Starting /dee2/code/volunteer_pipeline.sh SRR7172144 current disk space = 3116909928448 free memory = 1582220840 SRR7172144 SRAfilesize 5171edb1b2b4b59efd3f67a1fbebf521 SRR7172144.sra SRR7172144.sra file validated SRR7172144 is paired end SRR7172144 is conventional basespace SRR7172144 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.688 33.0 33.0 34.0 32.0 34.0 2 32.82725 33.0 33.0 34.0 31.0 34.0 3 32.91475 33.0 33.0 34.0 31.0 34.0 4 32.009 33.0 32.0 33.0 31.0 34.0 5 32.28375 33.0 32.0 33.0 31.0 34.0 6 36.7335 38.0 37.0 38.0 34.0 38.0 7 37.19175 38.0 38.0 38.0 36.0 38.0 8 37.30975 38.0 38.0 38.0 37.0 38.0 9 37.494 38.0 38.0 38.0 37.0 38.0 10-14 37.4953 38.0 38.0 38.0 37.6 38.0 15-19 37.4989 38.0 38.0 38.0 38.0 38.0 20-24 37.406549999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.31255 38.0 38.0 38.0 37.0 38.0 30-34 37.03195 38.0 38.0 38.0 36.2 38.0 35-39 36.781349999999996 38.0 38.0 38.0 34.8 38.0 40-44 37.05205 38.0 38.0 38.0 36.2 38.0 45-49 37.13845 38.0 38.0 38.0 36.2 38.0 50-54 37.2267 38.0 38.0 38.0 36.6 38.0 55-59 37.2509 38.0 38.0 38.0 36.8 38.0 60-64 37.2909 38.0 38.0 38.0 37.0 38.0 65-69 37.212450000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.1733 38.0 38.0 38.0 36.4 38.0 75-79 37.06765 38.0 38.0 38.0 36.0 38.0 80-84 36.80625 38.0 38.0 38.0 35.4 38.0 85-89 36.75234999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.60735 38.0 38.0 38.0 34.4 38.0 95-99 36.57445 38.0 38.0 38.0 34.0 38.0 100-104 36.587650000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.51735 38.0 38.0 38.0 34.0 38.0 110-114 36.322050000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.1314 38.0 37.4 38.0 33.6 38.0 120-124 36.06845 38.0 37.0 38.0 33.0 38.0 125-129 35.55305 38.0 36.8 38.0 31.0 38.0 130-134 35.24135 38.0 36.0 38.0 30.6 38.0 135-139 34.9462 38.0 35.8 38.0 29.8 38.0 140-144 34.245850000000004 38.0 35.0 38.0 25.2 38.0 145-149 33.56985 38.0 33.6 38.0 20.6 38.0 150-151 28.584375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 2.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 4.0 21 2.0 22 7.0 23 5.0 24 9.0 25 15.0 26 24.0 27 17.0 28 33.0 29 28.0 30 42.0 31 67.0 32 68.0 33 109.0 34 145.0 35 288.0 36 621.0 37 2504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.85 16.475 16.25 35.425000000000004 2 19.15 24.675 38.525 17.65 3 18.224999999999998 29.599999999999998 27.200000000000003 24.975 4 19.925 38.074999999999996 22.8 19.2 5 20.424999999999997 35.375 25.05 19.15 6 15.825 37.175000000000004 25.825 21.175 7 12.5 20.65 46.050000000000004 20.8 8 19.025 22.05 28.275 30.65 9 17.025000000000002 23.35 32.05 27.575 10-14 18.856599809933478 30.60571199919972 26.634322012704448 23.903366178162358 15-19 18.985949297464874 30.191509575478776 27.38136906845342 23.44117205860293 20-24 19.035 29.675 27.85 23.44 25-29 18.91 29.904999999999998 27.700000000000003 23.485 30-34 19.415 29.439999999999998 27.54 23.605 35-39 19.53 30.305 27.24 22.925 40-44 19.994999999999997 29.325000000000003 28.1 22.58 45-49 18.955 29.395 27.560000000000002 24.09 50-54 18.935 30.0 27.67 23.395 55-59 19.255 29.425 28.04 23.28 60-64 19.1 28.51 28.355000000000004 24.035 65-69 19.625 28.58 27.855 