Starting /dee2/code/volunteer_pipeline.sh SRR7172140 current disk space = 3119512141824 free memory = 1449609052 SRR7172140 SRAfilesize 75f56cdc9c6cfea2d1f06096644de4c6 SRR7172140.sra SRR7172140.sra file validated SRR7172140 is paired end SRR7172140 is conventional basespace SRR7172140 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68375 33.0 33.0 34.0 32.0 34.0 2 33.0915 34.0 33.0 34.0 32.0 34.0 3 33.12575 34.0 33.0 34.0 32.0 34.0 4 33.262 34.0 33.0 34.0 33.0 34.0 5 33.35425 34.0 33.0 34.0 33.0 34.0 6 36.97875 38.0 37.0 38.0 35.0 38.0 7 37.444 38.0 38.0 38.0 37.0 38.0 8 37.47025 38.0 38.0 38.0 37.0 38.0 9 37.4755 38.0 38.0 38.0 38.0 38.0 10-14 37.33905 38.0 38.0 38.0 37.2 38.0 15-19 37.501850000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.4484 38.0 38.0 38.0 37.6 38.0 25-29 37.3925 38.0 38.0 38.0 37.2 38.0 30-34 37.438599999999994 38.0 38.0 38.0 37.2 38.0 35-39 37.29815 38.0 38.0 38.0 37.0 38.0 40-44 37.2626 38.0 38.0 38.0 37.0 38.0 45-49 36.9701 38.0 38.0 38.0 36.0 38.0 50-54 37.25915 38.0 38.0 38.0 37.0 38.0 55-59 37.31475 38.0 38.0 38.0 37.0 38.0 60-64 37.2968 38.0 38.0 38.0 37.0 38.0 65-69 37.2534 38.0 38.0 38.0 37.0 38.0 70-74 37.19755 38.0 38.0 38.0 36.6 38.0 75-79 37.0181 38.0 38.0 38.0 36.0 38.0 80-84 37.00625 38.0 38.0 38.0 36.0 38.0 85-89 36.86725 38.0 38.0 38.0 35.8 38.0 90-94 36.7828 38.0 38.0 38.0 35.2 38.0 95-99 36.72055 38.0 38.0 38.0 34.8 38.0 100-104 36.7487 38.0 38.0 38.0 35.0 38.0 105-109 36.5581 38.0 38.0 38.0 34.0 38.0 110-114 36.3971 38.0 38.0 38.0 34.0 38.0 115-119 36.28965 38.0 38.0 38.0 34.0 38.0 120-124 36.1462 38.0 37.8 38.0 33.8 38.0 125-129 35.91735 38.0 37.0 38.0 33.0 38.0 130-134 35.6322 38.0 36.4 38.0 31.2 38.0 135-139 35.39045 38.0 36.0 38.0 31.0 38.0 140-144 34.8109 38.0 35.8 38.0 29.2 38.0 145-149 34.13275 38.0 35.4 38.0 26.4 38.0 150-151 29.043750000000003 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 3.0 18 0.0 19 3.0 20 0.0 21 4.0 22 6.0 23 5.0 24 9.0 25 13.0 26 18.0 27 16.0 28 22.0 29 31.0 30 45.0 31 45.0 32 77.0 33 75.0 34 139.0 35 239.0 36 568.0 37 2678.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.975 15.825 15.725 38.475 2 19.725 25.35 37.025000000000006 17.9 3 18.45 30.225 26.650000000000002 24.675 4 21.175 36.875 22.15 19.8 5 19.85 37.175000000000004 23.400000000000002 19.575 6 16.6 35.875 25.6 21.925 7 11.625 19.75 46.875 21.75 8 17.125 22.05 28.65 32.175 9 19.05 23.05 30.7 27.200000000000003 10-14 19.260300095348022 30.145029357153614 26.90319666783761 23.691473879660762 15-19 19.485 28.854999999999997 27.325 24.335 20-24 19.215 29.185 27.715 23.885 25-29 19.09 29.354999999999997 28.225 23.330000000000002 30-34 20.34 28.925 27.51 23.225 35-39 19.645000000000003 29.270000000000003 27.72 23.365 40-44 20.51 29.435 27.105 22.95 45-49 19.68 28.910000000000004 28.050000000000004 23.36 50-54 19.785 28.83 27.47 23.915 55-59 19.485 29.215000000000003 27.544999999999998 23.755000000000003 60-64 20.16 29.2 27.565 23.075000000000003 65-69 19.93 28.95 27.400000000000002 23.72 70-74 20.48 28.64 27.51 23.369999999999997 75-79 20.18 28.32 27.715 