Starting /dee2/code/volunteer_pipeline.sh SRR7172148 current disk space = 3117958082560 free memory = 1449217452 SRR7172148 SRAfilesize 6faf8fb15b5ad11911919141026fbd80 SRR7172148.sra SRR7172148.sra file validated SRR7172148 is paired end SRR7172148 is conventional basespace SRR7172148 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172148_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7475 33.0 33.0 34.0 32.0 34.0 2 32.7675 33.0 33.0 34.0 31.0 34.0 3 32.83075 33.0 33.0 34.0 31.0 34.0 4 33.1395 34.0 33.0 34.0 32.0 34.0 5 33.085 33.0 33.0 34.0 32.0 34.0 6 36.73525 38.0 37.0 38.0 34.0 38.0 7 37.18675 38.0 38.0 38.0 36.0 38.0 8 37.09825 38.0 38.0 38.0 36.0 38.0 9 37.35725 38.0 38.0 38.0 37.0 38.0 10-14 37.392399999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.46865 38.0 38.0 38.0 37.4 38.0 20-24 37.39735 38.0 38.0 38.0 37.4 38.0 25-29 37.20555 38.0 38.0 38.0 36.6 38.0 30-34 37.03785 38.0 38.0 38.0 36.0 38.0 35-39 36.73729999999999 38.0 37.8 38.0 34.6 38.0 40-44 36.9337 38.0 38.0 38.0 36.0 38.0 45-49 37.08315 38.0 38.0 38.0 36.2 38.0 50-54 37.20765 38.0 38.0 38.0 36.8 38.0 55-59 37.208949999999994 38.0 38.0 38.0 36.6 38.0 60-64 37.22035 38.0 38.0 38.0 36.8 38.0 65-69 37.2192 38.0 38.0 38.0 36.8 38.0 70-74 37.12895 38.0 38.0 38.0 36.0 38.0 75-79 37.0136 38.0 38.0 38.0 36.0 38.0 80-84 36.804 38.0 38.0 38.0 35.0 38.0 85-89 36.61999999999999 38.0 38.0 38.0 34.6 38.0 90-94 36.5231 38.0 38.0 38.0 34.2 38.0 95-99 36.49980000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.52545 38.0 38.0 38.0 34.0 38.0 105-109 36.474900000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.2987 38.0 38.0 38.0 34.0 38.0 115-119 36.07165 38.0 37.0 38.0 33.6 38.0 120-124 36.00745 38.0 37.0 38.0 32.8 38.0 125-129 35.66080000000001 38.0 36.6 38.0 31.8 38.0 130-134 35.34655 38.0 36.0 38.0 30.6 38.0 135-139 34.949799999999996 38.0 35.4 38.0 29.4 38.0 140-144 34.26185 38.0 34.8 38.0 25.2 38.0 145-149 33.4585 38.0 33.6 38.0 19.6 38.0 150-151 28.527625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 1.0 18 2.0 19 1.0 20 4.0 21 7.0 22 7.0 23 2.0 24 13.0 25 15.0 26 20.0 27 27.0 28 33.0 29 37.0 30 37.0 31 52.0 32 80.0 33 105.0 34 163.0 35 268.0 36 646.0 37 2474.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.875000000000004 16.825000000000003 13.925 38.375 2 20.28514257128564 25.41270635317659 37.943971985992995 16.358179089544773 3 17.525 30.75 26.450000000000003 25.275 4 21.099999999999998 37.65 22.15 19.1 5 19.925 36.85 24.6 18.625 6 15.925 36.975 25.8 21.3 7 12.575 19.875 46.075 21.475 8 17.474999999999998 21.775 28.125 32.625 9 17.2 22.85 32.375 27.575 10-14 18.831006355402092 29.995496171745984 26.747735575238952 24.425761897612972 15-19 19.620981049052453 28.706435321766087 27.976398819940997 23.69618480924046 20-24 19.075 29.01 28.134999999999998 23.78 25-29 19.59 29.415000000000003 27.145000000000003 23.849999999999998 30-34 19.445 29.53 27.675 23.35 35-39 19.52 28.415000000000003 28.715000000000003 23.35 40-44 19.555 28.970000000000002 28.26 23.215 45-49 19.380969048452425 28.671433571678584 28.0314015700785 23.916195809790487 50-54 19.25 29.34 27.525 23.885 55-59 19.99 28.945 27.425 23.64 60-64 19.255 29.005 27.99 