Starting /dee2/code/volunteer_pipeline.sh SRR7172149 current disk space = 3111146254336 free memory = 1413152408 SRR7172149 SRAfilesize dff472ebef8eb774e553af913dbb7d1f SRR7172149.sra SRR7172149.sra file validated SRR7172149 is paired end SRR7172149 is conventional basespace SRR7172149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.975 33.0 32.0 34.0 30.0 34.0 2 32.61425 33.0 33.0 34.0 31.0 34.0 3 32.78275 33.0 33.0 34.0 31.0 34.0 4 32.33575 33.0 32.0 33.0 31.0 34.0 5 32.91775 33.0 33.0 34.0 32.0 34.0 6 36.8515 38.0 37.0 38.0 35.0 38.0 7 37.013 38.0 37.0 38.0 35.0 38.0 8 37.37675 38.0 38.0 38.0 36.0 38.0 9 37.4855 38.0 38.0 38.0 37.0 38.0 10-14 37.5135 38.0 38.0 38.0 37.0 38.0 15-19 37.5617 38.0 38.0 38.0 37.4 38.0 20-24 37.5357 38.0 38.0 38.0 37.4 38.0 25-29 37.5706 38.0 38.0 38.0 38.0 38.0 30-34 37.507600000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.51795 38.0 38.0 38.0 37.8 38.0 40-44 37.50064999999999 38.0 38.0 38.0 37.6 38.0 45-49 37.43175 38.0 38.0 38.0 37.0 38.0 50-54 37.326100000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.2299 38.0 38.0 38.0 36.0 38.0 60-64 37.13075 38.0 38.0 38.0 36.0 38.0 65-69 37.062200000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.058499999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.928450000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.9003 38.0 38.0 38.0 35.2 38.0 85-89 36.75345 38.0 38.0 38.0 34.8 38.0 90-94 36.682249999999996 38.0 38.0 38.0 34.2 38.0 95-99 36.52345 38.0 38.0 38.0 34.0 38.0 100-104 36.465700000000005 38.0 37.8 38.0 34.0 38.0 105-109 36.2496 38.0 37.0 38.0 33.6 38.0 110-114 36.08295 38.0 37.0 38.0 33.2 38.0 115-119 35.877449999999996 38.0 37.0 38.0 32.4 38.0 120-124 35.66244999999999 38.0 36.2 38.0 31.0 38.0 125-129 35.38555 38.0 36.0 38.0 30.6 38.0 130-134 35.17285 38.0 35.6 38.0 28.8 38.0 135-139 34.776 38.0 35.0 38.0 27.6 38.0 140-144 34.044500000000006 38.0 34.2 38.0 23.2 38.0 145-149 33.4902 38.0 34.0 38.0 19.2 38.0 150-151 29.981125 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 1.0 17 2.0 18 2.0 19 1.0 20 5.0 21 5.0 22 4.0 23 6.0 24 9.0 25 9.0 26 16.0 27 14.0 28 20.0 29 23.0 30 44.0 31 40.0 32 49.0 33 88.0 34 171.0 35 334.0 36 962.0 37 2192.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.659978880675823 17.5818373812038 15.232312565997889 41.52587117212249 2 16.525000000000002 28.875 37.425000000000004 17.175 3 17.675 29.875 25.324999999999996 27.125 4 19.875 36.8 20.849999999999998 22.475 5 20.474999999999998 37.775 23.849999999999998 17.9 6 15.425 37.2 26.625 20.75 7 11.924999999999999 22.125 44.925 21.025 8 17.7 21.15 28.025 33.125 9 17.5 21.95 31.175000000000004 29.375 10-14 19.37 30.625000000000004 26.05 23.955000000000002 15-19 19.715 29.04 27.735 23.51 20-24 19.705000000000002 28.64 27.73 23.925 25-29 19.305 30.130000000000003 27.634999999999998 22.93 30-34 19.470000000000002 29.915000000000003 27.685 22.93 35-39 19.77 29.965000000000003 27.284999999999997 22.98 40-44 20.025000000000002 29.315 27.16 23.5 45-49 19.505 29.43 27.634999999999998 23.43 50-54 20.1 28.715000000000003 28.12 23.064999999999998 55-59 19.715 29.304999999999996 27.54 23.44 60-64 19.55 28.925 27.555000000000003 23.97 65-69 19.665 29.549999999999997 27.650000000000002 23.135 70-74 19.759999999999998 28.815 28.310000000000002 23.115 75-79 20.085 28.62 27.715 23.580000000000002 80-84 20.265 28.935 