Starting /dee2/code/volunteer_pipeline.sh SRR7172146 current disk space = 3118076379136 free memory = 1448981672 SRR7172146 SRAfilesize f8ccc89ab47a103b136f9ac66f03db25 SRR7172146.sra SRR7172146.sra file validated SRR7172146 is paired end SRR7172146 is conventional basespace SRR7172146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.845 33.0 33.0 34.0 32.0 34.0 2 32.88 33.0 33.0 34.0 31.0 34.0 3 32.978 34.0 33.0 34.0 31.0 34.0 4 32.35925 33.0 33.0 34.0 31.0 34.0 5 33.10025 33.0 33.0 34.0 32.0 34.0 6 36.7305 38.0 37.0 38.0 34.0 38.0 7 37.323 38.0 38.0 38.0 36.0 38.0 8 37.35525 38.0 38.0 38.0 37.0 38.0 9 37.4695 38.0 38.0 38.0 37.0 38.0 10-14 37.4513 38.0 38.0 38.0 37.8 38.0 15-19 37.4927 38.0 38.0 38.0 37.4 38.0 20-24 37.4338 38.0 38.0 38.0 37.2 38.0 25-29 37.3081 38.0 38.0 38.0 37.0 38.0 30-34 37.078050000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.86765 38.0 38.0 38.0 35.2 38.0 40-44 37.0877 38.0 38.0 38.0 36.0 38.0 45-49 37.1117 38.0 38.0 38.0 36.4 38.0 50-54 37.192099999999996 38.0 38.0 38.0 36.2 38.0 55-59 37.224450000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.24565 38.0 38.0 38.0 36.6 38.0 65-69 37.2371 38.0 38.0 38.0 36.6 38.0 70-74 37.144800000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.025800000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.80604999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.7125 38.0 38.0 38.0 35.0 38.0 90-94 36.58105 38.0 38.0 38.0 34.2 38.0 95-99 36.5517 38.0 38.0 38.0 34.2 38.0 100-104 36.501799999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.416999999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.302350000000004 38.0 37.8 38.0 34.0 38.0 115-119 36.174549999999996 38.0 37.2 38.0 33.8 38.0 120-124 36.07115 38.0 37.2 38.0 33.0 38.0 125-129 35.66435 38.0 36.8 38.0 31.4 38.0 130-134 35.2279 38.0 36.0 38.0 29.8 38.0 135-139 34.99105 38.0 35.8 38.0 29.4 38.0 140-144 34.1918 38.0 34.2 38.0 25.0 38.0 145-149 33.567150000000005 38.0 33.2 38.0 21.8 38.0 150-151 28.566 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 1.0 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 4.0 21 3.0 22 1.0 23 5.0 24 6.0 25 14.0 26 18.0 27 29.0 28 24.0 29 44.0 30 47.0 31 52.0 32 71.0 33 107.0 34 167.0 35 258.0 36 687.0 37 2450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.599999999999994 16.3 13.65 35.449999999999996 2 20.625 25.124999999999996 36.775000000000006 17.474999999999998 3 17.299999999999997 31.0 27.650000000000002 24.05 4 20.674999999999997 35.725 22.6 21.0 5 20.05 37.45 23.875 18.625 6 16.375 36.199999999999996 24.474999999999998 22.95 7 11.4 19.875 46.9 21.825 8 17.45 21.975 28.4 32.175 9 17.525 21.875 31.8 28.799999999999997 10-14 19.282533646870466 30.104567969179968 26.302096362635712 24.310802021313854 15-19 19.29596479823991 29.681484074203713 27.11635581779089 23.906195309765486 20-24 19.155 29.435 27.82 23.59 25-29 19.725 28.48 28.065 23.73 30-34 19.6 29.360000000000003 27.565 23.474999999999998 35-39 19.81 28.294999999999998 27.944999999999997 23.95 40-44 20.064999999999998 29.104999999999997 27.405 23.425 45-49 19.73 28.694999999999997 