23.785 80-84 20.005 29.154999999999998 27.66 23.18 85-89 19.84 28.685 27.900000000000002 23.575 90-94 20.335 29.095 27.345000000000002 23.225 95-99 20.385 28.83 27.74 23.044999999999998 100-104 19.85 29.195 27.405 23.549999999999997 105-109 20.451022551127558 28.081404070203508 27.50637531876594 23.961198059902994 110-114 20.96524131032758 28.377094273568392 26.95173793448362 23.705926481620406 115-119 20.46 28.865000000000002 27.235 23.44 120-124 20.325162581290645 28.71935967983992 27.25862931465733 23.696848424212106 125-129 20.410513141426783 27.869837296620776 27.659574468085108 24.060075093867333 130-134 20.785 28.994999999999997 27.235 22.985 135-139 20.995 28.84 26.87 23.294999999999998 140-144 20.66 29.28 26.534999999999997 23.525 145-149 20.599999999999998 28.660000000000004 26.605 24.135 150-151 20.05 29.4 26.474999999999998 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 3.0 25 4.0 26 3.5 27 6.0 28 9.0 29 14.0 30 22.0 31 37.5 32 44.0 33 53.5 34 69.0 35 82.5 36 109.0 37 135.0 38 166.0 39 188.5 40 206.0 41 222.5 42 234.0 43 246.0 44 255.5 45 255.0 46 250.5 47 253.0 48 218.0 49 184.5 50 170.0 51 134.5 52 98.0 53 72.0 54 59.5 55 53.5 56 39.0 57 24.5 58 20.0 59 12.5 60 6.5 61 7.5 62 6.5 63 3.0 64 4.5 65 5.5 66 3.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.365 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.025 115-119 0.0 120-124 0.05 125-129 0.125 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.25119316754584275 0.5 3 0.07535795026375283 0.22499999999999998 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.5374999999999996 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGTTT 10 0.0065874006 146.74684 8 TGTCAAT 10 0.006843168 144.91249 3 TTTTTTT 35 0.003549008 20.701786 120-124 >>END_MODULE SRR7172140 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98 33.0 33.0 34.0 32.0 34.0 2 33.021 34.0 33.0 34.0 32.0 34.0 3 33.0685 34.0 33.0 34.0 33.0 34.0 4 33.0095 34.0 33.0 34.0 33.0 34.0 5 33.04125 34.0 33.0 34.0 32.0 34.0 6 37.21475 38.0 38.0 38.0 37.0 38.0 7 37.35775 38.0 38.0 38.0 37.0 38.0 8 37.31475 38.0 38.0 38.0 37.0 38.0 9 37.345 38.0 38.0 38.0 37.0 38.0 10-14 37.2408 38.0 38.0 38.0 37.0 38.0 15-19 37.1845 38.0 38.0 38.0 37.0 38.0 20-24 37.15725 38.0 38.0 38.0 37.0 38.0 25-29 37.111749999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.1301 38.0 38.0 38.0 37.0 38.0 35-39 37.07845 38.0 38.0 38.0 37.0 38.0 40-44 37.028800000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.085800000000006 38.0 38.0 38.0 36.8 38.0 50-54 37.074400000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.10715 38.0 38.0 38.0 36.8 38.0 60-64 37.04195 38.0 38.0 38.0 36.4 38.0 65-69 36.97485 38.0 38.0 38.0 36.0 38.0 70-74 36.8689 38.0 38.0 38.0 36.0 38.0 75-79 36.8897 38.0 38.0 38.0 36.0 38.0 80-84 36.768100000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.64805 38.0 38.0 38.0 35.0 38.0 90-94 36.53040000000001 38.0 38.0 38.0 34.6 38.0 95-99 36.38185 38.0 38.0 38.0 34.0 38.0 100-104 36.27205 38.0 38.0 38.0 34.0 38.0 105-109 36.244749999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.1644 38.0 37.8 38.0 33.8 38.0 115-119 36.03045000000001 38.0 37.8 38.0 33.4 38.0 120-124 35.73855 38.0 37.2 38.0 31.8 38.0 125-129 35.592 38.0 37.0 38.0 31.2 38.0 130-134 35.264300000000006 38.0 36.6 38.0 30.4 38.0 135-139 34.98335000000001 38.0 36.0 38.0 29.6 38.0 140-144 34.48755 38.0 35.4 38.0 27.4 38.0 145-149 33.717549999999996 38.0 34.6 38.0 22.8 38.0 150-151 29.064 35.5 18.