23.75 65-69 19.040000000000003 29.330000000000002 27.665 23.965 70-74 19.365 28.939999999999998 28.084999999999997 23.61 75-79 19.62 28.560000000000002 28.08 23.74 80-84 19.939999999999998 28.59 28.03 23.44 85-89 19.445 29.425 27.405 23.724999999999998 90-94 19.43194319431943 29.122912291229124 27.442744274427444 24.002400240024002 95-99 19.81 28.51 27.860000000000003 23.82 100-104 19.825 28.720000000000002 27.700000000000003 23.755000000000003 105-109 20.145 28.705000000000002 27.99 23.16 110-114 19.98899779955991 28.395679135827166 27.760552110422083 23.854770954190837 115-119 20.237082979042665 28.585004751663085 27.864752663432203 23.31315960586205 120-124 20.1600400100025 28.942235558889724 27.181795448862218 23.71592898224556 125-129 20.196353436185134 28.506311360448812 27.825085153275896 23.472250050090164 130-134 20.005 29.065 27.54 23.39 135-139 20.64 28.544999999999998 27.58 23.235 140-144 20.465 28.375 26.905 24.255 145-149 20.565 28.54 27.21 23.685000000000002 150-151 20.1625 27.6875 27.950000000000003 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 2.0 23 1.5 24 2.0 25 5.5 26 7.0 27 10.0 28 13.0 29 12.5 30 18.0 31 30.5 32 43.0 33 60.5 34 77.0 35 85.5 36 104.5 37 127.5 38 137.0 39 161.5 40 214.0 41 238.0 42 249.0 43 272.5 44 286.0 45 283.0 46 273.5 47 250.5 48 206.0 49 177.0 50 157.5 51 119.0 52 92.5 53 78.0 54 49.0 55 34.0 56 34.0 57 26.5 58 14.5 59 9.0 60 6.5 61 5.5 62 5.0 63 3.5 64 1.5 65 2.0 66 2.5 67 1.5 68 0.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.08499999999999999 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.034999999999999996 120-124 0.025 125-129 0.18 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.2874999999999996 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.2125000000000004 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 5.05 0.0 0.0 0.0 0.0 138-139 5.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172148 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172148_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89475 33.0 33.0 34.0 32.0 34.0 2 32.98125 34.0 33.0 34.0 32.0 34.0 3 33.05525 34.0 33.0 34.0 32.0 34.0 4 32.97075 34.0 33.0 34.0 32.0 34.0 5 33.032 34.0 33.0 34.0 32.0 34.0 6 37.15275 38.0 38.0 38.0 37.0 38.0 7 37.1915 38.0 38.0 38.0 37.0 38.0 8 37.22125 38.0 38.0 38.0 37.0 38.0 9 37.3 38.0 38.0 38.0 37.0 38.0 10-14 37.24735 38.0 38.0 38.0 37.0 38.0 15-19 37.09310000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.11295 38.0 38.0 38.0 36.8 38.0 25-29 37.09765 38.0 38.0 38.0 37.0 38.0 30-34 37.06355 38.0 38.0 38.0 37.0 38.0 35-39 36.981100000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.9633 38.0 38.0 38.0 36.6 38.0 45-49 36.965199999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.00940000000001 38.0 38.0 38.0 36.4 38.0 55-59 37.003949999999996 38.0 38.0 38.0 36.4 38.0 60-64 36.953599999999994 38.0 38.0 38.0 36.2 38.0 65-69 36.859350000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.809000000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.8073 38.0 38.0 38.0 36.0 38.0 80-84 36.66769999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.42549999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.326499999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.2376 