27.805000000000003 23.77 50-54 19.744999999999997 28.720000000000002 27.76 23.775 55-59 19.564999999999998 28.925 27.275 24.235 60-64 19.830000000000002 28.82 27.165 24.185000000000002 65-69 20.119999999999997 28.765 27.800000000000004 23.315 70-74 20.195 28.57 28.21 23.025000000000002 75-79 20.07 28.675 27.994999999999997 23.26 80-84 19.895 28.685 28.044999999999998 23.375 85-89 20.09 28.255000000000003 28.42 23.235 90-94 20.560000000000002 28.244999999999997 27.625 23.57 95-99 20.424999999999997 28.205000000000002 27.61 23.76 100-104 19.895 28.46 28.43 23.215 105-109 20.395 28.110000000000003 28.59 22.905 110-114 20.279055811162234 28.245649129825967 27.865573114622926 23.609721944388877 115-119 20.03801520608243 28.276310524209684 27.460984393757503 24.224689875950382 120-124 19.760928278483544 28.708612583775135 27.788336500950283 23.742122636791038 125-129 20.719366796914137 28.34886283939485 27.607454162909526 23.324316200781485 130-134 20.525 28.18 27.310000000000002 23.985 135-139 20.95 28.575 26.91 23.565 140-144 21.345 28.110000000000003 27.22 23.325000000000003 145-149 20.395 28.7 27.47 23.435 150-151 21.212500000000002 28.262500000000003 26.5125 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.5 24 5.0 25 6.0 26 6.0 27 7.5 28 8.5 29 15.5 30 23.5 31 26.5 32 33.5 33 47.5 34 69.5 35 82.5 36 90.0 37 121.0 38 139.0 39 172.5 40 217.0 41 227.5 42 242.5 43 265.5 44 261.5 45 270.0 46 288.5 47 261.5 48 212.0 49 176.0 50 161.0 51 128.5 52 102.5 53 80.0 54 58.0 55 49.5 56 37.5 57 25.5 58 16.5 59 15.5 60 12.0 61 7.0 62 6.5 63 5.5 64 4.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.065 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.04 120-124 0.03 125-129 0.19 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.825 0.0 0.0 0.0 0.0 136-137 3.1 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7915 33.0 33.0 34.0 32.0 34.0 2 32.88175 34.0 33.0 34.0 32.0 34.0 3 32.93575 34.0 33.0 34.0 32.0 34.0 4 32.85775 34.0 33.0 34.0 32.0 34.0 5 32.934 34.0 33.0 34.0 32.0 34.0 6 37.072 38.0 38.0 38.0 37.0 38.0 7 37.06325 38.0 38.0 38.0 37.0 38.0 8 37.1065 38.0 38.0 38.0 37.0 38.0 9 37.05025 38.0 38.0 38.0 37.0 38.0 10-14 37.0552 38.0 38.0 38.0 36.8 38.0 15-19 36.9763 38.0 38.0 38.0 36.6 38.0 20-24 36.89305 38.0 38.0 38.0 36.0 38.0 25-29 36.87455 38.0 38.0 38.0 36.0 38.0 30-34 36.93585 38.0 38.0 38.0 36.6 38.0 35-39 36.829699999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.75985000000001 38.0 38.0 38.0 35.8 38.0 45-49 36.837599999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.85615 38.0 38.0 38.0 36.0 38.0 55-59 36.79055 38.0 38.0 38.0 36.0 38.0 60-64 36.76205 38.0 38.0 38.0 35.8 38.0 65-69 36.705799999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.6157 38.0 38.0 38.0 35.0 38.0 75-79 36.58415 38.0 38.0 38.0 35.0 38.0 80-84 36.45595 38.0 38.0 38.0 34.8 38.0 85-89 36.17355 38.0 38.0 38.0 33.8 38.0 90-94 36.042100000000005 38.0 38.0 38.0 33.4 38.0 95-99 35.891200000000005 38.0 37.6 38.0 32.8 38.0 100-104 35.8009 38.0 37.0 38.0 33.0 38.0 105-109 35.75765 38.0 37.4 38.0 32.4 38.0 110-114 35.751549999999995 38.0 37.2 38.0 32.2 38.0 