Starting /dee2/code/volunteer_pipeline.sh SRR7172142 current disk space = 3117423751168 free memory = 1579380876 SRR7172142 SRAfilesize 91d12423140189994c54446807967305 SRR7172142.sra SRR7172142.sra file validated SRR7172142 is paired end SRR7172142 is conventional basespace SRR7172142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91475 33.0 33.0 34.0 32.0 34.0 2 33.1595 34.0 33.0 34.0 32.0 34.0 3 33.13025 34.0 33.0 34.0 32.0 34.0 4 32.8645 33.0 33.0 34.0 32.0 34.0 5 33.1685 34.0 33.0 34.0 33.0 34.0 6 36.87725 38.0 37.0 38.0 35.0 38.0 7 37.39525 38.0 38.0 38.0 37.0 38.0 8 37.4475 38.0 38.0 38.0 37.0 38.0 9 37.48825 38.0 38.0 38.0 38.0 38.0 10-14 37.29705 38.0 38.0 38.0 37.2 38.0 15-19 37.46985 38.0 38.0 38.0 38.0 38.0 20-24 37.385749999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.3813 38.0 38.0 38.0 37.0 38.0 30-34 37.380250000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.2761 38.0 38.0 38.0 37.0 38.0 40-44 37.2325 38.0 38.0 38.0 37.0 38.0 45-49 36.90695 38.0 38.0 38.0 35.8 38.0 50-54 37.23175 38.0 38.0 38.0 37.0 38.0 55-59 37.3096 38.0 38.0 38.0 37.0 38.0 60-64 37.2736 38.0 38.0 38.0 37.0 38.0 65-69 37.281349999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.139700000000005 38.0 38.0 38.0 36.2 38.0 75-79 37.00920000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.0167 38.0 38.0 38.0 36.0 38.0 85-89 36.872 38.0 38.0 38.0 35.6 38.0 90-94 36.83819999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.78945 38.0 38.0 38.0 35.0 38.0 100-104 36.76055 38.0 38.0 38.0 35.0 38.0 105-109 36.604200000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.43335 38.0 38.0 38.0 34.0 38.0 115-119 36.275999999999996 38.0 37.8 38.0 33.8 38.0 120-124 36.1573 38.0 37.6 38.0 33.6 38.0 125-129 35.96375 38.0 37.0 38.0 33.0 38.0 130-134 35.70115 38.0 36.4 38.0 31.4 38.0 135-139 35.43065 38.0 36.0 38.0 31.0 38.0 140-144 34.948249999999994 38.0 35.8 38.0 30.0 38.0 145-149 34.16845 38.0 35.4 38.0 26.4 38.0 150-151 28.92475 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 4.0 21 8.0 22 4.0 23 2.0 24 8.0 25 8.0 26 9.0 27 18.0 28 31.0 29 29.0 30 35.0 31 56.0 32 80.0 33 87.0 34 140.0 35 225.0 36 582.0 37 2667.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.65 15.275 15.575 39.5 2 19.1 24.325 39.625 16.950000000000003 3 17.8 31.2 26.424999999999997 24.575 4 22.45 37.125 21.625 18.8 5 19.35 38.375 23.5 18.775 6 15.825 37.325 25.874999999999996 20.974999999999998 7 12.35 22.05 44.25 21.349999999999998 8 18.0 23.0 28.375 30.625000000000004 9 17.9 22.625 31.85 27.625 10-14 19.304767167328077 31.139800070327023 26.066207866579592 23.48922489576531 15-19 19.655 29.134999999999998 27.939999999999998 23.27 20-24 19.09 29.080000000000002 28.189999999999998 23.64 25-29 19.035 29.775000000000002 27.655 23.535 30-34 19.564999999999998 29.865000000000002 26.889999999999997 23.68 35-39 19.985 29.609999999999996 27.49 22.915 40-44 19.475 29.78 27.62 23.125 45-49 19.689999999999998 29.25 27.565 23.494999999999997 50-54 19.43 29.49 28.275 22.805 55-59 19.695 28.57 28.655 23.080000000000002 60-64 19.56 29.160000000000004 27.845 23.435 65-69 20.075000000000003 