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 2.0 15 2.0 16 4.0 17 2.0 18 4.0 19 4.0 20 7.0 21 6.0 22 10.0 23 10.0 24 10.0 25 12.0 26 31.0 27 22.0 28 25.0 29 31.0 30 40.0 31 52.0 32 69.0 33 84.0 34 139.0 35 237.0 36 547.0 37 2634.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.55697470573504 13.248184322564487 17.380415727523165 36.814425244177315 2 23.678276121272866 21.373089451265347 38.08569280881984 16.862941618641944 3 21.09746930593836 25.457278877474316 30.2179904785768 23.227261338010525 4 24.129290904535207 36.05612628413931 20.270608869957403 19.54397394136808 5 22.84569138276553 37.70040080160321 22.069138276553108 17.384769539078157 6 17.875 36.225 25.0 20.9 7 16.075 14.2 47.699999999999996 22.025 8 20.175 20.424999999999997 28.875 30.525000000000002 9 22.175 24.575 28.475 24.775 10-14 22.805 28.7 26.745 21.75 15-19 23.080000000000002 27.150000000000002 28.470000000000002 21.3 20-24 23.080000000000002 27.985 27.91 21.025 25-29 22.41 28.910000000000004 28.065 20.615 30-34 22.375 28.310000000000002 28.144999999999996 21.17 35-39 23.015 27.325 28.294999999999998 21.365000000000002 40-44 22.91 28.025 28.305000000000003 20.76 45-49 22.81 28.15 28.449999999999996 20.59 50-54 23.200000000000003 28.044999999999998 28.53 20.225 55-59 23.51 27.665 28.175 20.65 60-64 23.11 27.905 28.525 20.46 65-69 23.630000000000003 27.825 28.310000000000002 20.235 70-74 23.26 27.6 28.255000000000003 20.885 75-79 23.515 27.24 28.744999999999997 20.5 80-84 23.22 28.199999999999996 28.144999999999996 20.435 85-89 23.799999999999997 27.71 27.965 20.525 90-94 23.580000000000002 27.889999999999997 28.360000000000003 20.169999999999998 95-99 23.175 28.244999999999997 28.24 20.34 100-104 23.630000000000003 27.605 28.59 20.175 105-109 23.505000000000003 27.21 28.64 20.645 110-114 23.66 28.005000000000003 27.91 20.424999999999997 115-119 23.22 27.48 28.77 20.53 120-124 24.07 27.685 28.1 20.145 125-129 23.615 28.095 27.99 20.3 130-134 24.325 27.894999999999996 27.71 20.07 135-139 24.060000000000002 28.22 28.1 19.62 140-144 25.36 28.04 27.565 19.035 145-149 24.66 28.139999999999997 27.77 19.43 150-151 24.075 27.537499999999998 28.787499999999998 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 4.5 27 6.0 28 7.0 29 9.5 30 12.5 31 21.5 32 26.0 33 35.5 34 45.5 35 53.5 36 85.5 37 112.0 38 132.0 39 165.0 40 206.5 41 241.0 42 269.0 43 279.0 44 283.5 45 290.0 46 273.5 47 253.5 48 231.0 49 204.5 50 161.5 51 135.0 52 117.0 53 83.5 54 61.0 55 49.5 56 38.0 57 23.5 58 16.0 59 12.0 60 10.0 61 10.0 62 8.0 63 5.0 64 3.5 65 2.0 66 0.5 67 3.0 68 3.