Starting /dee2/code/volunteer_pipeline.sh SRR7172139 current disk space = 3117603647488 free memory = 1579945764 SRR7172139 SRAfilesize 7a6eeb4ce1ed3e1a841932015448894a SRR7172139.sra SRR7172139.sra file validated SRR7172139 is paired end SRR7172139 is conventional basespace SRR7172139 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.606 33.0 33.0 34.0 32.0 34.0 2 32.78125 33.0 33.0 34.0 31.0 34.0 3 31.72025 33.0 31.0 33.0 29.0 34.0 4 31.07925 33.0 31.0 33.0 28.0 33.0 5 32.62975 33.0 33.0 33.0 32.0 34.0 6 36.632 38.0 37.0 38.0 34.0 38.0 7 37.338 38.0 38.0 38.0 37.0 38.0 8 37.24975 38.0 38.0 38.0 36.0 38.0 9 37.431 38.0 38.0 38.0 37.0 38.0 10-14 37.43985 38.0 38.0 38.0 37.2 38.0 15-19 37.4506 38.0 38.0 38.0 37.0 38.0 20-24 37.39525 38.0 38.0 38.0 37.2 38.0 25-29 37.2797 38.0 38.0 38.0 37.0 38.0 30-34 37.0145 38.0 38.0 38.0 36.0 38.0 35-39 36.823750000000004 38.0 38.0 38.0 35.0 38.0 40-44 36.995400000000004 38.0 38.0 38.0 36.0 38.0 45-49 37.0965 38.0 38.0 38.0 36.2 38.0 50-54 37.14625 38.0 38.0 38.0 36.4 38.0 55-59 37.162 38.0 38.0 38.0 36.6 38.0 60-64 37.2148 38.0 38.0 38.0 36.6 38.0 65-69 37.188599999999994 38.0 38.0 38.0 36.0 38.0 70-74 37.0606 38.0 38.0 38.0 36.0 38.0 75-79 36.86685 38.0 38.0 38.0 35.4 38.0 80-84 36.71945 38.0 38.0 38.0 34.8 38.0 85-89 36.60125000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.48395 38.0 38.0 38.0 34.0 38.0 95-99 36.4433 38.0 38.0 38.0 34.0 38.0 100-104 36.40145 38.0 38.0 38.0 34.0 38.0 105-109 36.402550000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.26935 38.0 37.4 38.0 34.0 38.0 115-119 36.12485 38.0 37.0 38.0 33.2 38.0 120-124 35.8837 38.0 37.0 38.0 32.2 38.0 125-129 35.3915 38.0 36.2 38.0 30.6 38.0 130-134 35.0546 38.0 36.0 38.0 28.8 38.0 135-139 34.80625 38.0 35.8 38.0 28.2 38.0 140-144 33.9225 38.0 33.6 38.0 23.2 38.0 145-149 33.2526 38.0 33.0 38.0 18.8 38.0 150-151 28.441874999999996 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 1.0 20 2.0 21 6.0 22 5.0 23 12.0 24 12.0 25 17.0 26 21.0 27 26.0 28 34.0 29 29.0 30 50.0 31 59.0 32 93.0 33 112.0 34 169.0 35 301.0 36 676.0 37 2366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.575000000000003 17.4 14.95 37.075 2 18.725 25.424999999999997 37.775 18.075 3 16.725 31.25 25.775 26.25 4 20.9 36.925000000000004 21.075 21.099999999999998 5 18.575 39.875 24.0 17.549999999999997 6 14.75 36.75 27.125 21.375 7 12.775 20.0 45.5 21.725 8 17.849999999999998 21.775 29.275000000000002 31.1 9 17.875 21.875 32.225 28.025 10-14 19.08167858750563 30.565697994298002 26.444255489421298 23.90836792877507 15-19 19.866986698669866 28.377837783778375 28.03780378037804 23.717371737173718 20-24 18.235 30.15 28.165000000000003 23.45 25-29 19.67 28.925 28.144999999999996 23.26 30-34 18.94 29.115000000000002 28.615000000000002 23.330000000000002 35-39 19.345000000000002 30.03 27.694999999999997 22.93 40-44 19.64 29.62 27.810000000000002 22.93 45-49 19.78 28.49 27.744999999999997 23.985 50-54 19.24 29.34 27.700000000000003 23.72 55-59 19.78 28.854999999999997 28.199999999999996 23.165 60-64 19.75 28.79 28.055000000000003 23.405 65-69 20.335 29.044999999999998 27.515 23.105 70-74 19.86 28.95 27.74 23.45 75-79 19.975 28.994999999999997 27.6 23.43 80-84 20.25 28.335 27.98 23.435 85-89 19.939999999999998 