27.439999999999998 23.36 85-89 20.265 28.910000000000004 27.55 23.275000000000002 90-94 20.4 28.799999999999997 27.544999999999998 23.255 95-99 20.305 28.444999999999997 27.555000000000003 23.695 100-104 20.560000000000002 28.705000000000002 27.46 23.275000000000002 105-109 20.294999999999998 29.09 27.36 23.255 110-114 21.005 28.925 26.784999999999997 23.285 115-119 20.474999999999998 28.46 27.284999999999997 23.78 120-124 20.305 28.23 27.57 23.895 125-129 20.535 28.315 27.175 23.974999999999998 130-134 20.68 28.42 27.339999999999996 23.56 135-139 20.560000000000002 28.22 27.66 23.56 140-144 21.055 27.384999999999998 27.85 23.71 145-149 20.669999999999998 28.499999999999996 27.315 23.515 150-151 21.2625 27.975 26.825 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 2.0 25 4.5 26 7.0 27 10.0 28 12.0 29 18.0 30 25.5 31 33.5 32 54.0 33 69.0 34 75.5 35 91.0 36 115.5 37 120.5 38 138.0 39 179.0 40 195.0 41 220.5 42 255.5 43 268.0 44 260.5 45 256.5 46 261.5 47 253.0 48 223.0 49 181.0 50 145.0 51 114.5 52 96.0 53 81.0 54 62.0 55 45.0 56 35.0 57 31.0 58 19.5 59 11.5 60 7.0 61 2.5 62 3.5 63 3.5 64 2.0 65 1.0 66 1.5 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.2375 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.575 0.0 0.0 0.0 0.0 138-139 4.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2365 34.0 33.0 34.0 33.0 34.0 2 33.325 34.0 33.0 34.0 33.0 34.0 3 33.359 34.0 33.0 34.0 33.0 34.0 4 33.3605 34.0 33.0 34.0 33.0 34.0 5 33.3715 34.0 33.0 34.0 33.0 34.0 6 37.45925 38.0 38.0 38.0 38.0 38.0 7 37.5695 38.0 38.0 38.0 38.0 38.0 8 37.5265 38.0 38.0 38.0 38.0 38.0 9 37.5075 38.0 38.0 38.0 38.0 38.0 10-14 37.471799999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.50115 38.0 38.0 38.0 38.0 38.0 20-24 37.490899999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.4424 38.0 38.0 38.0 37.8 38.0 30-34 37.4471 38.0 38.0 38.0 37.8 38.0 35-39 37.41995 38.0 38.0 38.0 37.0 38.0 40-44 37.41244999999999 38.0 38.0 38.0 37.2 38.0 45-49 37.33725 38.0 38.0 38.0 37.0 38.0 50-54 37.31395 38.0 38.0 38.0 37.0 38.0 55-59 37.25805 38.0 38.0 38.0 37.0 38.0 60-64 37.21175 38.0 38.0 38.0 37.0 38.0 65-69 37.12415 38.0 38.0 38.0 36.0 38.0 70-74 37.066250000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.98885 38.0 38.0 38.0 36.0 38.0 80-84 36.92235000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.8403 38.0 38.0 38.0 35.6 38.0 90-94 36.730399999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.5741 38.0 38.0 38.0 34.4 38.0 100-104 36.55844999999999 38.0 38.0 38.0 34.2 38.0 105-109 36.3278 38.0 37.8 38.0 34.0 38.0 110-114 36.19935 38.0 37.6 38.0 33.8 38.0 115-119 36.04774999999999 38.0 37.0 38.0 33.4 38.0 120-124 35.75905 38.0 36.8 38.0 31.6 38.0 125-129 35.503550000000004 38.0 36.2 38.0 30.6 38.0 130-134 35.2039 38.0 36.0 38.0 29.4 38.0 135-139 34.9532 38.0 35.0 38.0 28.0 38.0 140-144 34.6047 38.0 34.8 38.0 27.4 38.0 145-149 33.814350000000005 38.0 34.2 38.0 23.4 38.0 150-151 29.51025 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 3.0 19 3.0 20 2.0 21 2.0 22 10.0 23 9.0 24 8.0 25 13.0 26 12.0 27 22.0 28 18.0 29 31.0 30 37.0 31 56.0 32 44.0 33 78.0 34 131.0 35 255.0 36 701.0 37 2554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.85 13.075000000000001 17.775 35.3 2 23.075000000000003 22.775000000000002 37.35 16.8 3 22.45 26.1 29.549999999999997 21.9 4 25.374999999999996 33.6 