38.0 38.0 38.0 34.0 38.0 100-104 36.1623 38.0 38.0 38.0 33.8 38.0 105-109 36.16955 38.0 38.0 38.0 34.0 38.0 110-114 36.06755 38.0 38.0 38.0 34.0 38.0 115-119 35.8952 38.0 37.4 38.0 32.6 38.0 120-124 35.562599999999996 38.0 37.0 38.0 31.0 38.0 125-129 35.294650000000004 38.0 36.8 38.0 31.0 38.0 130-134 34.9761 38.0 36.0 38.0 29.0 38.0 135-139 34.382 38.0 35.4 38.0 26.2 38.0 140-144 33.8335 38.0 33.8 38.0 22.0 38.0 145-149 33.13075 38.0 33.0 38.0 17.4 38.0 150-151 27.86925 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 4.0 5 4.0 6 4.0 7 1.0 8 0.0 9 0.0 10 3.0 11 1.0 12 1.0 13 0.0 14 3.0 15 3.0 16 2.0 17 2.0 18 1.0 19 3.0 20 4.0 21 12.0 22 15.0 23 4.0 24 12.0 25 15.0 26 24.0 27 21.0 28 27.0 29 36.0 30 32.0 31 60.0 32 70.0 33 101.0 34 153.0 35 273.0 36 587.0 37 2512.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.80070105157736 15.12268402603906 18.02704056084126 33.04957436154231 2 24.3993993993994 21.27127127127127 36.93693693693694 17.39239239239239 3 19.73980485364023 26.444833625218916 31.17338003502627 22.641981486114584 4 23.992994746059544 34.701025769326996 20.815611708781585 20.490367775831874 5 23.692769577182887 37.0778083562672 21.766324743557668 17.463097322992244 6 18.15 37.974999999999994 24.375 19.5 7 17.96347260445334 15.186389792344258 46.7100325243933 20.140105078809107 8 20.3 21.7 29.4 28.599999999999998 9 22.55 24.075 28.625 24.75 10-14 22.903742245347207 28.89733840304182 26.736041624974987 21.46287772663598 15-19 23.366029426483838 27.945150635572013 27.96516865178661 20.72365128615754 20-24 23.1519455836751 28.358507552265678 27.9333800140042 20.556166850055018 25-29 22.345000000000002 28.285 28.355000000000004 21.015 30-34 22.63 28.525 28.425 20.419999999999998 35-39 22.875 28.050000000000004 28.375 20.7 40-44 23.1 27.92 27.98 21.0 45-49 23.305 28.22 27.805000000000003 20.669999999999998 50-54 22.470000000000002 28.599999999999998 28.555000000000003 20.375 55-59 22.675 28.4 28.58 20.345 60-64 23.31 28.134999999999998 28.125 20.43 65-69 23.5 28.244999999999997 27.950000000000003 20.305 70-74 23.835 28.4 27.584999999999997 20.18 75-79 23.61618080904045 28.196409820491024 28.331416570828544 19.85599279963998 80-84 23.849999999999998 27.794999999999998 28.310000000000002 20.044999999999998 85-89 23.615 27.775 28.785 19.825 90-94 24.09 28.910000000000004 27.51 19.49 95-99 23.723558533780068 27.849177376606495 28.27924188628294 20.1480222033305 100-104 23.915 28.310000000000002 28.26 19.515 105-109 23.799999999999997 28.365000000000002 28.095 19.74 110-114 23.669999999999998 28.46 27.815 20.055 115-119 23.705000000000002 28.37 28.355000000000004 19.57 120-124 23.965 27.91 28.455000000000002 19.67 125-129 23.580000000000002 28.64 28.03 19.75 130-134 24.205 27.665 28.42 19.71 135-139 24.36 28.095 27.79 19.755 140-144 24.255 28.275 27.785 19.685 145-149 24.535 28.24 27.72 19.505 150-151 24.9375 26.8 28.3125 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.0 24 1.5 25 2.5 26 3.5 27 5.5 28 7.0 29 10.5 30 17.5 31 21.0 32 26.5 33 40.0 34 55.0 35 66.0 36 77.5 37 102.0 38 142.5 39 188.0 40 224.5 41 246.0 42 262.5 43 276.0 44 272.0 45 282.0 46 287.0 47 247.0 48 220.0 49 216.5 50 175.0 51 120.5 52 95.0 53 75.0 54 53.0 55 41.5 56 35.5 57 27.5 58 23.0 59 14.5 60 8.5 61 7.5 62 6.0 63 4.5 64 4.0 65 2.0 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.1 3 0.075 4 0.075 5 0.075 6 0.0 7 0.075 8 0.0 9 0.0 10-14 0.06 15-19 0.09 20-24 0.03 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 4.75 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138-139 5.