Starting /dee2/code/volunteer_pipeline.sh SRR7172147 current disk space = 3117118771200 free memory = 1576189232 SRR7172147 SRAfilesize cb2355991099942ca71021dfe3a041bc SRR7172147.sra SRR7172147.sra file validated SRR7172147 is paired end SRR7172147 is conventional basespace SRR7172147 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172147_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.00875 33.0 32.0 33.0 27.0 33.0 2 25.45375 28.0 18.0 31.0 18.0 32.0 3 30.22 31.0 29.0 33.0 27.0 33.0 4 32.064 33.0 32.0 33.0 31.0 33.0 5 32.18875 33.0 32.0 33.0 32.0 33.0 6 36.02575 37.0 36.0 38.0 33.0 38.0 7 37.16775 38.0 37.0 38.0 36.0 38.0 8 37.29475 38.0 38.0 38.0 36.0 38.0 9 37.48325 38.0 38.0 38.0 37.0 38.0 10-14 37.50705000000001 38.0 38.0 38.0 37.6 38.0 15-19 37.50359999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.49380000000001 38.0 38.0 38.0 37.2 38.0 25-29 37.47695 38.0 38.0 38.0 37.6 38.0 30-34 37.44015 38.0 38.0 38.0 37.4 38.0 35-39 37.463049999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.4154 38.0 38.0 38.0 37.0 38.0 45-49 37.3633 38.0 38.0 38.0 37.0 38.0 50-54 37.28595 38.0 38.0 38.0 37.0 38.0 55-59 37.1957 38.0 38.0 38.0 36.0 38.0 60-64 37.15095 38.0 38.0 38.0 36.0 38.0 65-69 37.066700000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.99634999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.859500000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.847699999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.7344 38.0 38.0 38.0 34.8 38.0 90-94 36.66035000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.540749999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.42635 38.0 37.8 38.0 34.0 38.0 105-109 36.198350000000005 38.0 37.0 38.0 33.6 38.0 110-114 35.99305 38.0 37.0 38.0 32.6 38.0 115-119 35.859449999999995 38.0 37.0 38.0 32.4 38.0 120-124 35.63575 38.0 36.4 38.0 31.2 38.0 125-129 35.286849999999994 38.0 36.0 38.0 28.8 38.0 130-134 35.120799999999996 38.0 35.8 38.0 28.2 38.0 135-139 34.643499999999996 38.0 35.0 38.0 27.4 38.0 140-144 34.01005 38.0 34.6 38.0 23.0 38.0 145-149 33.40325 38.0 34.2 38.0 20.4 38.0 150-151 29.4805 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 10.0 19 2.0 20 3.0 21 2.0 22 5.0 23 6.0 24 9.0 25 9.0 26 21.0 27 18.0 28 26.0 29 31.0 30 40.0 31 54.0 32 75.0 33 86.0 34 158.0 35 348.0 36 994.0 37 2100.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.723140495867767 18.104338842975206 15.160123966942148 41.01239669421488 2 17.675 20.3 41.099999999999994 20.925 3 16.8 26.174999999999997 27.725 29.299999999999997 4 20.7 35.0 22.8 21.5 5 19.975 34.449999999999996 24.125 21.45 6 15.725 35.949999999999996 26.724999999999998 21.6 7 11.75 21.75 44.474999999999994 22.025 8 18.425 21.2 28.725 31.65 9 18.05 22.25 31.724999999999998 27.975 10-14 19.3 29.555 26.595000000000002 24.55 15-19 19.465 29.310000000000002 27.189999999999998 24.035 20-24 20.0 28.965000000000003 27.61 23.425 25-29 19.48 29.285 27.465 23.77 30-34 19.595000000000002 29.099999999999998 28.03 23.275000000000002 35-39 19.79 29.13 27.925 23.155 40-44 19.825 28.645 28.59 22.939999999999998 45-49 19.8 28.71 27.474999999999998 24.015 50-54 19.855 29.104999999999997 27.71 23.330000000000002 55-59 19.865 29.13 27.839999999999996 23.165 60-64 19.805 29.235 27.26 23.7 65-69 19.689999999999998 28.68 28.139999999999997 23.49 70-74 20.105 28.994999999999997 28.01 22.89 75-79 19.56 28.804999999999996 28.084999999999997 23.549999999999997 80-84 20.155 28.395 27.73 23.72 85-89 20.165 28.515 28.13 23.189999999999998 90-94 20.385 28.845 27.384999999999998 23.385 95-99 19.975 28.27 28.310000000000002 23.445 100-104 20.27 28.555000000000003 27.985 23.189999999999998 105-109 20.005 29.270000000000003 27.435 23.29 110-114 20.78 28.595 27.325 23.3 115-119 20.565 28.67 27.589999999999996 23.175 120-124 20.419999999999998 