28.46 28.139999999999997 23.325000000000003 70-74 19.55 28.775000000000002 28.43 23.244999999999997 75-79 20.34 28.68 27.805000000000003 23.175 80-84 19.869999999999997 29.38 27.48 23.27 85-89 20.305 28.78 28.15 22.765 90-94 20.26 29.175 27.515 23.05 95-99 20.380000000000003 28.444999999999997 27.860000000000003 23.315 100-104 20.105 29.044999999999998 28.08 22.770000000000003 105-109 20.66 28.255000000000003 27.644999999999996 23.44 110-114 20.7970797079708 28.967896789678964 27.317731773177318 22.917291729172916 115-119 20.369999999999997 28.875 27.605 23.150000000000002 120-124 20.459091818363675 28.62072414482897 27.475495099019803 23.444688937787557 125-129 20.558223289315727 28.241296518607445 27.460984393757503 23.739495798319325 130-134 21.025 29.104999999999997 27.229999999999997 22.64 135-139 21.185000000000002 28.465 26.884999999999998 23.465 140-144 20.794999999999998 28.494999999999997 27.175 23.535 145-149 21.075 28.48 26.779999999999998 23.665 150-151 20.549999999999997 28.075 26.974999999999998 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 1.5 20 2.5 21 1.5 22 1.0 23 2.0 24 4.0 25 4.5 26 5.5 27 9.5 28 15.5 29 18.0 30 26.5 31 37.0 32 44.0 33 61.5 34 82.0 35 97.0 36 117.0 37 142.5 38 164.5 39 185.5 40 205.5 41 227.5 42 238.0 43 245.0 44 252.5 45 236.5 46 235.0 47 238.5 48 218.0 49 198.0 50 172.5 51 129.5 52 104.5 53 81.0 54 46.5 55 33.0 56 24.5 57 15.5 58 14.0 59 11.5 60 8.5 61 8.5 62 4.5 63 4.5 64 4.0 65 4.5 66 5.0 67 1.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.46499999999999997 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.0 120-124 0.02 125-129 0.04 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.725 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.35 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.028 33.0 33.0 34.0 32.0 34.0 2 33.02175 34.0 33.0 34.0 32.0 34.0 3 33.07975 34.0 33.0 34.0 33.0 34.0 4 33.04775 34.0 33.0 34.0 33.0 34.0 5 33.066 34.0 33.0 34.0 33.0 34.0 6 37.23825 38.0 38.0 38.0 37.0 38.0 7 37.3955 38.0 38.0 38.0 38.0 38.0 8 37.2975 38.0 38.0 38.0 38.0 38.0 9 37.28275 38.0 38.0 38.0 38.0 38.0 10-14 37.2787 38.0 38.0 38.0 37.2 38.0 15-19 37.241049999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.16465000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.07045 38.0 38.0 38.0 37.0 38.0 30-34 37.13155 38.0 38.0 38.0 37.0 38.0 35-39 37.0505 38.0 38.0 38.0 36.8 38.0 40-44 37.0252 38.0 38.0 38.0 36.6 38.0 45-49 37.09454999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.15715 38.0 38.0 38.0 36.8 38.0 55-59 37.092499999999994 38.0 38.0 38.0 36.8 38.0 60-64 37.056050000000006 38.0 38.0 38.0 36.6 38.0 65-69 37.00685 38.0 38.0 38.0 36.2 38.0 70-74 36.9519 38.0 38.0 38.0 36.0 38.0 75-79 36.9638 38.0 38.0 38.0 36.0 38.0 80-84 36.80095 38.0 38.0 38.0 36.0 38.0 85-89 36.677 38.0 38.0 38.0 35.2 38.0 90-94 36.59165 38.0 38.0 38.0 34.6 38.0 95-99 36.381600000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.3542 38.0 38.0 38.0 34.0 38.0 105-109 36.3291 38.0 38.0 38.0 34.0 38.0 110-114 36.21165 38.0 38.0 38.0 34.0 38.0 115-119 36.099900000000005 38.0 38.0 38.0 33.6 38.0 120-124 35.89659999999999 38.0 37.6 38.0 33.2 38.0 125-129 35.7183 38.0 37.0 38.0 32.2 38.0 130-134 35.3781 38.0 36.6 38.0 31.0 38.0 135-139 35.08215 38.0 36.0 38.0 30.2 38.0 140-144 34.596349999999994 38.0 35.8 38.0 28.6 38.0 145-149 33.824850000000005 38.0 35.6 38.0 23.4 38.0 150-151 29.016125000000002 35.