Starting /dee2/code/volunteer_pipeline.sh SRR7172143 current disk space = 2818758983680 free memory = 1463804324 SRR7172143 SRAfilesize 412ce6310b94d5f8e9f68c9b842a2b74 SRR7172143.sra SRR7172143.sra file validated SRR7172143 is paired end SRR7172143 is conventional basespace SRR7172143 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08825 33.0 33.0 34.0 30.0 34.0 2 32.79925 33.0 33.0 34.0 32.0 34.0 3 31.69 33.0 31.0 33.0 28.0 34.0 4 32.32875 33.0 33.0 33.0 31.0 34.0 5 32.8705 33.0 33.0 34.0 32.0 34.0 6 36.58125 38.0 37.0 38.0 34.0 38.0 7 37.221 38.0 38.0 38.0 36.0 38.0 8 37.51525 38.0 38.0 38.0 37.0 38.0 9 37.611 38.0 38.0 38.0 38.0 38.0 10-14 37.6197 38.0 38.0 38.0 38.0 38.0 15-19 37.60475 38.0 38.0 38.0 38.0 38.0 20-24 37.612249999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.59590000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.5433 38.0 38.0 38.0 37.6 38.0 35-39 37.541599999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.454750000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.415000000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.34495 38.0 38.0 38.0 37.0 38.0 55-59 37.2419 38.0 38.0 38.0 36.2 38.0 60-64 37.15855 38.0 38.0 38.0 36.0 38.0 65-69 37.122299999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.07415 38.0 38.0 38.0 36.0 38.0 75-79 36.9855 38.0 38.0 38.0 36.0 38.0 80-84 36.922799999999995 38.0 38.0 38.0 35.6 38.0 85-89 36.848349999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.756800000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.66779999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.50455 38.0 37.8 38.0 34.0 38.0 105-109 36.22449999999999 38.0 37.0 38.0 33.6 38.0 110-114 36.074850000000005 38.0 37.0 38.0 33.2 38.0 115-119 35.93835 38.0 37.0 38.0 32.4 38.0 120-124 35.754149999999996 38.0 36.6 38.0 31.0 38.0 125-129 35.46505 38.0 36.0 38.0 29.8 38.0 130-134 35.28959999999999 38.0 35.6 38.0 29.4 38.0 135-139 34.84445 38.0 35.0 38.0 27.8 38.0 140-144 34.14255 38.0 34.2 38.0 23.8 38.0 145-149 33.590199999999996 38.0 34.0 38.0 20.4 38.0 150-151 29.867625 36.0 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 4.0 16 1.0 17 2.0 18 0.0 19 0.0 20 2.0 21 4.0 22 2.0 23 4.0 24 5.0 25 8.0 26 10.0 27 15.0 28 11.0 29 23.0 30 32.0 31 41.0 32 71.0 33 98.0 34 177.0 35 344.0 36 979.0 37 2164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.19316688567674 20.02628120893561 12.115637319316688 34.664914586070964 2 18.4 25.974999999999998 35.9 19.725 3 16.275000000000002 33.2 27.55 22.975 4 19.85 36.25 22.425 21.475 5 19.75 38.35 23.225 18.675 6 17.5 36.225 22.650000000000002 23.625 7 11.774999999999999 21.925 44.725 21.575 8 18.099999999999998 21.425 28.7 31.775 9 17.424999999999997 21.349999999999998 31.1 30.125 10-14 19.64 30.0 26.83 23.53 15-19 20.155 29.005 27.505000000000003 23.335 20-24 19.955000000000002 29.38 27.755000000000003 22.91 25-29 19.72 28.965000000000003 27.92 23.395 30-34 19.32 29.43 27.93 23.32 35-39 19.74 29.255 27.950000000000003 23.055 40-44 20.275000000000002 28.715000000000003 27.994999999999997 23.015 45-49 19.830000000000002 29.34 27.455000000000002 23.375 50-54 20.095 29.18 27.595 23.13 55-59 20.355 28.96 27.99 22.695 60-64 19.794999999999998 29.215000000000003 27.71 23.28 65-69 19.939999999999998 28.865000000000002 27.93 23.265 70-74 20.34 28.884999999999998 27.79 22.985 75-79 20.03 29.165000000000003 27.61 23.195 80-84 20.775 28.825 27.255000000000003 23.145 85-89 20.28 28.999999999999996 27.55 23.169999999999998 90-94 20.22 29.03 27.35 23.400000000000002 95-99 19.915 28.54 27.685 23.86 100-104 20.34 29.645 27.27 22.745 105-109 20.365 28.694999999999997 27.224999999999998 23.715 110-114 20.645 28.78 27.54 23.035 115-119 20.895 28.34 27.935 22.830000000000002 120-124 20.735 