Starting /dee2/code/volunteer_pipeline.sh SRR7172141 current disk space = 3102397460480 free memory = 1016246412 SRR7172141 SRAfilesize 991a8ea94865dda4b312806cce0598f2 SRR7172141.sra SRR7172141.sra file validated SRR7172141 is paired end SRR7172141 is conventional basespace SRR7172141 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.967 34.0 33.0 34.0 32.0 34.0 2 33.2955 34.0 33.0 34.0 33.0 34.0 3 32.988 34.0 33.0 34.0 32.0 34.0 4 33.14025 34.0 33.0 34.0 32.0 34.0 5 33.293 34.0 33.0 34.0 33.0 34.0 6 36.93775 38.0 37.0 38.0 35.0 38.0 7 37.3665 38.0 38.0 38.0 37.0 38.0 8 37.447 38.0 38.0 38.0 37.0 38.0 9 37.2955 38.0 38.0 38.0 37.0 38.0 10-14 37.4699 38.0 38.0 38.0 37.2 38.0 15-19 37.5019 38.0 38.0 38.0 37.6 38.0 20-24 37.44985 38.0 38.0 38.0 37.2 38.0 25-29 37.3722 38.0 38.0 38.0 37.0 38.0 30-34 37.32615 38.0 38.0 38.0 37.0 38.0 35-39 37.2303 38.0 38.0 38.0 37.0 38.0 40-44 37.21575 38.0 38.0 38.0 36.6 38.0 45-49 37.1386 38.0 38.0 38.0 36.8 38.0 50-54 37.31125 38.0 38.0 38.0 37.0 38.0 55-59 37.27705 38.0 38.0 38.0 37.0 38.0 60-64 37.16635 38.0 38.0 38.0 36.4 38.0 65-69 37.16525 38.0 38.0 38.0 36.2 38.0 70-74 37.10835 38.0 38.0 38.0 36.0 38.0 75-79 36.96470000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.915850000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.796400000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.734049999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.6198 38.0 38.0 38.0 34.2 38.0 100-104 36.447700000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.40475 38.0 38.0 38.0 34.0 38.0 110-114 36.13205 38.0 37.6 38.0 33.6 38.0 115-119 36.00845 38.0 37.0 38.0 33.0 38.0 120-124 35.740899999999996 38.0 36.8 38.0 31.4 38.0 125-129 35.37075 38.0 36.0 38.0 30.6 38.0 130-134 35.29559999999999 38.0 36.0 38.0 30.6 38.0 135-139 34.93515 38.0 35.8 38.0 28.6 38.0 140-144 34.170300000000005 38.0 33.8 38.0 24.4 38.0 145-149 33.56155 38.0 33.4 38.0 20.2 38.0 150-151 28.67 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 2.0 17 2.0 18 2.0 19 1.0 20 2.0 21 3.0 22 7.0 23 4.0 24 9.0 25 9.0 26 16.0 27 24.0 28 35.0 29 29.0 30 47.0 31 60.0 32 97.0 33 106.0 34 153.0 35 265.0 36 604.0 37 2518.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.275 17.424999999999997 15.475 33.825 2 20.75 25.35 35.575 18.325 3 16.575 32.425 26.924999999999997 24.075 4 20.10502625656414 37.53438359589897 21.905476369092273 20.455113778444613 5 19.525000000000002 36.85 23.875 19.75 6 16.475 35.4 25.324999999999996 22.8 7 12.85 21.075 44.2 21.875 8 17.575 21.275 29.675 31.474999999999998 9 16.960241570206342 21.992954202315047 32.460996477101155 28.58580775037745 10-14 19.03475868967242 29.982495623905976 26.78169542385596 24.20105026256564 15-19 19.505 28.705000000000002 27.55 24.240000000000002 20-24 19.435 28.615000000000002 27.68 24.27 25-29 19.92099604980249 29.106455322766138 27.591379568978446 23.381169058452922 30-34 19.62 29.044999999999998 28.025 23.31 35-39 19.715 28.99 27.700000000000003 23.595 40-44 20.282028202820282 28.417841784178417 28.05780578057806 23.242324232423243 45-49 19.99399879975995 29.290858171634326 27.240448089617924 23.4746949389878 50-54 19.67 28.884999999999998 28.075 23.369999999999997 55-59 19.794999999999998 29.115000000000002 27.425 23.665 60-64 20.330000000000002 29.015 27.07 23.585 65-69 19.705000000000002 28.825 27.88 23.59 70-74 19.93 28.925 27.950000000000003 23.195 75-79 20.349999999999998 