29.09 27.67 23.3 90-94 19.73 28.465 28.165000000000003 23.64 95-99 19.775000000000002 29.025000000000002 27.705000000000002 23.494999999999997 100-104 20.07 27.865000000000002 28.144999999999996 23.919999999999998 105-109 19.950000000000003 28.689999999999998 28.15 23.21 110-114 19.773954790958193 28.660732146429286 28.050610122024406 23.514702940588116 115-119 20.713285314125653 28.26130452180872 27.62104841936775 23.40436174469788 120-124 20.202070724753664 28.40494172960536 27.684689641374483 23.70829790426649 125-129 20.662357833558794 28.102610351220005 27.611603787764917 23.623428027456285 130-134 20.255000000000003 28.775000000000002 27.57 23.400000000000002 135-139 20.849999999999998 28.265 27.47 23.415 140-144 21.044999999999998 28.035 27.245 23.674999999999997 145-149 21.135 28.475 26.735 23.655 150-151 20.7625 29.049999999999997 26.474999999999998 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 2.5 25 4.0 26 8.0 27 11.0 28 13.5 29 18.0 30 23.0 31 33.5 32 49.5 33 65.0 34 69.0 35 79.5 36 101.5 37 133.5 38 166.0 39 193.5 40 212.5 41 230.0 42 258.5 43 268.0 44 264.0 45 276.0 46 273.0 47 230.5 48 192.5 49 160.5 50 140.0 51 121.0 52 96.5 53 86.0 54 63.0 55 38.0 56 27.0 57 21.5 58 17.5 59 10.0 60 7.0 61 8.0 62 5.0 63 4.5 64 4.0 65 1.5 66 0.5 67 0.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.04 120-124 0.034999999999999996 125-129 0.20500000000000002 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.025 0.0 0.0 0.0 94-95 0.25 0.025 0.0 0.0 0.0 96-97 0.375 0.025 0.0 0.0 0.0 98-99 0.5125 0.025 0.0 0.0 0.0 100-101 0.6499999999999999 0.025 0.0 0.0 0.0 102-103 0.8999999999999999 0.025 0.0 0.0 0.0 104-105 1.1 0.025 0.0 0.0 0.0 106-107 1.2125 0.025 0.0 0.0 0.0 108-109 1.4 0.025 0.0 0.0 0.0 110-111 1.5875 0.025 0.0 0.0 0.0 112-113 1.775 0.025 0.0 0.0 0.0 114-115 2.0625 0.025 0.0 0.0 0.0 116-117 2.325 0.025 0.0 0.0 0.0 118-119 2.5 0.025 0.0 0.0 0.0 120-121 2.9 0.025 0.0 0.0 0.0 122-123 3.3625 0.025 0.0 0.0 0.0 124-125 3.725 0.025 0.0 0.0 0.0 126-127 3.9625 0.025 0.0 0.0 0.0 128-129 4.3375 0.025 0.0 0.0 0.0 130-131 4.8125 0.025 0.0 0.0 0.0 132-133 5.199999999999999 0.025 0.0 0.0 0.0 134-135 5.6375 0.025 0.0 0.0 0.0 136-137 6.1625 0.025 0.0 0.0 0.0 138-139 6.637499999999999 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGCA 10 0.006830828 145.0 8 TGAGCAT 10 0.006830828 145.0 9 TTTGATC 10 0.006830828 145.0 2 >>END_MODULE SRR7172139 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70425 33.0 33.0 34.0 32.0 34.0 2 32.8595 33.0 33.0 34.0 32.0 34.0 3 32.9275 34.0 33.0 34.0 32.0 34.0 4 32.80525 34.0 33.0 34.0 32.0 34.0 5 32.907 34.0 33.0 34.0 32.0 34.0 6 37.0205 38.0 38.0 38.0 37.0 38.0 7 37.1575 38.0 38.0 38.0 37.0 38.0 8 37.1575 38.0 38.0 38.0 37.0 38.0 9 37.1885 38.0 38.0 38.0 37.0 38.0 10-14 37.13535 38.0 38.0 38.0 37.0 38.0 15-19 37.0274 38.0 38.0 38.0 36.4 38.0 20-24 36.927049999999994 38.0 38.0 38.0 36.2 38.0 25-29 36.9667 38.0 38.0 38.0 36.4 38.0 30-34 36.947199999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.8306 38.0 38.0 38.0 36.0 38.0 40-44 36.7525 38.0 38.0 38.0 35.8 38.0 45-49 36.91525 38.0 38.0 38.0 36.0 38.0 50-54 36.838699999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.7932 38.0 38.0 38.0 35.6 38.0 60-64 36.76950000000001 38.0 