115-119 35.5099 38.0 37.0 38.0 31.2 38.0 120-124 35.163399999999996 38.0 36.6 38.0 29.8 38.0 125-129 34.89525 38.0 36.0 38.0 28.4 38.0 130-134 34.62745 38.0 35.8 38.0 27.8 38.0 135-139 33.958600000000004 38.0 34.0 38.0 23.2 38.0 140-144 33.3269 38.0 33.0 38.0 19.4 38.0 145-149 32.6057 38.0 33.0 38.0 11.8 38.0 150-151 27.464875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 5.0 5 4.0 6 1.0 7 1.0 8 3.0 9 0.0 10 1.0 11 2.0 12 5.0 13 1.0 14 4.0 15 2.0 16 4.0 17 3.0 18 7.0 19 11.0 20 6.0 21 10.0 22 11.0 23 13.0 24 18.0 25 18.0 26 17.0 27 16.0 28 28.0 29 46.0 30 41.0 31 67.0 32 83.0 33 121.0 34 182.0 35 250.0 36 612.0 37 2394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.11670423240671 15.477084898572501 16.503881793137992 29.902329075882793 2 24.224224224224226 23.2982982982983 34.75975975975976 17.71771771771772 3 20.295295295295297 25.825825825825827 32.107107107107105 21.77177177177177 4 23.317488116087066 32.94971228421316 22.191643732799598 21.541155866900176 5 21.85546386596649 38.78469617404351 21.680420105026258 17.67941985496374 6 17.349999999999998 38.1 24.775 19.775000000000002 7 17.08781586189642 15.861896422316738 45.359019264448335 21.691268451338505 8 19.950000000000003 22.0 27.825 30.225 9 22.125 23.5 28.15 26.224999999999998 10-14 23.53912347408445 27.101260756453872 27.00620372223334 22.35341204722834 15-19 22.87673289625144 28.126720384365143 28.02662529402933 20.969921425354087 20-24 22.829565913182638 27.895579115823168 28.135627125425085 21.139227845569113 25-29 23.055 27.644999999999996 28.000000000000004 21.3 30-34 22.405 27.589999999999996 28.310000000000002 21.695 35-39 22.74 27.939999999999998 28.134999999999998 21.185000000000002 40-44 23.165 27.935 27.655 21.245 45-49 22.965 28.09 28.42 20.525 50-54 23.105 27.88 27.815 21.2 55-59 23.325000000000003 27.625 28.405 20.645 60-64 23.275000000000002 28.01 28.205000000000002 20.51 65-69 23.18 28.244999999999997 28.110000000000003 20.465 70-74 23.855 27.47 28.044999999999998 20.630000000000003 75-79 23.095 27.944999999999997 27.955000000000002 21.005 80-84 23.330000000000002 28.01 28.139999999999997 20.52 85-89 22.900000000000002 28.03 28.21 20.86 90-94 23.145 27.750000000000004 28.365000000000002 20.74 95-99 23.836191809590478 27.396369818490925 28.201410070503524 20.56602830141507 100-104 23.580000000000002 27.295 28.12 21.005 105-109 23.765 27.750000000000004 27.800000000000004 20.685000000000002 110-114 23.775 27.500000000000004 28.51 20.215 115-119 23.415 27.82 28.505000000000003 20.26 120-124 23.43 27.750000000000004 28.365000000000002 20.455000000000002 125-129 24.349999999999998 27.625 28.175 19.85 130-134 23.799999999999997 27.66 27.944999999999997 20.595 135-139 24.265 27.71 28.09 19.935 140-144 24.32 28.325 27.18 20.175 145-149 25.405 27.775 27.35 19.470000000000002 150-151 25.074999999999996 27.5625 27.224999999999998 20.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 3.5 25 4.0 26 2.5 27 3.5 28 4.5 29 9.0 30 13.0 31 15.5 32 24.0 33 29.5 34 39.0 35 56.5 36 81.0 37 104.5 38 128.5 39 160.5 40 195.0 41 237.0 42 275.5 43 284.5 44 291.0 45 293.0 46 265.5 47 253.0 48 236.5 49 196.5 50 167.5 51 151.0 52 116.5 53 82.0 54 68.5 55 53.0 56 35.5 57 27.5 58 17.0 59 10.5 60 14.5 61 11.0 62 10.0 63 8.5 64 4.0 65 3.0 66 2.