28.560000000000002 27.495000000000005 23.595 80-84 20.0 28.34 27.400000000000002 24.26 85-89 20.143021453217983 28.199229884482673 28.01420213031955 23.643546531979798 90-94 20.419999999999998 29.020000000000003 27.3 23.26 95-99 20.244999999999997 27.79 28.349999999999998 23.615 100-104 20.55602780139007 28.57142857142857 27.316365818290915 23.556177808890443 105-109 19.765 28.835 27.825 23.575 110-114 20.11120016028852 28.731717090763375 27.05369665397716 24.103386094970947 115-119 20.325 28.610000000000003 27.515 23.549999999999997 120-124 20.34636368186596 29.040492517143 27.06842184293508 23.54472195805596 125-129 20.78449053201082 27.86794910329626 27.366997294860234 23.980563069832684 130-134 20.915 28.035 27.72 23.330000000000002 135-139 20.945 28.15 27.43 23.474999999999998 140-144 21.154230846169234 28.285657131426284 26.625325065013 23.93478695739148 145-149 20.605 28.62 26.645000000000003 24.13 150-151 20.6125 29.349999999999998 26.087500000000002 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.5 19 1.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 3.5 26 8.0 27 10.0 28 9.5 29 14.5 30 24.5 31 36.5 32 39.0 33 42.0 34 58.0 35 72.5 36 88.0 37 107.5 38 150.5 39 187.0 40 208.5 41 231.5 42 246.0 43 258.5 44 271.0 45 277.5 46 267.0 47 243.5 48 217.0 49 193.5 50 166.0 51 138.0 52 109.0 53 81.0 54 62.0 55 47.0 56 36.5 57 25.0 58 13.5 59 12.0 60 9.0 61 5.0 62 4.5 63 4.5 64 3.5 65 1.5 66 1.0 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.65 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.18 115-119 0.0 120-124 0.105 125-129 0.19 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.85 0.0 0.0 0.0 0.0 132-133 4.1125 0.0 0.0 0.0 0.0 134-135 4.4125 0.0 0.0 0.0 0.0 136-137 4.6125 0.0 0.0 0.0 0.0 138-139 5.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAACCC 10 0.006830828 145.0 3 >>END_MODULE SRR7172141 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91075 33.0 33.0 34.0 32.0 34.0 2 33.0705 34.0 33.0 34.0 32.0 34.0 3 33.098 34.0 33.0 34.0 33.0 34.0 4 33.03025 34.0 33.0 34.0 33.0 34.0 5 33.02225 34.0 33.0 34.0 33.0 34.0 6 37.16625 38.0 38.0 38.0 37.0 38.0 7 37.225 38.0 38.0 38.0 37.0 38.0 8 37.19375 38.0 38.0 38.0 37.0 38.0 9 37.1455 38.0 38.0 38.0 37.0 38.0 10-14 37.181149999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.114549999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.013549999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.04045000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.036649999999995 38.0 38.0 38.0 36.8 38.0 35-39 36.989050000000006 38.0 38.0 38.0 36.6 38.0 40-44 36.9109 38.0 38.0 38.0 36.2 38.0 45-49 36.88785 38.0 38.0 38.0 36.0 38.0 50-54 36.90605000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.833 38.0 38.0 38.0 36.0 38.0 60-64 36.791700000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.6377 38.0 38.0 38.0 35.2 38.0 70-74 36.6865 38.0 38.0 38.0 35.6 38.0 75-79 36.6423 38.0 38.0 38.0 35.6 38.0 80-84 36.5491 38.0 38.0 38.0 34.8 38.0 85-89 36.441100000000006 38.0 38.0 38.0 34.6 38.0 90-94 36.26775000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.1223 38.0 38.0 38.0 34.0 38.0 100-104 36.04045 38.0 38.0 38.0 33.6 38.0 105-109 35.9541 38.0 38.0 38.0 33.4 38.0 110-114 35.71815 38.0 37.6 38.0 31.8 38.0 115-119 35.718399999999995 38.0 37.0 38.0 31.8 38.0 120-124 35.483250000000005 38.0 37.0 38.0 31.0 38.0 125-129 35.07955 38.0 36.0 38.0 29.2 38.0 