23.94 70-74 19.31 29.49 28.084999999999997 23.115 75-79 20.064999999999998 29.615000000000002 27.084999999999997 23.235 80-84 19.78 29.095 28.134999999999998 22.99 85-89 19.725 29.14 27.685 23.45 90-94 19.580000000000002 29.125 27.93 23.365 95-99 20.105 29.020000000000003 27.785 23.09 100-104 20.3 28.535 27.305 23.86 105-109 19.875 28.785 27.925 23.415 110-114 19.805990299514974 28.47642382119106 27.86639331966598 23.851192559627982 115-119 20.10902180436087 28.460692138427685 27.675535107021403 23.754750950190036 120-124 20.033004950742612 28.779316897534628 27.97919687953193 23.208481272190827 125-129 20.160320641282564 28.276553106212425 27.359719438877754 24.203406813627254 130-134 19.939999999999998 28.825 27.389999999999997 23.845 135-139 20.05 28.93 26.974999999999998 24.044999999999998 140-144 20.68 28.499999999999996 27.24 23.580000000000002 145-149 20.785 28.475 27.325 23.415 150-151 20.549999999999997 28.549999999999997 26.775 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.5 24 3.5 25 5.5 26 8.0 27 11.5 28 15.5 29 21.0 30 25.5 31 34.0 32 47.0 33 61.0 34 75.0 35 95.5 36 127.5 37 149.5 38 182.5 39 207.0 40 196.5 41 209.0 42 248.5 43 259.0 44 267.5 45 275.5 46 248.5 47 228.5 48 196.0 49 160.5 50 140.5 51 120.5 52 95.0 53 66.5 54 52.0 55 42.5 56 31.5 57 16.0 58 12.0 59 13.5 60 9.0 61 5.5 62 5.5 63 5.0 64 4.0 65 3.0 66 2.5 67 3.0 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.02 120-124 0.015 125-129 0.2 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 6.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGTGA 20 0.0059777987 28.9575 20-24 >>END_MODULE SRR7172144 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172144_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7965 33.0 33.0 34.0 32.0 34.0 2 32.933 34.0 33.0 34.0 32.0 34.0 3 32.9525 34.0 33.0 34.0 32.0 34.0 4 32.91525 34.0 33.0 34.0 32.0 34.0 5 32.99875 34.0 33.0 34.0 32.0 34.0 6 37.003 38.0 38.0 38.0 36.0 38.0 7 37.192 38.0 38.0 38.0 37.0 38.0 8 37.16775 38.0 38.0 38.0 37.0 38.0 9 37.179 38.0 38.0 38.0 37.0 38.0 10-14 37.1617 38.0 38.0 38.0 37.0 38.0 15-19 37.066449999999996 38.0 38.0 38.0 36.8 38.0 20-24 36.9337 38.0 38.0 38.0 36.6 38.0 25-29 36.908100000000005 38.0 38.0 38.0 36.6 38.0 30-34 37.00609999999999 38.0 38.0 38.0 36.8 38.0 35-39 36.89755 38.0 38.0 38.0 36.0 38.0 40-44 36.8201 38.0 38.0 38.0 36.2 38.0 45-49 36.90775 38.0 38.0 38.0 36.2 38.0 50-54 36.90965 38.0 38.0 38.0 36.2 38.0 55-59 36.9218 38.0 38.0 38.0 36.0 38.0 60-64 36.88965 38.0 38.0 38.0 36.0 38.0 65-69 36.83515 38.0 38.0 38.0 36.0 38.0 70-74 36.710750000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.7111 38.0 38.0 38.0 35.4 38.0 80-84 36.573299999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.398199999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.26795 38.0 38.0 38.0 34.0 38.0 95-99 36.08345 38.0 38.0 38.0 33.6 38.0 100-104 35.98165 38.0 37.6 38.0 33.0 38.0 105-109 36.08755 38.0 37.8 38.0 33.6 38.0 110-114 35.99805 38.0 38.0 38.0 33.4 38.0 115-119 35.86514999999999 38.0 37.4 38.0 32.8 38.0 120-124 35.4824 38.0 37.0 38.0 31.0 38.0 125-129 35.29845 38.0 36.6 38.0 31.0 38.0 130-134 34.90305 38.0 36.0 38.0 29.0 38.0 