38.0 38.0 35.8 38.0 65-69 36.6882 38.0 38.0 38.0 35.0 38.0 70-74 36.651999999999994 38.0 38.0 38.0 35.0 38.0 75-79 36.608149999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.4644 38.0 38.0 38.0 34.4 38.0 85-89 36.203 38.0 38.0 38.0 33.8 38.0 90-94 36.10355 38.0 38.0 38.0 33.4 38.0 95-99 35.94355 38.0 37.6 38.0 32.6 38.0 100-104 35.81685 38.0 37.0 38.0 31.6 38.0 105-109 35.81255 38.0 37.0 38.0 32.2 38.0 110-114 35.817 38.0 37.2 38.0 32.2 38.0 115-119 35.6471 38.0 37.0 38.0 31.4 38.0 120-124 35.2618 38.0 36.6 38.0 30.0 38.0 125-129 35.02635 38.0 36.0 38.0 28.6 38.0 130-134 34.6654 38.0 36.0 38.0 27.2 38.0 135-139 34.020900000000005 38.0 34.2 38.0 22.6 38.0 140-144 33.431400000000004 38.0 33.0 38.0 20.0 38.0 145-149 32.54415 38.0 33.0 38.0 10.6 38.0 150-151 27.222 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 3.0 5 1.0 6 2.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 2.0 14 2.0 15 5.0 16 4.0 17 3.0 18 6.0 19 4.0 20 8.0 21 12.0 22 8.0 23 16.0 24 20.0 25 19.0 26 24.0 27 30.0 28 24.0 29 39.0 30 63.0 31 70.0 32 104.0 33 115.0 34 170.0 35 254.0 36 586.0 37 2392.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.17238787271361 13.95640190428464 19.09295915810574 34.77825106489602 2 23.2982982982983 22.54754754754755 37.512512512512515 16.64164164164164 3 20.38519259629815 24.68734367183592 32.491245622811405 22.436218109054526 4 24.087043521760883 33.691845922961484 21.83591795897949 20.38519259629815 5 23.611805902951478 38.61930965482742 20.83541770885443 16.933466733366682 6 17.125 38.95 23.775 20.150000000000002 7 16.65832916458229 14.457228614307155 48.099049524762385 20.785392696348172 8 20.575 22.125 27.250000000000004 30.049999999999997 9 22.35 22.975 29.125 25.55 10-14 22.556278139069537 28.544272136068034 27.24862431215608 21.650825412706354 15-19 22.052642113690954 28.51781425140112 28.077461969575662 21.352081665332264 20-24 22.80456091218244 28.460692138427685 28.105621124224843 20.629125825165033 25-29 22.795 27.72 28.499999999999996 20.985 30-34 23.07 28.15 28.175 20.605 35-39 22.925 27.700000000000003 28.499999999999996 20.875 40-44 22.925 28.625 28.060000000000002 20.39 45-49 23.544999999999998 28.125 27.99 20.34 50-54 22.925 28.22 28.310000000000002 20.544999999999998 55-59 23.36 28.585 28.139999999999997 19.915 60-64 23.865 28.185 27.435 20.515 65-69 24.08 27.894999999999996 27.975 20.05 70-74 23.745 27.79 28.110000000000003 20.355 75-79 23.355 27.794999999999998 28.34 20.51 80-84 23.395 28.265 27.955000000000002 20.385 85-89 23.615 27.965 27.950000000000003 20.47 90-94 23.135 28.16 28.71 19.994999999999997 95-99 23.9 28.470000000000002 27.644999999999996 19.985 100-104 23.43 27.425 28.499999999999996 20.645 105-109 23.43 28.28 28.08 20.21 110-114 23.585 27.975 28.29 20.150000000000002 115-119 24.22 27.875 27.860000000000003 20.044999999999998 120-124 24.25 28.54 27.52 19.689999999999998 125-129 23.805 28.705000000000002 27.765 19.725 130-134 24.02 28.355000000000004 27.79 19.835 135-139 24.545 27.96 28.335 19.16 140-144 24.565 28.035 27.77 19.63 145-149 24.545 28.51 27.405 19.54 150-151 24.9875 28.0625 27.3 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 1.0 26 2.5 27 5.5 28 9.5 29 12.5 30 16.0 31 21.5 32 27.5 33 37.0 34 46.0 35 60.5 36 88.0 37 112.5 38 133.5 39 178.0 40 217.0 41 225.0 42 245.5 43 281.5 44 298.0 45 290.5 46 279.5 47 261.5 48 236.5 49 210.5 50 161.5 51 118.5 52 107.5 53 86.5 54 61.0 55 43.5 56 34.5 57 29.5 58 20.0 59 11.0 60 6.5 61 6.0 62 2.0 63 1.0 64 3.5 65 2.