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.575 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.975 0.0 0.0 0.0 0.0 134-135 4.324999999999999 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 4.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACGTG 10 0.006830828 145.0 145 >>END_MODULE Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859335 spots for SRR7172140.sra Written 859335 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra Read 859316 spots for SRR7172140.sra Written 859316 spots for SRR7172140.sra SRR ids: ['SRR7172140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fci7f2ue SRR7172140.sra spots: 17186339 blocks: [[1, 859316], [859317, 1718632], [1718633, 2577948], [2577949, 3437264], [3437265, 4296580], [4296581, 5155896], [5155897, 6015212], [6015213, 6874528], [6874529, 7733844], [7733845, 8593160], [8593161, 9452476], [9452477, 10311792], [10311793, 11171108], [11171109, 12030424], [12030425, 12889740], [12889741, 13749056], [13749057, 14608372], [14608373, 15467688], [15467689, 16327004], [16327005, 17186339]] SRR7172140 file size 5802185 SRR7172140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172140 SRR7172140_1.fastq SRR7172140_2.fastq Input file: SRR7172140_1.fastq Paired file: SRR7172140_2.fastq trimmed: SRR7172140-trimmed-pair1.fastq, SRR7172140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:37:37 2025 >> started Fri Feb 14 07:38:03 2025 >> done (26.914s) 17186339 read pairs processed; of these: 8259 ( 0.05%) short read pairs filtered out after trimming by size control 6290 ( 0.04%) empty read pairs filtered out after trimming by size control 17171790 (99.92%) read pairs available; of these: 8371414 (48.75%) trimmed read pairs available after processing 8800376 (51.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 8 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 5 0.00% 26 2 0.00% 27 1 0.00% 28 5 0.00% 29 3 0.00% 30 10 0.00% 31 3 0.00% 32 5 0.00% 33 6 0.00% 34 7 0.00% 35 4 0.00% 36 2 0.00% 37 8 0.00% 38 13 0.00% 39 4 0.00% 40 4 0.00% 41 9 0.00% 42 8 0.00% 43 12 0.00% 44 10 0.00% 45 9 0.00% 46 12 0.00% 47 12 0.00% 48 15 0.00% 49 25 0.00% 50 20 0.00% 51 26 0.00% 52 25 0.00% 53 29 0.00% 54 44 0.00% 55 32 0.00% 56 54 0.00% 57 72 0.00% 58 79 0.00% 59 98 0.00% 60 78 0.00% 61 83 0.00% 62 95 0.00% 63 151 0.00% 64 145 0.00% 65 169 0.00% 66 191 0.00% 67 213 0.00% 68 245 0.00% 69 247 0.00% 70 310 0.00% 71 342 0.00% 72 436 0.00% 73 477 0.00% 74 619 0.00% 75 665 0.00% 76 802 0.00% 77 848 0.00% 78 948 0.01% 79 1182 0.01% 80 1277 0.01% 81 1342 0.01% 82 1636 0.01% 83 2043 0.01% 84 3056 0.02% 85 3560 0.02% 86 3700 0.02% 87 4224 0.02% 88 4462 0.03% 89 4489 0.03% 90 4813 0.03% 91 5327 0.03% 92 5722 0.03% 93 6220 0.04% 94 6806 0.04% 95 7105 0.04% 96 7736 0.05% 97 8801 0.05% 98 9445 0.06% 99 10359 0.06% 100 11796 0.07% 101 11754 0.07% 102 12291 0.07% 103 13203 0.08% 104 13721 0.08% 105 14734 0.09% 106 15839 0.09% 107 16514 0.10% 108 17518 0.10% 109 18324 0.11% 110 19574 0.11% 111 20499 0.12% 112 21428 0.12% 113 22553 0.13% 114 23634 0.14% 115 25132 0.15% 116 26139 0.15% 117 27747 0.16% 118 28933 0.17% 119 29935 0.17% 120 31359 0.18% 121 