20.674999999999997 20.349999999999998 5 23.599999999999998 36.725 21.775 17.9 6 18.275 37.775 24.05 19.900000000000002 7 17.474999999999998 15.4 45.75 21.375 8 20.225 21.625 28.625 29.525000000000002 9 23.425 22.6 28.1 25.874999999999996 10-14 23.585 28.470000000000002 25.835 22.11 15-19 23.315 27.650000000000002 27.725 21.310000000000002 20-24 23.005 28.48 27.76 20.755000000000003 25-29 22.955000000000002 28.64 27.384999999999998 21.02 30-34 23.135 27.905 27.875 21.085 35-39 22.775000000000002 27.939999999999998 28.09 21.195 40-44 23.330000000000002 27.855 27.694999999999997 21.12 45-49 23.51 28.355000000000004 27.63 20.505000000000003 50-54 22.62 28.544999999999998 27.650000000000002 21.185000000000002 55-59 23.400000000000002 27.839999999999996 27.605 21.154999999999998 60-64 23.225 27.655 28.535 20.585 65-69 23.865 28.04 27.395000000000003 20.7 70-74 23.41 27.675 28.08 20.835 75-79 22.905 28.215 28.310000000000002 20.57 80-84 23.5 27.894999999999996 28.09 20.515 85-89 23.64 27.834999999999997 28.599999999999998 19.925 90-94 23.419999999999998 27.785 28.12 20.674999999999997 95-99 24.154999999999998 27.744999999999997 28.110000000000003 19.99 100-104 23.990000000000002 27.700000000000003 27.79 20.52 105-109 23.875 27.834999999999997 28.15 20.14 110-114 23.615 28.110000000000003 28.249999999999996 20.025000000000002 115-119 23.61 28.08 28.24 20.07 120-124 24.154999999999998 26.825 28.625 20.395 125-129 23.7 27.779999999999998 28.244999999999997 20.275000000000002 130-134 24.04 27.834999999999997 27.860000000000003 20.265 135-139 24.529999999999998 27.185 28.38 19.905 140-144 24.505 28.49 27.345000000000002 19.66 145-149 24.645 27.67 27.79 19.895 150-151 25.1875 27.4125 27.787499999999998 19.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 2.5 26 3.5 27 4.5 28 4.0 29 3.0 30 10.5 31 14.5 32 21.0 33 30.5 34 44.5 35 60.5 36 74.5 37 90.5 38 118.5 39 162.5 40 199.5 41 229.5 42 258.5 43 282.0 44 290.5 45 287.5 46 293.5 47 281.0 48 256.0 49 207.5 50 158.5 51 141.5 52 118.5 53 93.0 54 76.5 55 56.5 56 29.5 57 24.0 58 19.5 59 9.0 60 6.5 61 7.5 62 5.0 63 4.0 64 4.0 65 2.5 66 2.5 67 2.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.2125 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529151 spots for SRR7172149.sra Written 529151 spots for SRR7172149.sra Read 529156 spots for SRR7172149.sra Written 529156 spots for SRR7172149.sra SRR ids: ['SRR7172149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dvzxye6v SRR7172149.sra spots: 10583025 blocks: [[1, 529151], [529152, 1058302], [1058303, 1587453], [1587454, 2116604], [2116605, 2645755], [2645756, 3174906], [3174907, 3704057], [3704058, 4233208], [4233209, 4762359], [4762360, 5291510], [5291511, 5820661], [5820662, 6349812], [6349813, 6878963], [6878964, 7408114], [7408115, 7937265], [7937266, 8466416], [8466417, 8995567], [8995568, 9524718], [9524719, 10053869], [10053870, 10583025]] SRR7172149 file size 3564539 SRR7172149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172149 SRR7172149_1.fastq SRR7172149_2.fastq Input file: SRR7172149_1.fastq Paired file: SRR7172149_2.fastq trimmed: SRR7172149-trimmed-pair1.fastq, SRR7172149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:35:51 2025 >> started Fri Feb 14 17:36:05 2025 >> done (13.106s) 10583025 read pairs processed; of these: 3969 ( 0.04%) short read pairs filtered out after trimming by size control 2795 ( 0.03%) empty read pairs filtered out after trimming by size control 10576261 (99.94%) read pairs available; of these: 6084475 (57.53%) trimmed read pairs available after processing 4491786 (42.