Starting /dee2/code/volunteer_pipeline.sh SRR7172145 current disk space = 3119299735552 free memory = 1014800940 SRR7172145 SRAfilesize 4125bf5985acb5275061b797c15c794d SRR7172145.sra SRR7172145.sra file validated SRR7172145 is paired end SRR7172145 is conventional basespace SRR7172145 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172145_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.481 27.0 18.0 33.0 18.0 33.0 2 25.70825 27.0 18.0 31.0 18.0 33.0 3 29.8955 31.0 29.0 33.0 27.0 33.0 4 29.125 31.0 29.0 33.0 25.0 33.0 5 31.698 33.0 32.0 33.0 30.0 33.0 6 36.7665 38.0 37.0 38.0 35.0 38.0 7 37.4235 38.0 38.0 38.0 37.0 38.0 8 37.55125 38.0 38.0 38.0 37.0 38.0 9 37.56375 38.0 38.0 38.0 38.0 38.0 10-14 37.4842 38.0 38.0 38.0 37.8 38.0 15-19 37.55309999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.5318 38.0 38.0 38.0 37.8 38.0 25-29 37.39730000000001 38.0 38.0 38.0 37.2 38.0 30-34 37.47395 38.0 38.0 38.0 37.6 38.0 35-39 37.367000000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.2043 38.0 38.0 38.0 36.8 38.0 45-49 37.3236 38.0 38.0 38.0 37.0 38.0 50-54 37.35039999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.373450000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.35145 38.0 38.0 38.0 37.0 38.0 65-69 37.30415000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.21130000000001 38.0 38.0 38.0 36.4 38.0 75-79 37.14335 38.0 38.0 38.0 36.0 38.0 80-84 37.0589 38.0 38.0 38.0 36.0 38.0 85-89 36.9562 38.0 38.0 38.0 36.0 38.0 90-94 36.8421 38.0 38.0 38.0 35.2 38.0 95-99 36.819300000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.60925000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.69539999999999 38.0 38.0 38.0 34.6 38.0 110-114 36.24975 38.0 38.0 38.0 34.0 38.0 115-119 35.8196 38.0 37.0 38.0 31.2 38.0 120-124 36.26379999999999 38.0 37.6 38.0 33.8 38.0 125-129 35.885799999999996 38.0 36.8 38.0 32.6 38.0 130-134 35.7101 38.0 36.4 38.0 31.6 38.0 135-139 35.574299999999994 38.0 36.0 38.0 31.0 38.0 140-144 35.1046 38.0 36.0 38.0 30.0 38.0 145-149 34.598549999999996 38.0 35.6 38.0 29.2 38.0 150-151 30.277749999999997 35.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 3.0 22 2.0 23 3.0 24 3.0 25 9.0 26 10.0 27 18.0 28 20.0 29 24.0 30 33.0 31 53.0 32 74.0 33 93.0 34 172.0 35 279.0 36 744.0 37 2447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.025 16.125 13.600000000000001 32.25 2 21.224999999999998 23.625 37.0 18.15 3 18.5 29.875 27.900000000000002 23.724999999999998 4 22.0 34.75 24.025 19.225 5 19.725 38.025 24.3 17.95 6 16.475 36.05 25.575 21.9 7 12.1 20.8 46.575 20.525 8 17.575 21.4 30.349999999999998 30.675 9 17.424999999999997 22.2 30.825000000000003 29.549999999999997 10-14 19.194550190342614 29.232618713684634 26.843317972350228 24.72951312362252 15-19 19.105 29.270000000000003 27.675 23.95 20-24 19.825 28.99 27.800000000000004 23.385 25-29 19.500975048752437 29.186459322966147 28.016400820041003 23.296164808240412 30-34 19.46597329866493 29.181459072953647 27.83639181959098 23.51617580879044 35-39 19.96799519927989 29.12936940541081 27.169075361304195 23.733560034005098 40-44 20.04900980196039 29.035807161432288 27.680536107221442 23.234646929385878 45-49 19.54 28.945 28.000000000000004 23.515 50-54 19.869999999999997 28.82 28.110000000000003 23.200000000000003 55-59 20.125 28.34 28.285 23.25 60-64 19.33 28.694999999999997 