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.1 3 0.1 4 0.075 5 0.025 6 0.0 7 0.075 8 0.0 9 0.0 10-14 0.06 15-19 0.095 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.525 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.4124999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846939 spots for SRR7172146.sra Written 846939 spots for SRR7172146.sra Read 846949 spots for SRR7172146.sra Written 846949 spots for SRR7172146.sra SRR ids: ['SRR7172146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_062aeo9c SRR7172146.sra spots: 16938790 blocks: [[1, 846939], [846940, 1693878], [1693879, 2540817], [2540818, 3387756], [3387757, 4234695], [4234696, 5081634], [5081635, 5928573], [5928574, 6775512], [6775513, 7622451], [7622452, 8469390], [8469391, 9316329], [9316330, 10163268], [10163269, 11010207], [11010208, 11857146], [11857147, 12704085], [12704086, 13551024], [13551025, 14397963], [14397964, 15244902], [15244903, 16091841], [16091842, 16938790]] SRR7172146 file size 5718299 SRR7172146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172146 SRR7172146_1.fastq SRR7172146_2.fastq Input file: SRR7172146_1.fastq Paired file: SRR7172146_2.fastq trimmed: SRR7172146-trimmed-pair1.fastq, SRR7172146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:29:22 2025 >> started Fri Feb 14 08:29:40 2025 >> done (18.180s) 16938790 read pairs processed; of these: 18452 ( 0.11%) short read pairs filtered out after trimming by size control 15233 ( 0.09%) empty read pairs filtered out after trimming by size control 16905105 (99.80%) read pairs available; of these: 9655882 (57.12%) trimmed read pairs available after processing 7249223 (42.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 10 0.00% 23 3 0.00% 24 11 0.00% 25 12 0.00% 26 6 0.00% 27 7 0.00% 28 10 0.00% 29 5 0.00% 30 4 0.00% 31 3 0.00% 32 4 0.00% 33 7 0.00% 34 8 0.00% 35 9 0.00% 36 8 0.00% 37 7 0.00% 38 7 0.00% 39 3 0.00% 40 4 0.00% 41 8 0.00% 42 11 0.00% 43 16 0.00% 44 11 0.00% 45 12 0.00% 46 7 0.00% 47 16 0.00% 48 10 0.00% 49 16 0.00% 50 20 0.00% 51 20 0.00% 52 27 0.00% 53 25 0.00% 54 21 0.00% 55 36 0.00% 56 62 0.00% 57 431 0.00% 58 203 0.00% 59 185 0.00% 60 180 0.00% 61 75 0.00% 62 128 0.00% 63 110 0.00% 64 148 0.00% 65 128 0.00% 66 133 0.00% 67 234 0.00% 68 251 0.00% 69 259 0.00% 70 244 0.00% 71 292 0.00% 72 359 0.00% 73 433 0.00% 74 417 0.00% 75 524 0.00% 76 618 0.00% 77 961 0.01% 78 1399 0.01% 79 1006 0.01% 80 1152 0.01% 81 1223 0.01% 82 1329 0.01% 83 1882 0.01% 84 4144 0.02% 85 4458 0.03% 86 4217 0.02% 87 3884 0.02% 88 3728 0.02% 89 4009 0.02% 90 4157 0.02% 91 4337 0.03% 92 4611 0.03% 93 5134 0.03% 94 5598 0.03% 95 5766 0.03% 96 6479 0.04% 97 7226 0.04% 98 7528 0.04% 99 7883 0.05% 100 8429 0.05% 101 9549 0.06% 102 9587 0.06% 103 10145 0.06% 104 11009 0.07% 105 11682 0.07% 106 12140 0.07% 107 13259 0.08% 108 13735 0.08% 109 14569 0.09% 110 15857 0.09% 111 16480 0.10% 112 17683 0.10% 113 18795 0.11% 114 20116 0.12% 