130-134 34.6869 38.0 36.0 38.0 27.8 38.0 135-139 34.205 38.0 35.6 38.0 24.6 38.0 140-144 33.36875 38.0 33.0 38.0 18.6 38.0 145-149 32.6443 38.0 33.0 38.0 11.8 38.0 150-151 27.613374999999998 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 3.0 5 1.0 6 1.0 7 3.0 8 4.0 9 3.0 10 0.0 11 2.0 12 1.0 13 3.0 14 2.0 15 1.0 16 2.0 17 6.0 18 4.0 19 2.0 20 6.0 21 2.0 22 10.0 23 20.0 24 17.0 25 15.0 26 18.0 27 28.0 28 32.0 29 43.0 30 53.0 31 58.0 32 83.0 33 100.0 34 141.0 35 260.0 36 552.0 37 2509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.78276121272864 15.259333500375845 17.71485843147081 30.243046855424705 2 26.145755071374904 21.23716503881793 35.13648885549712 17.48059103431004 3 19.924906132665832 26.48310387984981 31.414267834793492 22.177722152690862 4 23.329161451814766 34.14267834793492 22.07759699624531 20.450563204005007 5 22.753441802252816 37.37171464330413 21.35168961201502 18.523153942428035 6 19.684447783621337 36.764337590783875 23.766591535186578 19.784623090408214 7 17.255196594039568 16.478837966441272 44.953668920611065 21.312296518908088 8 20.90112640801001 22.02753441802253 28.16020025031289 28.911138923654566 9 22.778473091364205 23.178973717146434 27.88485607008761 26.157697121401753 10-14 23.11351459616444 28.601472134595163 26.468379149767163 21.816634119473235 15-19 22.90550353047223 27.943312133807403 27.63783864990736 21.51334568581301 20-24 22.60647615234473 28.016615784995746 27.801411340773736 21.57549672188579 25-29 23.2161608080404 27.101355067753385 28.826441322066103 20.856042802140106 30-34 22.884999999999998 27.694999999999997 28.515 20.905 35-39 23.455000000000002 27.74 27.82 20.985 40-44 23.195 27.875 28.139999999999997 20.79 45-49 22.855 27.794999999999998 28.74 20.61 50-54 23.556177808890443 27.406370318515926 28.056402820141006 20.981049052452622 55-59 23.745685558501325 27.53238957530889 28.09264168875994 20.629283177429844 60-64 23.34167083541771 27.583791895947975 28.194097048524263 20.880440220110057 65-69 23.673939151321058 27.787229783827062 28.387710168134504 20.151120896717373 70-74 23.58386709367494 27.577061649319457 28.487790232185752 20.351281024819855 75-79 23.95895895895896 28.113113113113116 27.832832832832832 20.095095095095093 80-84 23.095786207586826 28.25042538284456 28.295465919327395 20.358322490241218 85-89 23.280952857571815 27.544790311280153 28.665799219297366 20.508457611850666 90-94 23.403403403403402 27.66266266266266 28.718718718718716 20.215215215215217 95-99 23.315154850652924 27.64296792915395 28.328413468754693 20.713463751438436 100-104 23.546177308865442 27.33136656832842 28.801440072003597 20.32101605080254 105-109 23.595 27.474999999999998 28.03 20.9 110-114 23.87 27.155 28.71 20.265 115-119 23.858578786818022 27.849177376606495 28.399259888983348 19.89298394759214 120-124 23.793086197408574 28.215518535194356 28.060433238281057 19.930962029116014 125-129 23.99559713813979 28.533546805423526 27.09761344874168 20.373242607695 130-134 24.378159251288725 28.066663330163657 27.83143986787448 19.72373755067314 135-139 24.335685332532652 27.713556523044584 27.678526747735578 20.272231396687186 140-144 24.619695756605285 28.012409927942354 27.68714971977582 19.68074459567654 145-149 24.937493749374937 28.28782878287829 27.502750275027505 19.27192719271927 150-151 25.275 27.250000000000004 28.237499999999997 19.