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.1 3 0.05 4 0.05 5 0.05 6 0.0 7 0.05 8 0.0 9 0.0 10-14 0.05 15-19 0.08 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54682779456193 98.85000000000001 2 0.3021148036253776 0.6 3 0.10070493454179255 0.3 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.0125 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGGT 10 0.006830828 145.0 7 CCAGGTT 10 0.006830828 145.0 8 >>END_MODULE Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774789 spots for SRR7172139.sra Written 774789 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra Read 774772 spots for SRR7172139.sra Written 774772 spots for SRR7172139.sra SRR ids: ['SRR7172139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fpis5rox SRR7172139.sra spots: 15495457 blocks: [[1, 774772], [774773, 1549544], [1549545, 2324316], [2324317, 3099088], [3099089, 3873860], [3873861, 4648632], [4648633, 5423404], [5423405, 6198176], [6198177, 6972948], [6972949, 7747720], [7747721, 8522492], [8522493, 9297264], [9297265, 10072036], [10072037, 10846808], [10846809, 11621580], [11621581, 12396352], [12396353, 13171124], [13171125, 13945896], [13945897, 14720668], [14720669, 15495457]] SRR7172139 file size 5229201 SRR7172139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172139 SRR7172139_1.fastq SRR7172139_2.fastq Input file: SRR7172139_1.fastq Paired file: SRR7172139_2.fastq trimmed: SRR7172139-trimmed-pair1.fastq, SRR7172139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:43:33 2025 >> started Fri Feb 14 08:43:50 2025 >> done (17.192s) 15495457 read pairs processed; of these: 12952 ( 0.08%) short read pairs filtered out after trimming by size control 15106 ( 0.10%) empty read pairs filtered out after trimming by size control 15467399 (99.82%) read pairs available; of these: 8983705 (58.08%) trimmed read pairs available after processing 6483694 (41.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 1 0.00% 24 5 0.00% 25 3 0.00% 26 5 0.00% 27 6 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 5 0.00% 32 2 0.00% 33 1 0.00% 34 4 0.00% 35 12 0.00% 36 6 0.00% 37 5 0.00% 38 4 0.00% 39 7 0.00% 40 7 0.00% 41 6 0.00% 42 7 0.00% 43 19 0.00% 44 9 0.00% 45 15 0.00% 46 11 0.00% 47 15 0.00% 48 10 0.00% 49 21 0.00% 50 32 0.00% 51 24 0.00% 52 37 0.00% 53 30 0.00% 54 33 0.00% 55 45 0.00% 56 71 0.00% 57 420 0.00% 58 180 0.00% 59 184 0.00% 60 192 0.00% 61 134 0.00% 62 144 0.00% 63 149 0.00% 64 158 0.00% 65 157 0.00% 66 222 0.00% 67 312 0.00% 68 339 0.00% 69 331 0.00% 70 403 0.00% 71 419 0.00% 72 530 0.00% 73 675 0.00% 74 622 0.00% 75 782 0.01% 76 921 0.01% 77 1271 0.01% 78 1682 0.01% 79 1401 0.01% 80 1718 0.01% 81 1784 0.01% 82 1882 0.01% 83 2591 0.02% 84 4612 0.03% 85 4790 0.03% 86 4674 0.03% 87 4524 0.03% 88 4636 0.03% 89 5053 0.03% 90 5404 0.03% 91 5736 0.04% 92 6357 0.04% 93 7141 0.05% 94 7927 0.05% 95 8146 0.05% 96 9181 0.06% 97 9999 0.06% 98 10270 0.07% 99 10870 0.07% 100 11628 0.08% 101 12875 0.08% 102 13385 0.09% 103 14187 0.09% 