28.395 27.175 23.695 125-129 20.625 28.845 27.025 23.505000000000003 130-134 20.91 28.475 26.955000000000002 23.66 135-139 20.979999999999997 27.55 27.439999999999998 24.03 140-144 20.515 28.29 27.43 23.765 145-149 20.955 28.994999999999997 26.705000000000002 23.345 150-151 21.1375 28.499999999999996 26.700000000000003 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 3.5 24 4.0 25 4.0 26 5.0 27 8.5 28 12.5 29 17.5 30 20.0 31 26.0 32 37.5 33 53.0 34 70.5 35 91.0 36 109.0 37 137.5 38 150.5 39 169.0 40 199.5 41 224.0 42 250.0 43 276.5 44 293.5 45 286.0 46 264.5 47 231.0 48 213.0 49 181.0 50 149.5 51 126.0 52 95.0 53 75.5 54 59.0 55 39.5 56 32.0 57 24.5 58 15.5 59 11.0 60 7.5 61 6.0 62 4.5 63 5.0 64 3.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.9625000000000004 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 3.925 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.637499999999999 0.0 0.0 0.0 0.0 128-129 5.1125 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 6.0125 0.0 0.0 0.0 0.0 134-135 6.375 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATTTG 10 0.0060887975 150.61038 1 CCCATAA 10 0.006836113 144.9625 9 >>END_MODULE SRR7172143 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25675 34.0 33.0 34.0 33.0 34.0 2 33.32875 34.0 33.0 34.0 33.0 34.0 3 33.378 34.0 33.0 34.0 33.0 34.0 4 33.3585 34.0 33.0 34.0 33.0 34.0 5 33.401 34.0 33.0 34.0 33.0 34.0 6 37.53475 38.0 38.0 38.0 38.0 38.0 7 37.5955 38.0 38.0 38.0 38.0 38.0 8 37.595 38.0 38.0 38.0 38.0 38.0 9 37.6025 38.0 38.0 38.0 38.0 38.0 10-14 37.57015 38.0 38.0 38.0 38.0 38.0 15-19 37.541250000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.554700000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5172 38.0 38.0 38.0 38.0 38.0 30-34 37.46775 38.0 38.0 38.0 38.0 38.0 35-39 37.39135 38.0 38.0 38.0 37.0 38.0 40-44 37.4207 38.0 38.0 38.0 37.4 38.0 45-49 37.391999999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.357749999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.25555 38.0 38.0 38.0 36.8 38.0 60-64 37.217200000000005 38.0 38.0 38.0 36.4 38.0 65-69 37.20565 38.0 38.0 38.0 36.8 38.0 70-74 37.06175 38.0 38.0 38.0 36.0 38.0 75-79 37.0705 38.0 38.0 38.0 36.0 38.0 80-84 36.9601 38.0 38.0 38.0 36.0 38.0 85-89 36.871449999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.7341 38.0 38.0 38.0 35.0 38.0 95-99 36.65725 38.0 38.0 38.0 34.4 38.0 100-104 36.4918 38.0 38.0 38.0 34.0 38.0 105-109 36.3312 38.0 37.6 38.0 33.6 38.0 110-114 36.153650000000006 38.0 37.0 38.0 33.8 38.0 115-119 35.9616 38.0 37.0 38.0 33.0 38.0 120-124 35.67155 38.0 36.6 38.0 31.4 38.0 125-129 35.37775 38.0 36.0 38.0 29.8 38.0 130-134 35.10215 38.0 35.8 38.0 28.8 38.0 135-139 34.8777 38.0 35.4 38.0 28.0 38.0 140-144 34.46104999999999 38.0 34.6 38.0 27.2 38.0 145-149 33.7435 38.0 34.0 38.0 23.4 38.0 150-151 29.418749999999996 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 2.0 17 2.0 18 4.0 19 4.0 20 2.0 21 5.0 22 6.0 23 10.0 24 9.0 25 10.0 26 13.0 27 13.0 28 20.0 29 29.0 30 33.0 31 43.0 32 46.0 33 77.0 34 151.0 35 276.0 36 748.0 37 2490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.5 14.825 15.35 32.324999999999996 2 23.1 21.325 36.425000000000004 19.15 3 19.525000000000002 26.424999999999997 32.95 21.099999999999998 4 23.575 35.05 20.775 20.599999999999998 5 23.05 36.475 22.05 18.425 6 17.95 37.425000000000004 23.75 20.875 7 17.150000000000002 15.125 45.65 22.075 8 18.625 21.55 29.7 30.125 9 21.9 23.7 27.925 26.474999999999998 10-14 22.745 28.189999999999998 27.200000000000003 21.865000000000002 15-19 22.509999999999998 28.444999999999997 27.889999999999997 21.154999999999998 20-24 22.875 28.185 28.294999999999998 20.645 25-29 22.765 28.425 28.055000000000003 20.755000000000003 30-34 22.505 