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 165 0.0053690304 7.909091 120-124 >>END_MODULE Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982573 spots for SRR7172148.sra Written 982573 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra Read 982569 spots for SRR7172148.sra Written 982569 spots for SRR7172148.sra SRR ids: ['SRR7172148.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cm5wbl3f SRR7172148.sra spots: 19651384 blocks: [[1, 982569], [982570, 1965138], [1965139, 2947707], [2947708, 3930276], [3930277, 4912845], [4912846, 5895414], [5895415, 6877983], [6877984, 7860552], [7860553, 8843121], [8843122, 9825690], [9825691, 10808259], [10808260, 11790828], [11790829, 12773397], [12773398, 13755966], [13755967, 14738535], [14738536, 15721104], [15721105, 16703673], [16703674, 17686242], [17686243, 18668811], [18668812, 19651384]] SRR7172148 file size 6637508 SRR7172148 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172148 SRR7172148_1.fastq SRR7172148_2.fastq Input file: SRR7172148_1.fastq Paired file: SRR7172148_2.fastq trimmed: SRR7172148-trimmed-pair1.fastq, SRR7172148-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:34:36 2025 >> started Fri Feb 14 08:35:09 2025 >> done (32.160s) 19651384 read pairs processed; of these: 10724 ( 0.05%) short read pairs filtered out after trimming by size control 10058 ( 0.05%) empty read pairs filtered out after trimming by size control 19630602 (99.89%) read pairs available; of these: 11286385 (57.49%) trimmed read pairs available after processing 8344217 (42.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 4 0.00% 28 3 0.00% 29 7 0.00% 30 6 0.00% 31 6 0.00% 32 8 0.00% 33 6 0.00% 34 13 0.00% 35 9 0.00% 36 8 0.00% 37 12 0.00% 38 12 0.00% 39 12 0.00% 40 12 0.00% 41 14 0.00% 42 16 0.00% 43 12 0.00% 44 10 0.00% 45 13 0.00% 46 16 0.00% 47 13 0.00% 48 23 0.00% 49 25 0.00% 50 28 0.00% 51 26 0.00% 52 41 0.00% 53 22 0.00% 54 42 0.00% 55 51 0.00% 56 89 0.00% 57 472 0.00% 58 250 0.00% 59 201 0.00% 60 201 0.00% 61 113 0.00% 62 181 0.00% 63 166 0.00% 64 183 0.00% 65 234 0.00% 66 253 0.00% 67 304 0.00% 68 381 0.00% 69 363 0.00% 70 402 0.00% 71 484 0.00% 72 529 0.00% 73 761 0.00% 74 695 0.00% 75 859 0.00% 76 1036 0.01% 77 1424 0.01% 78 1970 0.01% 79 1681 0.01% 80 1771 0.01% 81 1944 0.01% 82 2202 0.01% 83 2810 0.01% 84 5080 0.03% 85 5141 0.03% 86 5216 0.03% 87 5011 0.03% 88 5221 0.03% 89 5453 0.03% 90 5854 0.03% 91 6120 0.03% 92 6770 0.03% 93 7442 0.04% 94 8272 0.04% 95 8958 0.05% 96 9968 0.05% 97 10933 0.06% 98 11419 0.06% 99 11994 0.06% 100 12900 0.07% 101 14202 0.07% 102 14857 0.08% 103 15089 0.08% 104 16031 0.08% 105 17788 0.09% 106 18606 0.09% 107 20164 0.10% 108 21137 0.11% 109 22099 0.11% 110 23416 0.12% 111 24358 0.12% 112 25889 0.13% 113 