28.244999999999997 23.73 65-69 19.6 28.715000000000003 28.315 23.369999999999997 70-74 20.69 28.675 27.77 22.865 75-79 19.725 28.560000000000002 28.79 22.925 80-84 19.586958695869587 28.782878287828783 27.547754775477546 24.082408240824083 85-89 20.11606383510931 28.945920256140877 27.835309420181098 23.102706488568714 90-94 20.220055013753438 28.902225556389098 27.826956739184794 23.05076269067267 95-99 20.0 28.725 28.215 23.06 100-104 20.213085234093636 28.716486594637857 27.78611444577831 23.284313725490197 105-109 20.006000300015 28.351417570878546 28.0114005700285 23.631181559077955 110-114 20.12185910670225 28.69228057807543 27.609648018530642 23.576212296691676 115-119 20.449302978638052 28.016247116638247 28.46254136997292 23.071908534750776 120-124 20.51230738443066 29.02241344806884 27.68661196718031 22.778667200320193 125-129 20.317906032191747 28.511257082685653 27.804242089956375 23.366594795166222 130-134 20.71 28.895 27.46 22.935 135-139 20.97 28.384999999999998 27.589999999999996 23.055 140-144 20.58220377131996 29.025158805581952 26.894413044565596 23.498224378532488 145-149 20.344240968678072 28.8752126488542 27.534273991794254 23.24627239067347 150-151 20.3 29.2 26.974999999999998 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 3.0 21 2.0 22 1.5 23 1.0 24 1.5 25 4.0 26 6.0 27 8.0 28 12.5 29 19.5 30 25.0 31 25.0 32 34.5 33 49.0 34 63.0 35 88.5 36 115.0 37 136.0 38 152.5 39 176.0 40 214.0 41 248.5 42 265.5 43 282.0 44 278.5 45 252.5 46 230.0 47 224.0 48 225.0 49 193.0 50 143.5 51 110.0 52 87.5 53 75.5 54 63.5 55 42.5 56 30.5 57 25.5 58 20.0 59 16.0 60 11.5 61 6.5 62 5.5 63 4.5 64 4.0 65 3.5 66 3.5 67 2.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.18 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.015 40-44 0.02 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.055 90-94 0.025 95-99 0.0 100-104 0.04 105-109 0.005 110-114 0.705 115-119 0.29 120-124 0.06 125-129 0.28500000000000003 130-134 0.0 135-139 0.0 140-144 0.034999999999999996 145-149 0.06999999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.9750000000000001 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.725 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAATC 10 0.006606125 146.6076 7 GTAATCT 10 0.006606125 146.6076 8 >>END_MODULE SRR7172145 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172145_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01875 33.0 33.0 34.0 32.0 34.0 2 33.0755 34.0 33.0 34.0 33.0 34.0 3 33.0955 34.0 33.0 34.0 33.0 34.0 4 33.03175 34.0 33.0 34.0 33.0 34.0 5 32.948 34.0 33.0 34.0 32.0 34.0 6 37.022 38.0 38.0 38.0 37.0 38.0 7 37.094 38.0 38.0 38.0 37.0 38.0 8 37.0515 38.0 38.0 38.0 37.0 38.0 9 36.98675 38.0 38.0 38.0 37.0 38.0 10-14 37.146950000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.0778 38.0 38.0 38.0 37.0 38.0 20-24 37.0276 38.0 38.0 38.0 37.0 38.0 25-29 37.06365 38.0 38.0 38.0 37.0 38.0 30-34 37.07695 38.0 38.0 38.0 37.0 38.0 35-39 37.082499999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.9385 38.0 38.0 38.0 36.6 38.0 45-49 36.935449999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.99005 38.0 38.0 38.0 36.4 38.0 55-59 36.9594 38.0 38.0 38.0 36.4 38.0 60-64 36.948699999999995 38.0 38.0 38.0 36.2 38.0 65-69 36.87480000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.8684 38.0 38.0 38.0 36.0 38.0 