28.449999999999996 28.345 20.7 35-39 23.085 27.97 28.194999999999997 20.75 40-44 22.79 28.505000000000003 28.389999999999997 20.315 45-49 22.96 27.775 28.854999999999997 20.41 50-54 23.185 27.66 28.144999999999996 21.01 55-59 22.98 27.83 28.63 20.560000000000002 60-64 23.799999999999997 27.83 28.18 20.19 65-69 22.85 27.794999999999998 28.549999999999997 20.805 70-74 23.31 28.13 28.215 20.345 75-79 23.455000000000002 27.810000000000002 28.27 20.465 80-84 23.105 28.29 28.044999999999998 20.560000000000002 85-89 23.31 27.66 28.325 20.705000000000002 90-94 22.865 28.205000000000002 28.27 20.66 95-99 23.200000000000003 27.889999999999997 28.175 20.735 100-104 23.71 27.99 28.175 20.125 105-109 23.52 28.189999999999998 28.43 19.86 110-114 24.12 27.905 27.85 20.125 115-119 24.21 28.455000000000002 27.389999999999997 19.945 120-124 23.474999999999998 27.925 28.075 20.525 125-129 24.275 27.834999999999997 28.000000000000004 19.89 130-134 24.4 28.015 27.810000000000002 19.775000000000002 135-139 24.26 28.355000000000004 28.044999999999998 19.34 140-144 24.695 27.615000000000002 27.765 19.925 145-149 24.755 27.82 27.939999999999998 19.485 150-151 25.8 27.487499999999997 27.750000000000004 18.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 3.0 27 3.5 28 7.0 29 10.5 30 14.5 31 22.0 32 27.5 33 33.0 34 48.0 35 68.0 36 93.5 37 118.5 38 143.0 39 172.0 40 189.0 41 210.0 42 259.5 43 296.5 44 307.0 45 286.5 46 263.0 47 267.0 48 248.0 49 208.0 50 169.5 51 134.5 52 97.0 53 70.5 54 59.5 55 48.0 56 35.0 57 24.5 58 13.5 59 9.5 60 10.5 61 8.0 62 5.5 63 3.0 64 2.0 65 1.5 66 1.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.7000000000000002 0.0 0.0 0.0 0.0 110-111 1.9749999999999999 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.1125 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.800000000000001 0.0 0.0 0.0 0.0 138-139 7.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 55 0.0025160722 15.818182 110-114 >>END_MODULE Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra Read 530587 spots for SRR7172143.sra Written 530587 spots for SRR7172143.sra SRR ids: ['SRR7172143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xz14dyo7 SRR7172143.sra spots: 10611740 blocks: [[1, 530587], [530588, 1061174], [1061175, 1591761], [1591762, 2122348], [2122349, 2652935], [2652936, 3183522], [3183523, 3714109], [3714110, 4244696], [4244697, 4775283], [4775284, 5305870], [5305871, 5836457], [5836458, 6367044], [6367045, 6897631], [6897632, 7428218], [7428219, 7958805], [7958806, 8489392], [8489393, 9019979], [9019980, 9550566], [9550567, 10081153], [10081154, 10611740]] SRR7172143 file size 3574270 SRR7172143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172143 SRR7172143_1.fastq SRR7172143_2.fastq Input file: SRR7172143_1.fastq Paired file: SRR7172143_2.fastq trimmed: SRR7172143-trimmed-pair1.fastq, SRR7172143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:58:08 2025 >> started Thu Apr 10 15:58:21 2025 >> done (13.343s) 10611740 read pairs processed; of these: 3560 ( 0.03%) short read pairs filtered out after trimming by size control 1951 ( 0.02%) empty read pairs filtered out after trimming by size control 10606229 (99.95%) read pairs available; of these: 6266792 (59.09%) trimmed read pairs available after processing 4339437 (40.