27570 0.14% 114 29136 0.15% 115 30446 0.16% 116 32072 0.16% 117 33713 0.17% 118 35618 0.18% 119 37095 0.19% 120 39506 0.20% 121 41547 0.21% 122 43322 0.22% 123 45718 0.23% 124 48534 0.25% 125 51036 0.26% 126 53549 0.27% 127 56438 0.29% 128 59326 0.30% 129 62144 0.32% 130 65030 0.33% 131 67810 0.35% 132 71169 0.36% 133 76551 0.39% 134 80814 0.41% 135 86202 0.44% 136 91585 0.47% 137 98693 0.50% 138 106880 0.54% 139 116108 0.59% 140 127837 0.65% 141 139846 0.71% 142 159146 0.81% 143 178549 0.91% 144 211401 1.08% 145 256914 1.31% 146 323530 1.65% 147 434679 2.21% 148 652686 3.32% 149 1264052 6.44% 150 5562294 28.33% 151 8344217 42.51% 19630602 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.41 fanout-score-rank=23 prefix-density=0.25 prefix-fanout=3.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=33.20 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.9 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=33 prefix-density=0.34 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=426.55 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=32.4 sequence=AAGAAGAAGAAA SRR7172148 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:35:55 Started mapping on | Feb 14 08:35:55 Finished on | Feb 14 08:40:48 Mapping speed, Million of reads per hour | 241.20 Number of input reads | 19630602 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18190450 Uniquely mapped reads % | 92.66% Average mapped length | 293.77 Number of splices: Total | 17761985 Number of splices: Annotated (sjdb) | 17416151 Number of splices: GT/AG | 17460636 Number of splices: GC/AG | 232143 Number of splices: AT/AC | 14977 Number of splices: Non-canonical | 54229 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 560820 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 72426 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 892286 892286 892286 N_multimapping 560820 560820 560820 N_noFeature 572908 17994211 668831 N_ambiguous 205797 1598 104396 UnstrandedReadsAssigned:17411745 PositiveStrandReadsAssigned:194641 NegativeStrandReadsAssigned:17417223 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172148 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172148-trimmed-pair1.fastq SRR7172148-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,630,602 reads, 17,323,198 reads pseudoaligned [quant] estimated average fragment length: 241.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7172148.ke.tsv 34699 SRR7172148.se.tsv 87100 total ==> SRR7172148.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.38 1075 32.6833 Potri.005G024800.1.v4.1 1035 794.378 284 19.3191 Potri.004G059700.1.v4.1 961 720.388 23 1.72527 Potri.007G009000.2.v4.1 1416 1175.38 0 0 Potri.003G141000.2.v4.1 2943 2702.38 632.456 12.6468 Potri.016G087400.1.v4.1 270 78.8762 1467 1005.03 Potri.015G069301.1.v4.1 564 327.041 0 0 Potri.010G195200.1.v4.1 1773 1532.38 598.672 21.1115 Potri.012G127500.1.v4.1 977 736.388 12391 909.277 ==> SRR7172148.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 95 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 577 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 290 SRR7172148 completed mapping pipeline successfully