28.595 27.735 23.25 125-129 20.535 28.625 27.400000000000002 23.44 130-134 20.775 28.244999999999997 27.605 23.375 135-139 20.78 29.020000000000003 26.705000000000002 23.494999999999997 140-144 20.885 28.655 26.97 23.49 145-149 21.15 28.655 26.340000000000003 23.855 150-151 19.9875 27.9375 28.199999999999996 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 2.0 24 4.0 25 6.0 26 9.5 27 12.0 28 12.5 29 17.0 30 29.5 31 32.0 32 38.5 33 56.5 34 69.0 35 79.5 36 95.0 37 118.5 38 149.5 39 174.5 40 205.0 41 240.5 42 254.5 43 255.5 44 250.5 45 258.0 46 269.5 47 255.0 48 212.0 49 173.0 50 155.5 51 130.0 52 104.0 53 83.5 54 60.0 55 50.0 56 35.0 57 21.0 58 22.0 59 16.5 60 9.0 61 6.5 62 5.0 63 5.5 64 4.5 65 1.0 66 0.5 67 3.0 68 2.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.0999999999999996 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.6625 0.0 0.0 0.0 0.0 134-135 3.9375 0.0 0.0 0.0 0.0 136-137 4.35 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACCA 10 0.0068378756 144.95 8 TCAAATG 10 0.0068378756 144.95 2 TTAGCAT 10 0.0068378756 144.95 6 TTAAACC 10 0.0068378756 144.95 7 TTCTTCA 25 8.7252335E-4 86.97 4 >>END_MODULE SRR7172147 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172147_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1215 34.0 33.0 34.0 32.0 34.0 2 33.2295 34.0 33.0 34.0 33.0 34.0 3 33.25 34.0 33.0 34.0 33.0 34.0 4 33.20575 34.0 33.0 34.0 33.0 34.0 5 33.20875 34.0 33.0 34.0 33.0 34.0 6 37.299 38.0 38.0 38.0 37.0 38.0 7 37.37525 38.0 38.0 38.0 37.0 38.0 8 37.34925 38.0 38.0 38.0 37.0 38.0 9 37.4085 38.0 38.0 38.0 37.0 38.0 10-14 37.36385 38.0 38.0 38.0 37.0 38.0 15-19 37.40435 38.0 38.0 38.0 37.0 38.0 20-24 37.34075 38.0 38.0 38.0 37.0 38.0 25-29 37.347449999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.3085 38.0 38.0 38.0 37.0 38.0 35-39 37.2342 38.0 38.0 38.0 37.0 38.0 40-44 37.22425 38.0 38.0 38.0 37.0 38.0 45-49 37.16725 38.0 38.0 38.0 36.6 38.0 50-54 37.1303 38.0 38.0 38.0 36.2 38.0 55-59 37.02275000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.0215 38.0 38.0 38.0 36.0 38.0 65-69 36.896449999999994 38.0 38.0 38.0 35.8 38.0 70-74 36.78355 38.0 38.0 38.0 35.4 38.0 75-79 36.7209 38.0 38.0 38.0 34.8 38.0 80-84 36.66635 38.0 38.0 38.0 35.0 38.0 85-89 36.59635 38.0 38.0 38.0 34.6 38.0 90-94 36.5144 38.0 38.0 38.0 34.2 38.0 95-99 36.3123 38.0 38.0 38.0 33.8 38.0 100-104 36.1745 38.0 37.6 38.0 33.4 38.0 105-109 36.004 38.0 37.2 38.0 32.6 38.0 110-114 35.7796 38.0 37.0 38.0 31.6 38.0 115-119 35.64595 38.0 37.0 38.0 31.0 38.0 120-124 35.3394 38.0 36.0 38.0 29.6 38.0 125-129 34.98205 38.0 35.6 38.0 28.4 38.0 130-134 34.7573 38.0 35.2 38.0 27.6 38.0 135-139 34.31875 38.0 35.0 38.0 24.0 38.0 140-144 33.81255 38.0 34.4 38.0 23.0 38.0 145-149 33.0794 38.0 34.0 38.0 18.0 38.0 150-151 28.43025 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 3.0 7 0.0 8 0.0 9 2.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 4.0 18 4.0 19 3.0 20 5.0 21 8.0 22 15.0 23 13.0 24 12.0 25 13.0 26 12.0 27 28.0 28 26.0 29 28.0 30 46.0 31 68.0 32 65.0 33 108.0 34 164.0 35 292.0 36 760.0 37 2313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.225 13.525 18.2 35.05 2 22.95 21.9 38.95 16.2 3 21.425 24.775 31.374999999999996 22.425 4 23.125 34.975 20.225 21.675 5 24.25 35.875 22.175 17.7 6 17.075000000000003 37.95 23.599999999999998 21.375 7 17.825 15.6 44.6 21.975 8 20.175 22.125 28.425 29.275000000000002 9 21.675 23.474999999999998 28.525 26.325 10-14 22.455 29.005 26.615 21.925 15-19 23.385 27.76 27.405 21.45 20-24 22.525000000000002 28.345 27.605 21.525 25-29 22.845 27.85 28.1 21.205 30-34 22.765 27.884999999999998 28.325 21.025 35-39 22.785 28.08 27.700000000000003 21.435000000000002 40-44 23.244999999999997 27.91 28.37 20.474999999999998 45-49 23.285 27.785 28.1 20.830000000000002 50-54 23.325000000000003 