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 2.0 25 3.0 26 3.0 27 3.5 28 6.0 29 9.0 30 11.0 31 17.5 32 23.5 33 27.5 34 40.0 35 55.0 36 76.0 37 105.0 38 126.5 39 172.0 40 206.0 41 217.0 42 254.5 43 289.5 44 286.5 45 284.5 46 293.0 47 265.0 48 237.0 49 211.5 50 179.5 51 154.0 52 113.0 53 75.5 54 66.5 55 54.0 56 33.5 57 24.5 58 16.5 59 13.0 60 9.5 61 6.5 62 7.0 63 4.0 64 1.0 65 0.5 66 1.5 67 2.0 68 2.0 69 1.5 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.17500000000000002 3 0.125 4 0.125 5 0.125 6 0.17500000000000002 7 0.17500000000000002 8 0.125 9 0.125 10-14 0.145 15-19 0.155 20-24 0.095 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.045 60-64 0.05 65-69 0.08 70-74 0.08 75-79 0.1 80-84 0.09 85-89 0.09 90-94 0.1 95-99 0.065 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.055 125-129 0.065 130-134 0.095 135-139 0.08499999999999999 140-144 0.08 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.8 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.725 0.0 0.0 0.0 0.0 126-127 3.1 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.9 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.487500000000001 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTGCT 10 0.006830828 145.0 8 >>END_MODULE Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913167 spots for SRR7172141.sra Written 913167 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra Read 913158 spots for SRR7172141.sra Written 913158 spots for SRR7172141.sra SRR ids: ['SRR7172141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5sh94k_q SRR7172141.sra spots: 18263169 blocks: [[1, 913158], [913159, 1826316], [1826317, 2739474], [2739475, 3652632], [3652633, 4565790], [4565791, 5478948], [5478949, 6392106], [6392107, 7305264], [7305265, 8218422], [8218423, 9131580], [9131581, 10044738], [10044739, 10957896], [10957897, 11871054], [11871055, 12784212], [12784213, 13697370], [13697371, 14610528], [14610529, 15523686], [15523687, 16436844], [16436845, 17350002], [17350003, 18263169]] SRR7172141 file size 6167088 SRR7172141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172141 SRR7172141_1.fastq SRR7172141_2.fastq Input file: SRR7172141_1.fastq Paired file: SRR7172141_2.fastq trimmed: SRR7172141-trimmed-pair1.fastq, SRR7172141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:16:00 2025 >> started Fri Feb 14 07:16:22 2025 >> done (22.321s) 18263169 read pairs processed; of these: 20198 ( 0.11%) short read pairs filtered out after trimming by size control 16134 ( 0.09%) empty read pairs filtered out after trimming by size control 18226837 (99.80%) read pairs available; of these: 10437651 (57.27%) trimmed read pairs available after processing 7789186 (42.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 6 0.00% 21 4 0.00% 22 6 0.00% 23 5 0.00% 24 7 0.00% 25 5 0.00% 26 9 0.00% 27 14 0.00% 28 5 0.00% 29 5 0.00% 30 10 0.00% 31 9 0.00% 32 3 0.00% 33 8 0.00% 34 11 0.00% 35 17 0.00% 36 10 0.00% 37 12 0.00% 38 6 0.00% 39 7 0.00% 40 11 0.00% 41 10 0.00% 42 15 0.00% 43 12 0.00% 44 15 0.00% 45 14 0.00% 46 16 0.00% 47 22 0.00% 48 18 0.00% 49 19 0.00% 50 29 0.00% 51 23 0.00% 52 43 0.00% 53 27 0.00% 54 43 0.00% 55 55 0.00% 56 55 0.00% 57 95 0.00% 58 215 0.00% 59 367 0.00% 60 200 0.00% 61 141 0.00% 62 145 0.00% 63 168 0.00% 64 167 0.00% 65 183 0.00% 66 200 0.00% 67 272 0.00% 68 291 0.00% 69 332 0.00% 70 417 0.00% 71 386 0.00% 72 505 0.00% 73 561 0.00% 74 647 0.00% 75 767 0.00% 76 896 0.00% 77 988 0.01% 78 