75-79 36.78515 38.0 38.0 38.0 36.0 38.0 80-84 36.693599999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.5352 38.0 38.0 38.0 35.0 38.0 90-94 36.298 38.0 38.0 38.0 34.0 38.0 95-99 36.304700000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.23595 38.0 38.0 38.0 34.0 38.0 105-109 36.20335 38.0 38.0 38.0 34.0 38.0 110-114 35.9802 38.0 38.0 38.0 33.4 38.0 115-119 35.895300000000006 38.0 37.6 38.0 32.8 38.0 120-124 35.65435 38.0 37.4 38.0 31.6 38.0 125-129 35.315549999999995 38.0 37.0 38.0 31.0 38.0 130-134 34.87525000000001 38.0 36.0 38.0 28.8 38.0 135-139 34.47915 38.0 36.0 38.0 26.4 38.0 140-144 33.998450000000005 38.0 35.2 38.0 24.2 38.0 145-149 32.99665 38.0 33.0 38.0 16.2 38.0 150-151 27.643875 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 3.0 5 1.0 6 3.0 7 0.0 8 2.0 9 1.0 10 0.0 11 2.0 12 3.0 13 1.0 14 3.0 15 1.0 16 4.0 17 4.0 18 2.0 19 12.0 20 6.0 21 7.0 22 14.0 23 6.0 24 6.0 25 14.0 26 14.0 27 25.0 28 32.0 29 39.0 30 44.0 31 44.0 32 59.0 33 108.0 34 137.0 35 240.0 36 553.0 37 2595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0 16.05 17.275 29.675 2 24.956239059764943 22.305576394098527 34.858714678669664 17.879469867466867 3 19.679919979995 26.756689172293076 32.40810202550637 21.155288822205552 4 23.092319239429575 34.65098824118088 22.91718789091819 19.339504628471353 5 22.814926120711245 38.367142499373905 21.136989732031054 17.680941647883795 6 18.156705173279757 38.849824208940234 23.907584128578605 19.085886489201407 7 18.10865191146881 16.473843058350102 44.668008048289735 20.74949698189135 8 20.080321285140563 23.167670682730922 28.062248995983936 28.68975903614458 9 21.616871704745165 24.50414260607582 28.998242530755714 24.8807431584233 10-14 22.582263242375603 28.601524879614765 26.725521669341894 22.090690208667738 15-19 22.898579816329605 27.791438751442765 28.45385657650424 20.85612485572339 20-24 22.476190476190478 27.774436090225564 28.340852130325818 21.408521303258148 25-29 22.631789536861056 27.618285485645693 28.738621586475944 21.011303391017304 30-34 22.5 29.080000000000002 28.285 20.135 35-39 22.939999999999998 27.88 28.335 20.845 40-44 22.81 28.294999999999998 28.82 20.075000000000003 45-49 22.946884065219567 28.203461038311495 28.16845053516055 20.681204361308392 50-54 23.05 28.525 28.194999999999997 20.23 55-59 23.14 27.52 28.555000000000003 20.785 60-64 22.99 28.744999999999997 27.765 20.5 65-69 23.305 28.57 28.349999999999998 19.775000000000002 70-74 23.45 28.199999999999996 28.244999999999997 20.105 75-79 22.84 28.155 28.76 20.244999999999997 80-84 22.46 27.975 28.865000000000002 20.7 85-89 23.02 28.199999999999996 28.43 20.349999999999998 90-94 23.285 28.435 28.48 19.8 95-99 23.185 28.32 28.325 20.169999999999998 100-104 23.494999999999997 27.99 28.17 20.345 105-109 23.445 27.634999999999998 28.849999999999998 20.07 110-114 22.759999999999998 28.08 28.895 20.265 115-119 23.294999999999998 28.410000000000004 27.865000000000002 20.43 120-124 23.23 28.08 27.935 20.755000000000003 125-129 22.770000000000003 28.185 28.799999999999997 20.244999999999997 130-134 24.060000000000002 27.36 28.610000000000003 19.97 135-139 24.605 27.744999999999997 28.175 19.475 140-144 24.42 28.34 27.295 19.945 145-149 24.12 27.505000000000003 28.32 20.055 150-151 24.5625 26.825 28.449999999999996 20.