135-139 34.392900000000004 38.0 35.6 38.0 25.8 38.0 140-144 33.8002 38.0 33.6 38.0 22.4 38.0 145-149 33.016749999999995 38.0 33.0 38.0 16.6 38.0 150-151 27.618875000000003 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 3.0 5 2.0 6 0.0 7 2.0 8 1.0 9 2.0 10 0.0 11 3.0 12 2.0 13 2.0 14 4.0 15 0.0 16 3.0 17 1.0 18 4.0 19 3.0 20 6.0 21 6.0 22 6.0 23 12.0 24 17.0 25 10.0 26 18.0 27 21.0 28 35.0 29 42.0 30 45.0 31 46.0 32 70.0 33 110.0 34 167.0 35 262.0 36 602.0 37 2474.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.39299123904881 14.367959949937422 19.799749687108886 31.439299123904878 2 23.23080770192548 21.43035758939735 37.43435858964741 17.90447611902976 3 20.80520130032508 24.781195298824706 32.433108277069266 21.980495123780948 4 25.1 33.925 21.224999999999998 19.75 5 25.1 36.5 21.725 16.675 6 17.675 36.925000000000004 24.7 20.7 7 16.75 16.025 44.5 22.725 8 21.625 22.1 27.025 29.25 9 22.575 23.599999999999998 27.6 26.224999999999998 10-14 23.43351502725409 28.16922538380757 26.563984597689654 21.83327499124869 15-19 23.549709941988397 27.965593118623726 27.81056211242248 20.674134826965393 20-24 23.78618930946547 28.906445322266112 27.076353817690883 20.23101155057753 25-29 23.974999999999998 28.08 27.305 20.64 30-34 22.98 29.080000000000002 27.305 20.635 35-39 23.35 28.199999999999996 28.03 20.419999999999998 40-44 23.169999999999998 28.285 28.139999999999997 20.405 45-49 23.064999999999998 28.189999999999998 28.294999999999998 20.45 50-54 23.39 27.525 28.46 20.625 55-59 23.875 27.900000000000002 27.589999999999996 20.635 60-64 23.494999999999997 28.175 28.244999999999997 20.085 65-69 23.515 27.92 28.525 20.04 70-74 23.380000000000003 27.665 28.475 20.48 75-79 23.735 28.060000000000002 28.535 19.67 80-84 23.405 27.82 28.305000000000003 20.47 85-89 23.195 28.84 28.310000000000002 19.655 90-94 24.01 27.66 28.15 20.18 95-99 23.990000000000002 28.005000000000003 28.24 19.765 100-104 23.72 28.144999999999996 28.025 20.11 105-109 23.95 27.905 28.175 19.97 110-114 23.66 28.34 28.349999999999998 19.650000000000002 115-119 23.815 28.335 28.33 19.52 120-124 24.104999999999997 28.16 28.525 19.21 125-129 24.11 28.255000000000003 28.07 19.564999999999998 130-134 23.995 28.000000000000004 28.34 19.665 135-139 24.709999999999997 27.439999999999998 28.915000000000003 18.935 140-144 25.575 27.905 27.3 19.220000000000002 145-149 24.13 27.965 28.12 19.785 150-151 24.8625 27.150000000000002 28.8875 19.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 1.0 24 0.0 25 1.0 26 3.0 27 2.5 28 3.0 29 9.0 30 15.0 31 19.5 32 28.0 33 38.0 34 45.0 35 66.0 36 87.5 37 112.0 38 139.5 39 170.0 40 205.5 41 237.0 42 251.5 43 258.0 44 274.5 45 292.5 46 289.0 47 258.0 48 229.0 49 203.0 50 171.0 51 138.0 52 110.5 53 82.0 54 63.0 55 47.5 56 34.0 57 29.0 58 21.0 59 15.5 60 12.0 61 5.0 62 4.0 63 5.0 64 5.5 65 5.0 66 2.0 67 2.5 68 2.