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 4.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 4.0 18 2.0 19 1.0 20 5.0 21 9.0 22 9.0 23 6.0 24 9.0 25 18.0 26 18.0 27 22.0 28 26.0 29 29.0 30 44.0 31 47.0 32 72.0 33 78.0 34 117.0 35 225.0 36 501.0 37 2731.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.59079539769885 14.607303651825912 19.909954977488745 33.89194597298649 2 22.8978978978979 22.197197197197198 38.46346346346346 16.441441441441444 3 20.82082082082082 25.8008008008008 31.206206206206204 22.17217217217217 4 25.075075075075077 32.80780780780781 22.67267267267267 19.444444444444446 5 23.88694347173587 36.643321660830416 21.810905452726363 17.658829414707352 6 17.67941985496374 38.959739934983745 23.58089522380595 19.779944986246562 7 17.25 14.7 47.275 20.775 8 21.275 21.4 27.950000000000003 29.375 9 21.25 24.375 28.349999999999998 26.025 10-14 23.006150307515373 28.901445072253612 26.696334816740837 21.396069803490175 15-19 23.205000000000002 27.49 28.444999999999997 20.86 20-24 23.05 28.060000000000002 28.244999999999997 20.645 25-29 23.59 27.925 27.74 20.745 30-34 23.35 27.705000000000002 28.77 20.175 35-39 23.68 27.105 28.28 20.935000000000002 40-44 23.315 28.03 27.779999999999998 20.875 45-49 22.965 27.810000000000002 28.345 20.880000000000003 50-54 23.48 27.634999999999998 28.110000000000003 20.775 55-59 23.794999999999998 28.04 27.97 20.195 60-64 23.435 28.18 28.155 20.23 65-69 23.544999999999998 27.665 28.34 20.45 70-74 23.57 27.91 28.1 20.419999999999998 75-79 23.474999999999998 28.09 28.275 20.16 80-84 22.97 28.09 28.325 20.615 85-89 23.635 27.62 27.839999999999996 20.905 90-94 23.330000000000002 28.065 28.1 20.505000000000003 95-99 23.125 27.77 28.389999999999997 20.715 100-104 23.799999999999997 28.044999999999998 27.93 20.225 105-109 23.830000000000002 28.175 28.22 19.775000000000002 110-114 23.765 28.194999999999997 28.075 19.965 115-119 23.915 28.18 27.825 20.080000000000002 120-124 24.3 28.155 28.134999999999998 19.41 125-129 24.099999999999998 28.215 27.994999999999997 19.689999999999998 130-134 24.22 27.47 28.34 19.97 135-139 24.54 28.310000000000002 28.005000000000003 19.145 140-144 24.995 28.12 27.334999999999997 19.55 145-149 24.455 27.855 28.33 19.36 150-151 25.05 27.450000000000003 27.187499999999996 20.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 0.0 25 0.0 26 1.0 27 2.0 28 6.5 29 12.0 30 14.5 31 19.0 32 22.5 33 33.0 34 54.5 35 65.0 36 79.0 37 96.5 38 132.5 39 167.5 40 194.5 41 247.0 42 269.5 43 268.5 44 280.5 45 296.5 46 280.0 47 256.0 48 232.0 49 195.5 50 168.5 51 149.5 52 118.0 53 83.0 54 70.5 55 54.5 56 39.5 57 26.0 58 18.0 59 14.0 60 6.5 61 4.5 62 3.5 63 2.5 64 2.0 65 2.0 66 2.