28.02 28.15 20.505000000000003 55-59 23.195 28.16 27.85 20.794999999999998 60-64 23.115 28.22 27.805000000000003 20.86 65-69 22.85 28.000000000000004 28.16 20.990000000000002 70-74 23.135 28.13 28.355000000000004 20.380000000000003 75-79 23.355 27.284999999999997 28.37 20.990000000000002 80-84 23.055 28.515 27.634999999999998 20.794999999999998 85-89 22.775000000000002 27.755000000000003 28.59 20.880000000000003 90-94 23.605 27.439999999999998 28.68 20.275000000000002 95-99 23.674999999999997 27.76 28.015 20.549999999999997 100-104 22.945 27.955000000000002 28.13 20.97 105-109 23.57 28.335 27.575 20.52 110-114 23.465 28.449999999999996 27.229999999999997 20.855 115-119 23.674999999999997 27.800000000000004 28.395 20.13 120-124 24.240000000000002 27.855 28.26 19.645000000000003 125-129 23.919999999999998 28.155 27.435 20.49 130-134 23.645 28.07 27.865000000000002 20.419999999999998 135-139 23.695 27.845 27.994999999999997 20.465 140-144 24.51 27.71 28.035 19.744999999999997 145-149 24.635 27.965 28.310000000000002 19.09 150-151 24.4 28.475 27.3 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 3.5 27 7.0 28 7.0 29 5.5 30 14.0 31 22.0 32 29.0 33 37.0 34 44.0 35 59.5 36 80.5 37 115.0 38 149.5 39 165.5 40 185.5 41 222.5 42 254.5 43 281.5 44 290.5 45 268.5 46 249.0 47 245.0 48 243.0 49 221.5 50 167.0 51 127.5 52 115.5 53 94.5 54 73.5 55 56.0 56 42.5 57 32.5 58 21.5 59 16.0 60 13.0 61 7.5 62 5.0 63 4.0 64 3.5 65 3.0 66 1.0 67 0.5 68 2.0 69 2.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.475 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.0375 0.0 0.0 0.0 0.0 136-137 4.4875 0.0 0.0 0.0 0.0 138-139 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAGG 10 0.006830828 145.0 9 CGCGTTC 10 0.006830828 145.0 2 >>END_MODULE Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480188 spots for SRR7172147.sra Written 480188 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra Read 480185 spots for SRR7172147.sra Written 480185 spots for SRR7172147.sra SRR ids: ['SRR7172147.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vkbqgbnk SRR7172147.sra spots: 9603703 blocks: [[1, 480185], [480186, 960370], [960371, 1440555], [1440556, 1920740], [1920741, 2400925], [2400926, 2881110], [2881111, 3361295], [3361296, 3841480], [3841481, 4321665], [4321666, 4801850], [4801851, 5282035], [5282036, 5762220], [5762221, 6242405], [6242406, 6722590], [6722591, 7202775], [7202776, 7682960], [7682961, 8163145], [8163146, 8643330], [8643331, 9123515], [9123516, 9603703]] SRR7172147 file size 3233453 SRR7172147 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172147 SRR7172147_1.fastq SRR7172147_2.fastq Input file: SRR7172147_1.fastq Paired file: SRR7172147_2.fastq trimmed: SRR7172147-trimmed-pair1.fastq, SRR7172147-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:03:01 2025 >> started Fri Feb 14 09:03:12 2025 >> done (10.255s) 9603703 read pairs processed; of these: 2636 ( 0.03%) short read pairs filtered out after trimming by size control 1749 ( 0.02%) empty read pairs filtered out after trimming by size control 9599318 (99.95%) read pairs available; of these: 5493250 (57.23%) trimmed read pairs available after processing 4106068 (42.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 6 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 5 0.00% 27 3 0.00% 28 3 0.00% 29 4 0.00% 30 1 0.00% 31 3 0.00% 32 2 0.00% 33 1 0.00% 34 4 0.00% 35 2 0.00% 36 3 0.00% 37 3 0.00% 38 3 0.00% 39 5 0.00% 40 2 0.00% 41 4 0.00% 42 6 0.00% 43 4 0.00% 44 14 0.00% 45 9 0.00% 46 9 0.00% 47 10 0.00% 48 13 0.00% 49 13 0.00% 50 14 0.00% 51 32 0.00% 52 18 0.00% 53 26 0.00% 54 23 0.00% 55 27 0.00% 56 36 0.00% 57 42 0.00% 58 53 0.00% 59 63 0.00% 60 64 0.00% 61 53 0.00% 62 50 0.00% 63 101 0.00% 64 88 0.00% 65 118 0.00% 66 110 0.00% 67 129 0.00% 68 162 0.00% 