139 66428 0.58% 140 73178 0.64% 141 81887 0.71% 142 93943 0.82% 143 108591 0.95% 144 131009 1.14% 145 161202 1.41% 146 211742 1.85% 147 300981 2.63% 148 478193 4.17% 149 900124 7.85% 150 2911142 25.39% 151 4986186 43.50% 11463784 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=19 prefix-density=0.37 prefix-fanout=3.6 sequence=CCACATTTGCAGCCATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=28.02 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.6 sequence=AGCACCAAGTGGAG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=20 prefix-density=0.81 prefix-fanout=3.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=38.63 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.7 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTG SRR7172138 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:47:17 Started mapping on | Feb 14 18:47:17 Finished on | Feb 14 18:49:07 Mapping speed, Million of reads per hour | 375.18 Number of input reads | 11463784 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10747595 Uniquely mapped reads % | 93.75% Average mapped length | 294.45 Number of splices: Total | 10515291 Number of splices: Annotated (sjdb) | 10319572 Number of splices: GT/AG | 10345168 Number of splices: GC/AG | 131230 Number of splices: AT/AC | 9206 Number of splices: Non-canonical | 29687 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310536 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 26706 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 412970 412970 412970 N_multimapping 310536 310536 310536 N_noFeature 315977 10628984 376214 N_ambiguous 116176 582 57513 UnstrandedReadsAssigned:10315442 PositiveStrandReadsAssigned:118029 NegativeStrandReadsAssigned:10313868 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172138 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172138-trimmed-pair1.fastq SRR7172138-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,463,784 reads, 10,214,591 reads pseudoaligned [quant] estimated average fragment length: 249.723 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR7172138.ke.tsv 34699 SRR7172138.se.tsv 87100 total ==> SRR7172138.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.28 930 49.0602 Potri.005G024800.1.v4.1 1035 786.277 235 27.8955 Potri.004G059700.1.v4.1 961 712.324 53 6.94449 Potri.007G009000.2.v4.1 1416 1167.28 0 0 Potri.003G141000.2.v4.1 2943 2694.28 424 14.6881 Potri.016G087400.1.v4.1 270 75.4691 569 703.696 Potri.015G069301.1.v4.1 564 319.753 0 0 Potri.010G195200.1.v4.1 1773 1524.28 221 13.5323 Potri.012G127500.1.v4.1 977 728.295 5380 689.473 ==> SRR7172138.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 396 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 192 SRR7172138 completed mapping pipeline successfully