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 8 0.00% 24 4 0.00% 25 3 0.00% 26 8 0.00% 27 4 0.00% 28 7 0.00% 29 6 0.00% 30 5 0.00% 31 3 0.00% 32 4 0.00% 33 9 0.00% 34 5 0.00% 35 4 0.00% 36 5 0.00% 37 8 0.00% 38 7 0.00% 39 5 0.00% 40 11 0.00% 41 12 0.00% 42 10 0.00% 43 11 0.00% 44 14 0.00% 45 14 0.00% 46 7 0.00% 47 16 0.00% 48 17 0.00% 49 17 0.00% 50 16 0.00% 51 23 0.00% 52 32 0.00% 53 36 0.00% 54 37 0.00% 55 38 0.00% 56 54 0.00% 57 53 0.00% 58 63 0.00% 59 67 0.00% 60 95 0.00% 61 90 0.00% 62 118 0.00% 63 118 0.00% 64 164 0.00% 65 153 0.00% 66 196 0.00% 67 238 0.00% 68 246 0.00% 69 312 0.00% 70 351 0.00% 71 406 0.00% 72 524 0.00% 73 559 0.01% 74 652 0.01% 75 734 0.01% 76 823 0.01% 77 929 0.01% 78 1044 0.01% 79 1171 0.01% 80 1417 0.01% 81 1543 0.01% 82 1818 0.02% 83 2046 0.02% 84 2462 0.02% 85 2959 0.03% 86 3115 0.03% 87 3447 0.03% 88 3743 0.04% 89 3915 0.04% 90 4528 0.04% 91 4771 0.04% 92 5290 0.05% 93 5828 0.05% 94 6247 0.06% 95 6806 0.06% 96 7161 0.07% 97 7393 0.07% 98 7772 0.07% 99 8382 0.08% 100 8940 0.08% 101 9827 0.09% 102 10597 0.10% 103 11459 0.11% 104 12135 0.11% 105 12599 0.12% 106 13438 0.13% 107 13794 0.13% 108 14418 0.14% 109 14983 0.14% 110 15653 0.15% 111 16356 0.15% 112 17124 0.16% 113 18078 0.17% 114 19013 0.18% 115 20375 0.19% 116 20994 0.20% 117 21888 0.21% 118 22203 0.21% 119 22968 0.22% 120 23400 0.22% 121 24673 0.23% 122 25692 0.24% 123 27005 0.25% 124 28587 0.27% 125 29507 0.28% 126 30929 0.29% 127 32138 0.30% 128 33414 0.32% 129 34900 0.33% 130 36634 0.35% 131 38335 0.36% 132 40677 0.38% 133 43753 0.41% 134 45979 0.43% 135 48756 0.46% 136 51914 0.49% 137 56657 0.53% 138 60085 0.57% 139 65323 0.62% 140 71669 0.68% 141 80015 0.75% 142 91058 0.86% 143 106049 1.00% 144 127854 1.21% 145 158603 1.50% 146 207238 1.95% 147 294591 2.78% 148 462083 4.36% 149 853085 8.04% 150 2619114 24.69% 151 4339437 40.91% 10606229 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=28 prefix-density=0.52 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=18.29 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.3 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=12 prefix-density=0.93 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=132.05 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=17.4 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172143 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:59:07 Started mapping on | Apr 10 15:59:07 Finished on | Apr 10 16:00:14 Mapping speed, Million of reads per hour | 569.89 Number of input reads | 10606229 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 9949704 Uniquely mapped reads % | 93.81% Average mapped length | 292.46 Number of splices: Total | 9813571 Number of splices: Annotated (sjdb) | 9637869 Number of splices: GT/AG | 9659664 Number of splices: GC/AG | 121718 Number of splices: AT/AC | 7212 Number of splices: Non-canonical | 24977 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283333 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 25475 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378603 378603 378603 N_multimapping 283333 283333 283333 N_noFeature 282738 9832717 349945 N_ambiguous 100056 560 49903 UnstrandedReadsAssigned:9566910 PositiveStrandReadsAssigned:116427 NegativeStrandReadsAssigned:9549856 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172143-trimmed-pair1.fastq SRR7172143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,606,229 reads, 9,445,713 reads pseudoaligned [quant] estimated average fragment length: 240.235 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7172143.ke.tsv 34699 SRR7172143.se.tsv 87100 total ==> SRR7172143.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.76 705 40.5429 Potri.005G024800.1.v4.1 1035 795.765 248 31.8794 Potri.004G059700.1.v4.1 961 721.779 15 2.12584 Potri.007G009000.2.v4.1 1416 1176.76 0 0 Potri.003G141000.2.v4.1 2943 2703.76 417 15.7765 Potri.016G087400.1.v4.1 270 83.1974 564 693.447 Potri.015G069301.1.v4.1 564 329.28 0 0 Potri.010G195200.1.v4.1 1773 1533.76 308 20.5417 Potri.012G127500.1.v4.1 977 737.77 3061 424.411 ==> SRR7172143.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 139 SRR7172143 completed mapping pipeline successfully