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.1 4 0.1 5 0.05 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 4.074999999999999 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.3 0.0 0.0 0.0 0.0 136-137 5.824999999999999 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834192 spots for SRR7172142.sra Written 834192 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra Read 834183 spots for SRR7172142.sra Written 834183 spots for SRR7172142.sra SRR ids: ['SRR7172142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_opupw00d SRR7172142.sra spots: 16683669 blocks: [[1, 834183], [834184, 1668366], [1668367, 2502549], [2502550, 3336732], [3336733, 4170915], [4170916, 5005098], [5005099, 5839281], [5839282, 6673464], [6673465, 7507647], [7507648, 8341830], [8341831, 9176013], [9176014, 10010196], [10010197, 10844379], [10844380, 11678562], [11678563, 12512745], [12512746, 13346928], [13346929, 14181111], [14181112, 15015294], [15015295, 15849477], [15849478, 16683669]] SRR7172142 file size 5631847 SRR7172142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172142 SRR7172142_1.fastq SRR7172142_2.fastq Input file: SRR7172142_1.fastq Paired file: SRR7172142_2.fastq trimmed: SRR7172142-trimmed-pair1.fastq, SRR7172142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:48:40 2025 >> started Fri Feb 14 08:48:58 2025 >> done (17.988s) 16683669 read pairs processed; of these: 8282 ( 0.05%) short read pairs filtered out after trimming by size control 7253 ( 0.04%) empty read pairs filtered out after trimming by size control 16668134 (99.91%) read pairs available; of these: 8134633 (48.80%) trimmed read pairs available after processing 8533501 (51.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 8 0.00% 30 4 0.00% 31 6 0.00% 32 3 0.00% 33 3 0.00% 34 4 0.00% 35 2 0.00% 36 2 0.00% 37 2 0.00% 38 5 0.00% 39 6 0.00% 40 9 0.00% 41 5 0.00% 42 7 0.00% 43 9 0.00% 44 10 0.00% 45 6 0.00% 46 12 0.00% 47 15 0.00% 48 18 0.00% 49 21 0.00% 50 18 0.00% 51 21 0.00% 52 23 0.00% 53 29 0.00% 54 24 0.00% 55 36 0.00% 56 48 0.00% 57 62 0.00% 58 100 0.00% 59 73 0.00% 60 93 0.00% 61 106 0.00% 62 99 0.00% 63 135 0.00% 64 131 0.00% 65 143 0.00% 66 195 0.00% 67 184 0.00% 68 230 0.00% 69 282 0.00% 70 299 0.00% 71 348 0.00% 72 412 0.00% 73 509 0.00% 74 549 0.00% 75 613 0.00% 76 737 0.00% 77 884 0.01% 78 967 0.01% 79 1178 0.01% 80 1343 0.01% 81 1416 0.01% 82 1670 0.01% 83 1983 0.01% 84 3068 0.02% 85 3601 0.02% 86 3731 0.02% 87 4240 0.03% 88 4627 0.03% 89 4559 0.03% 90 4992 0.03% 91 5500 0.03% 92 5920 0.04% 93 6344 0.04% 94 6895 0.04% 95 7526 0.05% 96 8130 0.05% 97 8915 0.05% 98 9549 0.06% 99 10625 0.06% 100 12171 0.07% 101 11990 0.07% 102 12664 0.08% 103 14072 0.08% 104 14413 0.09% 105 15238 0.09% 106 16667 0.10% 107 17415 0.10% 108 18503 0.11% 109 19663 0.12% 110 20622 0.12% 111 21464 0.13% 112 22680 0.14% 113 23649 0.14% 114 24765 0.15% 115 26266 0.16% 116 27638 0.17% 117 28976 0.17% 118 30411 0.18% 119 31137 0.19% 120 32661 0.20% 121 34456 0.21% 122 35685 0.21% 123 37210 0.22% 124 39278 0.24% 125 40016 0.24% 126 42060 0.25% 127 43553 0.26% 128 45038 0.27% 129 47797 0.29% 130 49680 0.30% 131 51390 0.31% 132 53443 0.32% 133 57098 0.34% 134 60058 0.36% 135 63044 0.38% 136 67862 0.41% 137 70619 0.42% 138 75590 0.45% 139 82749 0.50% 140 93271 0.56% 141 96932 0.58% 142 106409 0.64% 143 118255 0.71% 144 136850 0.82% 145 160461 0.96% 146 197471 1.18% 147 263301 1.58% 148 394986 2.37% 149 783998 4.70% 150 4229668 25.38% 151 8533501 51.20% 16668134 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=26 prefix-density=0.52 prefix-fanout=3.