1223 0.01% 79 1366 0.01% 80 1580 0.01% 81 1758 0.01% 82 2125 0.01% 83 3379 0.02% 84 5069 0.03% 85 5694 0.03% 86 5484 0.03% 87 5991 0.03% 88 6266 0.03% 89 5856 0.03% 90 6022 0.03% 91 6333 0.03% 92 6710 0.04% 93 7283 0.04% 94 8277 0.05% 95 9016 0.05% 96 9136 0.05% 97 9951 0.05% 98 10475 0.06% 99 11916 0.07% 100 13344 0.07% 101 13395 0.07% 102 14446 0.08% 103 15409 0.08% 104 15946 0.09% 105 17232 0.09% 106 17853 0.10% 107 18936 0.10% 108 20130 0.11% 109 21347 0.12% 110 22100 0.12% 111 23879 0.13% 112 24841 0.14% 113 26278 0.14% 114 27599 0.15% 115 29408 0.16% 116 31007 0.17% 117 32488 0.18% 118 34411 0.19% 119 36037 0.20% 120 37361 0.20% 121 39876 0.22% 122 41289 0.23% 123 43693 0.24% 124 46208 0.25% 125 48744 0.27% 126 50966 0.28% 127 54486 0.30% 128 56658 0.31% 129 59829 0.33% 130 62107 0.34% 131 64886 0.36% 132 68688 0.38% 133 71241 0.39% 134 75538 0.41% 135 80458 0.44% 136 85953 0.47% 137 89713 0.49% 138 95390 0.52% 139 104499 0.57% 140 116305 0.64% 141 125499 0.69% 142 140594 0.77% 143 161237 0.88% 144 189266 1.04% 145 222563 1.22% 146 285276 1.57% 147 393741 2.16% 148 576197 3.16% 149 1149801 6.31% 150 5204053 28.55% 151 7789186 42.73% 18226837 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=428.81 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=34.0 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=33.60 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.0 sequence=TTTGTTCTTGTCTACACTGTCTTCTCTGC SRR7172141 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:17:14 Started mapping on | Feb 14 07:17:14 Finished on | Feb 14 07:19:25 Mapping speed, Million of reads per hour | 500.89 Number of input reads | 18226837 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17307541 Uniquely mapped reads % | 94.96% Average mapped length | 293.56 Number of splices: Total | 17303572 Number of splices: Annotated (sjdb) | 17017004 Number of splices: GT/AG | 17026810 Number of splices: GC/AG | 218408 Number of splices: AT/AC | 12824 Number of splices: Non-canonical | 45530 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 529540 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 47620 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 413389 413389 413389 N_multimapping 529540 529540 529540 N_noFeature 414769 17155576 479766 N_ambiguous 182830 1437 94827 UnstrandedReadsAssigned:16709942 PositiveStrandReadsAssigned:150528 NegativeStrandReadsAssigned:16732948 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172141-trimmed-pair1.fastq SRR7172141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,226,837 reads, 16,609,533 reads pseudoaligned [quant] estimated average fragment length: 245.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR7172141.ke.tsv 34699 SRR7172141.se.tsv 87100 total ==> SRR7172141.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.1 1614 51.364 Potri.005G024800.1.v4.1 1035 790.102 420 29.9954 Potri.004G059700.1.v4.1 961 716.112 10 0.787967 Potri.007G009000.2.v4.1 1416 1171.1 0 0 Potri.003G141000.2.v4.1 2943 2698.1 533.17 11.1506 Potri.016G087400.1.v4.1 270 79.9816 1063 749.95 Potri.015G069301.1.v4.1 564 324.197 0 0 Potri.010G195200.1.v4.1 1773 1528.1 521.862 19.2704 Potri.012G127500.1.v4.1 977 732.107 8589 661.998 ==> SRR7172141.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 542 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 309 SRR7172141 completed mapping pipeline successfully