69 205 0.00% 70 184 0.00% 71 227 0.00% 72 271 0.00% 73 297 0.00% 74 320 0.00% 75 386 0.00% 76 468 0.00% 77 505 0.01% 78 546 0.01% 79 636 0.01% 80 726 0.01% 81 834 0.01% 82 885 0.01% 83 1011 0.01% 84 1265 0.01% 85 1545 0.02% 86 1715 0.02% 87 1963 0.02% 88 2107 0.02% 89 2304 0.02% 90 2438 0.03% 91 2667 0.03% 92 2958 0.03% 93 3235 0.03% 94 3395 0.04% 95 3754 0.04% 96 4039 0.04% 97 4218 0.04% 98 4551 0.05% 99 4892 0.05% 100 5256 0.05% 101 5639 0.06% 102 6156 0.06% 103 6445 0.07% 104 7009 0.07% 105 7301 0.08% 106 7883 0.08% 107 8488 0.09% 108 8896 0.09% 109 9213 0.10% 110 9790 0.10% 111 10284 0.11% 112 10965 0.11% 113 11748 0.12% 114 12347 0.13% 115 13410 0.14% 116 13913 0.14% 117 14487 0.15% 118 15387 0.16% 119 15684 0.16% 120 16695 0.17% 121 17541 0.18% 122 18516 0.19% 123 19667 0.20% 124 20799 0.22% 125 21935 0.23% 126 23328 0.24% 127 24880 0.26% 128 25987 0.27% 129 28172 0.29% 130 29998 0.31% 131 31908 0.33% 132 34118 0.36% 133 36376 0.38% 134 39072 0.41% 135 41285 0.43% 136 44376 0.46% 137 48469 0.50% 138 52048 0.54% 139 56544 0.59% 140 62768 0.65% 141 70688 0.74% 142 80359 0.84% 143 93497 0.97% 144 112236 1.17% 145 139016 1.45% 146 180563 1.88% 147 258071 2.69% 148 408252 4.25% 149 762605 7.94% 150 2437277 25.39% 151 4106068 42.77% 9599318 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.7 sequence=ACCTGCAATGATTGTCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=383.52 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=33.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.94 fanout-score-rank=19 prefix-density=0.39 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=222.91 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=18.1 sequence=GATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGG SRR7172147 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:04:15 Started mapping on | Feb 14 09:04:15 Finished on | Feb 14 09:06:01 Mapping speed, Million of reads per hour | 326.01 Number of input reads | 9599318 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8851045 Uniquely mapped reads % | 92.20% Average mapped length | 294.16 Number of splices: Total | 8856624 Number of splices: Annotated (sjdb) | 8695612 Number of splices: GT/AG | 8709811 Number of splices: GC/AG | 114962 Number of splices: AT/AC | 6569 Number of splices: Non-canonical | 25282 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285457 % of reads mapped to multiple loci | 2.97% Number of reads mapped to too many loci | 46646 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.18% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466650 466650 466650 N_multimapping 285457 285457 285457 N_noFeature 259930 8756237 308886 N_ambiguous 96757 490 50624 UnstrandedReadsAssigned:8494358 PositiveStrandReadsAssigned:94318 NegativeStrandReadsAssigned:8491535 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172147 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172147-trimmed-pair1.fastq SRR7172147-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,599,318 reads, 8,439,107 reads pseudoaligned [quant] estimated average fragment length: 248.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,029 rounds 52401 SRR7172147.ke.tsv 34699 SRR7172147.se.tsv 87100 total ==> SRR7172147.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.5 934 56.4367 Potri.005G024800.1.v4.1 1035 787.499 220 29.8871 Potri.004G059700.1.v4.1 961 713.525 28 4.19817 Potri.007G009000.2.v4.1 1416 1168.5 5 0.457775 Potri.003G141000.2.v4.1 2943 2695.5 306 12.1449 Potri.016G087400.1.v4.1 270 75.8885 607.489 856.394 Potri.015G069301.1.v4.1 564 320.895 0 0 Potri.010G195200.1.v4.1 1773 1525.5 209 14.657 Potri.012G127500.1.v4.1 977 729.52 4112 603.013 ==> SRR7172147.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 110 SRR7172147 completed mapping pipeline successfully