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.02 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26730672056594 98.225 2 0.6063668519454269 1.2 3 0.0 0.0 4 0.07579585649317837 0.3 5 0.025265285497726126 0.125 6 0.025265285497726126 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9749999999999999 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.725 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.3125 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809064 spots for SRR7172144.sra Written 809064 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra Read 809049 spots for SRR7172144.sra Written 809049 spots for SRR7172144.sra SRR ids: ['SRR7172144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4gfpfcqj SRR7172144.sra spots: 16180995 blocks: [[1, 809049], [809050, 1618098], [1618099, 2427147], [2427148, 3236196], [3236197, 4045245], [4045246, 4854294], [4854295, 5663343], [5663344, 6472392], [6472393, 7281441], [7281442, 8090490], [8090491, 8899539], [8899540, 9708588], [9708589, 10517637], [10517638, 11326686], [11326687, 12135735], [12135736, 12944784], [12944785, 13753833], [13753834, 14562882], [14562883, 15371931], [15371932, 16180995]] SRR7172144 file size 5461507 SRR7172144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172144 SRR7172144_1.fastq SRR7172144_2.fastq Input file: SRR7172144_1.fastq Paired file: SRR7172144_2.fastq trimmed: SRR7172144-trimmed-pair1.fastq, SRR7172144-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:19:14 2025 >> started Fri Feb 14 09:19:31 2025 >> done (17.003s) 16180995 read pairs processed; of these: 18785 ( 0.12%) short read pairs filtered out after trimming by size control 18284 ( 0.11%) empty read pairs filtered out after trimming by size control 16143926 (99.77%) read pairs available; of these: 9336851 (57.84%) trimmed read pairs available after processing 6807075 (42.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 7 0.00% 23 10 0.00% 24 9 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 9 0.00% 29 7 0.00% 30 8 0.00% 31 5 0.00% 32 5 0.00% 33 9 0.00% 34 9 0.00% 35 13 0.00% 36 12 0.00% 37 10 0.00% 38 10 0.00% 39 10 0.00% 40 9 0.00% 41 11 0.00% 42 16 0.00% 43 13 0.00% 44 15 0.00% 45 18 0.00% 46 22 0.00% 47 20 0.00% 48 25 0.00% 49 36 0.00% 50 25 0.00% 51 30 0.00% 52 46 0.00% 53 42 0.00% 54 47 0.00% 55 56 0.00% 56 83 0.00% 57 423 0.00% 58 231 0.00% 59 227 0.00% 60 228 0.00% 61 121 0.00% 62 176 0.00% 63 199 0.00% 64 191 0.00% 65 208 0.00% 66 245 0.00% 67 305 0.00% 68 387 0.00% 69 368 0.00% 70 431 0.00% 71 494 0.00% 72 531 0.00% 73 661 0.00% 74 694 0.00% 75 794 0.00% 76 966 0.01% 77 1398 0.01% 78 1853 0.01% 79 1560 0.01% 80 1756 0.01% 81 1924 0.01% 82 2140 0.01% 83 2822 0.02% 84 5017 0.03% 85 5615 0.03% 86 5689 0.04% 87 5615 0.03% 88 5710 0.04% 89 5753 0.04% 90 6143 0.04% 91 6411 0.04% 92 7059 0.04% 93 7389 0.05% 94 8086 0.05% 95 8490 0.05% 96 9565 0.06% 97 10446 0.06% 98 10710 0.07% 99 11654 0.07% 100 11859 0.07% 101 13218 0.08% 102 13567 0.08% 103 14742 0.09% 104 15510 0.10% 105 16482 0.10% 106 17564 0.11% 107 18638 0.12% 108 19556 0.12% 109 20428 0.13% 110 21534 0.13% 111 22434 0.14% 112 24025 0.15% 113 25600 0.16% 114 26373 0.16% 115 27837 0.17% 116 29516 0.18% 117 30790 0.19% 118 32334 0.20% 119 33779 0.21% 120 34671 0.21% 121 37020 0.23% 122 38643 0.24% 123 41061 0.25% 124 43162 0.27% 125 45188 0.28% 126 47611 0.29% 127 49756 0.31% 128 51731 0.32% 129 54371 0.34% 130 56946 0.35% 131 