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 1.5 23 1.5 24 1.5 25 4.5 26 6.0 27 6.5 28 9.5 29 11.5 30 13.5 31 22.5 32 35.0 33 46.0 34 55.5 35 73.0 36 93.0 37 107.0 38 135.0 39 179.0 40 208.0 41 246.0 42 280.0 43 285.5 44 306.0 45 298.5 46 260.5 47 237.0 48 214.0 49 186.5 50 154.5 51 128.0 52 101.5 53 72.0 54 51.5 55 44.5 56 35.0 57 20.5 58 15.0 59 12.0 60 8.5 61 8.5 62 7.5 63 3.0 64 3.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.075 5 0.17500000000000002 6 0.44999999999999996 7 0.6 8 0.4 9 0.42500000000000004 10-14 0.32 15-19 0.365 20-24 0.25 25-29 0.03 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.725 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952179 spots for SRR7172145.sra Written 952179 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra Read 952160 spots for SRR7172145.sra Written 952160 spots for SRR7172145.sra SRR ids: ['SRR7172145.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9grbrygv SRR7172145.sra spots: 19043219 blocks: [[1, 952160], [952161, 1904320], [1904321, 2856480], [2856481, 3808640], [3808641, 4760800], [4760801, 5712960], [5712961, 6665120], [6665121, 7617280], [7617281, 8569440], [8569441, 9521600], [9521601, 10473760], [10473761, 11425920], [11425921, 12378080], [12378081, 13330240], [13330241, 14282400], [14282401, 15234560], [15234561, 16186720], [16186721, 17138880], [17138881, 18091040], [18091041, 19043219]] SRR7172145 file size 6431421 SRR7172145 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172145 SRR7172145_1.fastq SRR7172145_2.fastq Input file: SRR7172145_1.fastq Paired file: SRR7172145_2.fastq trimmed: SRR7172145-trimmed-pair1.fastq, SRR7172145-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:37:24 2025 >> started Fri Feb 14 07:37:51 2025 >> done (27.356s) 19043219 read pairs processed; of these: 21025 ( 0.11%) short read pairs filtered out after trimming by size control 14746 ( 0.08%) empty read pairs filtered out after trimming by size control 19007448 (99.81%) read pairs available; of these: 9940816 (52.30%) trimmed read pairs available after processing 9066632 (47.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 8 0.00% 21 16 0.00% 22 10 0.00% 23 8 0.00% 24 9 0.00% 25 9 0.00% 26 13 0.00% 27 7 0.00% 28 10 0.00% 29 9 0.00% 30 11 0.00% 31 8 0.00% 32 7 0.00% 33 3 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 3 0.00% 38 13 0.00% 39 10 0.00% 40 12 0.00% 41 16 0.00% 42 17 0.00% 43 7 0.00% 44 10 0.00% 45 17 0.00% 46 19 0.00% 47 20 0.00% 48 15 0.00% 49 16 0.00% 50 22 0.00% 51 34 0.00% 52 24 0.00% 53 34 0.00% 54 34 0.00% 55 49 0.00% 56 40 0.00% 57 51 0.00% 58 71 0.00% 59 69 0.00% 60 79 0.00% 61 107 0.00% 62 107 0.00% 63 116 0.00% 64 125 0.00% 65 150 0.00% 66 161 0.00% 67 167 0.00% 68 190 0.00% 69 183 0.00% 70 244 0.00% 71 295 0.00% 72 324 0.00% 73 396 0.00% 74 445 0.00% 75 491 0.00% 76 548 0.00% 77 634 0.00% 78 676 0.00% 79 849 0.00% 80 1035 0.01% 81 1079 0.01% 82 1327 0.01% 83 1585 0.01% 84 3004 0.02% 85 3839 0.02% 86 4073 0.02% 87 4329 0.02% 88 4488 0.02% 89 4532 0.02% 90 4686 0.02% 91 5070 0.03% 92 5030 0.03% 93 5428 0.03% 94 5645 0.03% 95 6260 0.03% 96 6506 0.03% 97 7007 0.04% 98 7521 0.04% 99 7853 0.04% 100 8777 0.05% 101 9477 0.05% 102 10216 0.05% 103 11047 0.06% 104 11653 0.06% 105 12529 0.07% 106 13367 0.07% 107 13871 0.07% 108 14859 0.08% 109 15151 0.08% 110 16011 0.08% 111 17070 0.09% 112 18005 0.09% 113 19275 0.10% 