104 15040 0.10% 105 16306 0.11% 106 17460 0.11% 107 18136 0.12% 108 19412 0.13% 109 20316 0.13% 110 21227 0.14% 111 22197 0.14% 112 23530 0.15% 113 24573 0.16% 114 26287 0.17% 115 27648 0.18% 116 29157 0.19% 117 30300 0.20% 118 32301 0.21% 119 33565 0.22% 120 34921 0.23% 121 36677 0.24% 122 37989 0.25% 123 40296 0.26% 124 42494 0.27% 125 44682 0.29% 126 47456 0.31% 127 49458 0.32% 128 51315 0.33% 129 54231 0.35% 130 56172 0.36% 131 58571 0.38% 132 60822 0.39% 133 65257 0.42% 134 68793 0.44% 135 72590 0.47% 136 77558 0.50% 137 82484 0.53% 138 88895 0.57% 139 96687 0.63% 140 105074 0.68% 141 115040 0.74% 142 129518 0.84% 143 145996 0.94% 144 170450 1.10% 145 206160 1.33% 146 257082 1.66% 147 343211 2.22% 148 508581 3.29% 149 981308 6.34% 150 4295004 27.77% 151 6483694 41.92% 15467399 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=20 prefix-density=1.01 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=9.54 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=2.1 sequence=CGCACTTGCAGTC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=21 prefix-density=0.99 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=18.89 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=7.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:44:48 Started mapping on | Feb 14 08:44:48 Finished on | Feb 14 08:46:37 Mapping speed, Million of reads per hour | 510.85 Number of input reads | 15467399 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14573591 Uniquely mapped reads % | 94.22% Average mapped length | 293.09 Number of splices: Total | 14220087 Number of splices: Annotated (sjdb) | 13940590 Number of splices: GT/AG | 13990681 Number of splices: GC/AG | 178552 Number of splices: AT/AC | 11312 Number of splices: Non-canonical | 39542 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452998 % of reads mapped to multiple loci | 2.93% Number of reads mapped to too many loci | 43673 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 454683 454683 454683 N_multimapping 452998 452998 452998 N_noFeature 402972 14413535 473362 N_ambiguous 165510 722 75591 UnstrandedReadsAssigned:14005109 PositiveStrandReadsAssigned:159334 NegativeStrandReadsAssigned:14024638 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172139-trimmed-pair1.fastq SRR7172139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,467,399 reads, 13,879,432 reads pseudoaligned [quant] estimated average fragment length: 236.751 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7172139.ke.tsv 34699 SRR7172139.se.tsv 87100 total ==> SRR7172139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.25 1601 56.0483 Potri.005G024800.1.v4.1 1035 799.249 597 46.6049 Potri.004G059700.1.v4.1 961 725.277 22 1.8926 Potri.007G009000.2.v4.1 1416 1180.25 0 0 Potri.003G141000.2.v4.1 2943 2707.25 555.86 12.8108 Potri.016G087400.1.v4.1 270 81.1078 970 746.189 Potri.015G069301.1.v4.1 564 331.522 0 0 Potri.010G195200.1.v4.1 1773 1537.25 828.947 33.6451 Potri.012G127500.1.v4.1 977 741.266 2833 238.458 ==> SRR7172139.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 82 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 744 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 335 SRR7172139 completed mapping pipeline successfully