115 21384 0.13% 116 22410 0.13% 117 23570 0.14% 118 25055 0.15% 119 26547 0.16% 120 28183 0.17% 121 30034 0.18% 122 31802 0.19% 123 33683 0.20% 124 36156 0.21% 125 38356 0.23% 126 40982 0.24% 127 43254 0.26% 128 45788 0.27% 129 48047 0.28% 130 50818 0.30% 131 53046 0.31% 132 56699 0.34% 133 60603 0.36% 134 65068 0.38% 135 69478 0.41% 136 74720 0.44% 137 80285 0.47% 138 87462 0.52% 139 96642 0.57% 140 106516 0.63% 141 119169 0.70% 142 136054 0.80% 143 154283 0.91% 144 183844 1.09% 145 225210 1.33% 146 285014 1.69% 147 384178 2.27% 148 578492 3.42% 149 1124802 6.65% 150 4867291 28.79% 151 7249223 42.88% 16905105 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=57.58 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.8 sequence=AGCACCACCACCATG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=7.05 fanout-score-rank=14 prefix-density=0.39 prefix-fanout=4.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=107.69 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=20.8 sequence=CAAAGAAGAAGATGTTAGGCTGGGAGCTAACAGGTTCAATGAGAGGCAGCCAATTGGCACGGCAGCTCAGAGCCTAGATGACAAGG SRR7172146 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:30:42 Started mapping on | Feb 14 08:30:43 Finished on | Feb 14 08:32:37 Mapping speed, Million of reads per hour | 533.85 Number of input reads | 16905105 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15909037 Uniquely mapped reads % | 94.11% Average mapped length | 294.59 Number of splices: Total | 16131700 Number of splices: Annotated (sjdb) | 15890048 Number of splices: GT/AG | 15882822 Number of splices: GC/AG | 198519 Number of splices: AT/AC | 10901 Number of splices: Non-canonical | 39458 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.29 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423017 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 120149 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593635 593635 593635 N_multimapping 423017 423017 423017 N_noFeature 374635 15785803 422984 N_ambiguous 150939 826 75573 UnstrandedReadsAssigned:15383463 PositiveStrandReadsAssigned:122408 NegativeStrandReadsAssigned:15410480 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172146-trimmed-pair1.fastq SRR7172146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,905,105 reads, 15,362,734 reads pseudoaligned [quant] estimated average fragment length: 252.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR7172146.ke.tsv 34699 SRR7172146.se.tsv 87100 total ==> SRR7172146.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.38 966 35.111 Potri.005G024800.1.v4.1 1035 783.378 199 16.3091 Potri.004G059700.1.v4.1 961 709.394 28 2.53408 Potri.007G009000.2.v4.1 1416 1164.38 0 0 Potri.003G141000.2.v4.1 2943 2691.38 537.122 12.8129 Potri.016G087400.1.v4.1 270 74.1258 1373 1189.19 Potri.015G069301.1.v4.1 564 316.986 0 0 Potri.010G195200.1.v4.1 1773 1521.38 192 8.1024 Potri.012G127500.1.v4.1 977 725.388 2078 183.918 ==> SRR7172146.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 360 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 122 SRR7172146 completed mapping pipeline successfully