58660 0.36% 132 61979 0.38% 133 65168 0.40% 134 69210 0.43% 135 73114 0.45% 136 78606 0.49% 137 83366 0.52% 138 90066 0.56% 139 97149 0.60% 140 106992 0.66% 141 117123 0.73% 142 132220 0.82% 143 148057 0.92% 144 173961 1.08% 145 210166 1.30% 146 263569 1.63% 147 351074 2.17% 148 526865 3.26% 149 1020951 6.32% 150 4531239 28.07% 151 6807075 42.16% 16143926 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=24 prefix-density=0.77 prefix-fanout=2.7 sequence=CCACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=151.32 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=18.5 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAAGAAGCACCATTATACA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=4.73 fanout-score-rank=12 prefix-density=0.74 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=22.22 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=1.5 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACTTTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7172144 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:20:44 Started mapping on | Feb 14 09:20:44 Finished on | Feb 14 09:23:57 Mapping speed, Million of reads per hour | 301.13 Number of input reads | 16143926 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14606117 Uniquely mapped reads % | 90.47% Average mapped length | 293.14 Number of splices: Total | 13803521 Number of splices: Annotated (sjdb) | 13511317 Number of splices: GT/AG | 13565191 Number of splices: GC/AG | 179421 Number of splices: AT/AC | 12245 Number of splices: Non-canonical | 46664 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.30 Insertion rate per base | 0.03% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392966 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 53546 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.64% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1163996 1163996 1163996 N_multimapping 392966 392966 392966 N_noFeature 396183 14453684 449791 N_ambiguous 171393 650 72495 UnstrandedReadsAssigned:14038541 PositiveStrandReadsAssigned:151783 NegativeStrandReadsAssigned:14083831 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172144 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172144-trimmed-pair1.fastq SRR7172144-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,143,926 reads, 13,904,187 reads pseudoaligned [quant] estimated average fragment length: 234.115 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7172144.ke.tsv 34699 SRR7172144.se.tsv 87100 total ==> SRR7172144.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.88 997 32.9581 Potri.005G024800.1.v4.1 1035 801.885 232 17.0708 Potri.004G059700.1.v4.1 961 727.894 64 5.18786 Potri.007G009000.2.v4.1 1416 1182.88 0 0 Potri.003G141000.2.v4.1 2943 2709.88 480 10.4512 Potri.016G087400.1.v4.1 270 80.3177 1145.31 841.375 Potri.015G069301.1.v4.1 564 333.345 0 0 Potri.010G195200.1.v4.1 1773 1539.88 474 18.1621 Potri.012G127500.1.v4.1 977 743.889 18094 1435.17 ==> SRR7172144.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 790 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1022 SRR7172144 completed mapping pipeline successfully