32322 0.19% 122 34014 0.20% 123 35034 0.20% 124 37265 0.22% 125 39273 0.23% 126 40195 0.23% 127 42492 0.25% 128 44324 0.26% 129 46482 0.27% 130 48643 0.28% 131 50313 0.29% 132 53288 0.31% 133 56250 0.33% 134 59527 0.35% 135 63458 0.37% 136 67078 0.39% 137 71011 0.41% 138 76477 0.45% 139 84072 0.49% 140 94217 0.55% 141 99375 0.58% 142 108904 0.63% 143 121562 0.71% 144 140139 0.82% 145 165951 0.97% 146 205870 1.20% 147 275860 1.61% 148 413539 2.41% 149 822888 4.79% 150 4407901 25.67% 151 8800376 51.25% 17171790 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=27 prefix-density=0.49 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=65.68 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.9 sequence=AACAGAAACTAATTAAGCATTTTCATTAATTATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=30 prefix-density=0.63 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=81.81 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=18.1 sequence=TGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGCTTGGTCTTTGCTTATTACAAAGAAGGTGCTAC SRR7172140 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:38:54 Started mapping on | Feb 14 07:38:54 Finished on | Feb 14 07:42:27 Mapping speed, Million of reads per hour | 290.23 Number of input reads | 17171790 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16025993 Uniquely mapped reads % | 93.33% Average mapped length | 294.75 Number of splices: Total | 15634367 Number of splices: Annotated (sjdb) | 15348600 Number of splices: GT/AG | 15371261 Number of splices: GC/AG | 203242 Number of splices: AT/AC | 13790 Number of splices: Non-canonical | 46074 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.03% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494716 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 42929 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 661506 661506 661506 N_multimapping 494716 494716 494716 N_noFeature 471134 15878982 538280 N_ambiguous 176790 1219 96131 UnstrandedReadsAssigned:15378069 PositiveStrandReadsAssigned:145792 NegativeStrandReadsAssigned:15391582 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172140-trimmed-pair1.fastq SRR7172140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,171,790 reads, 15,197,457 reads pseudoaligned [quant] estimated average fragment length: 241.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7172140.ke.tsv 34699 SRR7172140.se.tsv 87100 total ==> SRR7172140.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.92 1427 49.81 Potri.005G024800.1.v4.1 1035 794.921 379 29.5883 Potri.004G059700.1.v4.1 961 720.936 36 3.09893 Potri.007G009000.2.v4.1 1416 1175.92 0 0 Potri.003G141000.2.v4.1 2943 2702.92 453.267 10.407 Potri.016G087400.1.v4.1 270 79.5389 977.49 762.672 Potri.015G069301.1.v4.1 564 327.664 0 0 Potri.010G195200.1.v4.1 1773 1532.92 388.88 15.7435 Potri.012G127500.1.v4.1 977 736.926 6363 535.85 ==> SRR7172140.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 419 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 373 SRR7172140 completed mapping pipeline successfully