114 20351 0.11% 115 21741 0.11% 116 22862 0.12% 117 24042 0.13% 118 25329 0.13% 119 26550 0.14% 120 27446 0.14% 121 28924 0.15% 122 31104 0.16% 123 32348 0.17% 124 33948 0.18% 125 36214 0.19% 126 38412 0.20% 127 40196 0.21% 128 42502 0.22% 129 44978 0.24% 130 48031 0.25% 131 51204 0.27% 132 55020 0.29% 133 59232 0.31% 134 63924 0.34% 135 69376 0.36% 136 78205 0.41% 137 80528 0.42% 138 86351 0.45% 139 94785 0.50% 140 102069 0.54% 141 111292 0.59% 142 124332 0.65% 143 141939 0.75% 144 166167 0.87% 145 197170 1.04% 146 249527 1.31% 147 343104 1.81% 148 529278 2.78% 149 1058759 5.57% 150 5444935 28.65% 151 9066632 47.70% 19007448 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=31 prefix-density=0.33 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=75.83 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=17.4 sequence=TTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTTG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=2.1 sequence=TTTCTCAGAGAACACCACAACTGAGACAATCAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=97.31 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=20.0 sequence=TGATGAGGATGA SRR7172145 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:38:44 Started mapping on | Feb 14 07:38:44 Finished on | Feb 14 07:42:09 Mapping speed, Million of reads per hour | 333.79 Number of input reads | 19007448 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17243038 Uniquely mapped reads % | 90.72% Average mapped length | 295.31 Number of splices: Total | 16585768 Number of splices: Annotated (sjdb) | 16231425 Number of splices: GT/AG | 16292128 Number of splices: GC/AG | 225312 Number of splices: AT/AC | 13753 Number of splices: Non-canonical | 54575 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.26 Insertion rate per base | 0.03% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 615368 % of reads mapped to multiple loci | 3.24% Number of reads mapped to too many loci | 57673 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.64% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1173247 1173247 1173247 N_multimapping 615368 615368 615368 N_noFeature 551350 17077549 621168 N_ambiguous 198647 1339 102100 UnstrandedReadsAssigned:16493041 PositiveStrandReadsAssigned:164150 NegativeStrandReadsAssigned:16519770 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172145 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172145-trimmed-pair1.fastq SRR7172145-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,007,448 reads, 16,430,782 reads pseudoaligned [quant] estimated average fragment length: 257.084 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7172145.ke.tsv 34699 SRR7172145.se.tsv 87100 total ==> SRR7172145.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.92 2470 84.2969 Potri.005G024800.1.v4.1 1035 778.916 430 33.1954 Potri.004G059700.1.v4.1 961 704.947 77 6.56802 Potri.007G009000.2.v4.1 1416 1159.92 0 0 Potri.003G141000.2.v4.1 2943 2686.92 593 13.2709 Potri.016G087400.1.v4.1 270 73.38 759 621.962 Potri.015G069301.1.v4.1 564 314.015 0 0 Potri.010G195200.1.v4.1 1773 1516.92 1036 41.0675 Potri.012G127500.1.v4.1 977 720.921 8721 727.409 ==> SRR7172145.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 683 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 322 SRR7172145 completed mapping pipeline successfully