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=120.70 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.8 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=3.2 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=97.28 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=14.5 sequence=GATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGGGGAAGCCGGGCACTGTAATCTGCTGGAGTTATGTACATGATGGGGTTGCTAAGACTGCTAAGGAGGTTATTGAAGCTATAGACGATGAGAAGCTGTCAACCACCTTCAAAGTGATTGAAGGAGACATCACCACGGAGTACAAGAATTTCATAATTATCGTTCAAGCTACTCCCAAAGGAGAGGGCAGCTGCTTGGCTCACTGGACTTTTGAATATGAGAAGCTAAATGAGAACGTTCCAGATCCTCAAACGTTGCTTGAGTTTTGCATCCATTGCAGCAAAGACATTGAGGATCATCACCTTACCCAG SRR7172142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:49:44 Started mapping on | Feb 14 08:49:44 Finished on | Feb 14 08:52:22 Mapping speed, Million of reads per hour | 379.78 Number of input reads | 16668134 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15518474 Uniquely mapped reads % | 93.10% Average mapped length | 294.47 Number of splices: Total | 14604627 Number of splices: Annotated (sjdb) | 14321575 Number of splices: GT/AG | 14367221 Number of splices: GC/AG | 180439 Number of splices: AT/AC | 12511 Number of splices: Non-canonical | 44456 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.39 Insertion rate per base | 0.03% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449982 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 43252 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 709568 709568 709568 N_multimapping 449982 449982 449982 N_noFeature 363786 15334526 438217 N_ambiguous 192460 1088 82590 UnstrandedReadsAssigned:14962228 PositiveStrandReadsAssigned:182860 NegativeStrandReadsAssigned:14997667 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172142-trimmed-pair1.fastq SRR7172142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,668,134 reads, 14,833,486 reads pseudoaligned [quant] estimated average fragment length: 235.189 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7172142.ke.tsv 34699 SRR7172142.se.tsv 87100 total ==> SRR7172142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.81 935 30.4443 Potri.005G024800.1.v4.1 1035 800.811 378 27.416 Potri.004G059700.1.v4.1 961 726.816 25 1.99783 Potri.007G009000.2.v4.1 1416 1181.81 0 0 Potri.003G141000.2.v4.1 2943 2708.81 526.181 11.2823 Potri.016G087400.1.v4.1 270 80.7655 1216.96 875.174 Potri.015G069301.1.v4.1 564 332.937 0 0 Potri.010G195200.1.v4.1 1773 1538.81 191 7.20927 Potri.012G127500.1.v4.1 977 742.811 5965 466.418 ==> SRR7172142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 97 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 794 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 126 SRR7172142 completed mapping pipeline successfully