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 8 0.00% 25 5 0.00% 26 2 0.00% 27 1 0.00% 28 1 0.00% 29 3 0.00% 30 7 0.00% 31 5 0.00% 32 4 0.00% 33 5 0.00% 34 3 0.00% 35 4 0.00% 36 1 0.00% 37 5 0.00% 38 5 0.00% 39 6 0.00% 40 3 0.00% 41 7 0.00% 42 9 0.00% 43 11 0.00% 44 10 0.00% 45 9 0.00% 46 5 0.00% 47 13 0.00% 48 14 0.00% 49 13 0.00% 50 13 0.00% 51 19 0.00% 52 18 0.00% 53 15 0.00% 54 18 0.00% 55 16 0.00% 56 30 0.00% 57 38 0.00% 58 44 0.00% 59 46 0.00% 60 50 0.00% 61 64 0.00% 62 65 0.00% 63 74 0.00% 64 90 0.00% 65 97 0.00% 66 101 0.00% 67 121 0.00% 68 141 0.00% 69 154 0.00% 70 172 0.00% 71 232 0.00% 72 224 0.00% 73 269 0.00% 74 328 0.00% 75 379 0.00% 76 419 0.00% 77 511 0.00% 78 523 0.00% 79 649 0.01% 80 650 0.01% 81 790 0.01% 82 883 0.01% 83 1107 0.01% 84 1360 0.01% 85 1557 0.01% 86 1737 0.02% 87 1966 0.02% 88 2245 0.02% 89 2345 0.02% 90 2502 0.02% 91 2785 0.03% 92 3005 0.03% 93 3239 0.03% 94 3722 0.04% 95 3943 0.04% 96 4258 0.04% 97 4575 0.04% 98 4953 0.05% 99 5360 0.05% 100 5721 0.05% 101 6149 0.06% 102 6661 0.06% 103 7170 0.07% 104 7490 0.07% 105 8249 0.08% 106 8749 0.08% 107 9386 0.09% 108 9873 0.09% 109 10464 0.10% 110 11230 0.11% 111 11718 0.11% 112 12599 0.12% 113 12970 0.12% 114 14122 0.13% 115 14694 0.14% 116 15647 0.15% 117 15978 0.15% 118 16689 0.16% 119 17631 0.17% 120 18612 0.18% 121 19716 0.19% 122 20618 0.19% 123 21655 0.20% 124 22956 0.22% 125 24167 0.23% 126 25382 0.24% 127 27011 0.26% 128 28369 0.27% 129 30132 0.28% 130 31694 0.30% 131 33887 0.32% 132 36200 0.34% 133 39270 0.37% 134 41514 0.39% 135 44214 0.42% 136 47485 0.45% 137 51539 0.49% 138 55971 0.53% 139 61334 0.58% 140 67540 0.64% 141 76200 0.72% 142 87597 0.83% 143 102015 0.96% 144 123207 1.16% 145 153138 1.45% 146 202821 1.92% 147 290623 2.75% 148 462758 4.38% 149 864986 8.18% 150 2690606 25.44% 151 4491786 42.47% 10576261 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=336.96 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=35.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.27 fanout-score-rank=16 prefix-density=0.38 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=34.19 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.1 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172149 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:37:14 Started mapping on | Feb 14 17:37:15 Finished on | Feb 14 17:38:53 Mapping speed, Million of reads per hour | 388.52 Number of input reads | 10576261 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9856197 Uniquely mapped reads % | 93.19% Average mapped length | 294.21 Number of splices: Total | 9854800 Number of splices: Annotated (sjdb) | 9688020 Number of splices: GT/AG | 9696789 Number of splices: GC/AG | 122893 Number of splices: AT/AC | 7181 Number of splices: Non-canonical | 27937 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324219 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 24926 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 400730 400730 400730 N_multimapping 324219 324219 324219 N_noFeature 241437 9762089 278722 N_ambiguous 108156 474 51103 UnstrandedReadsAssigned:9506604 PositiveStrandReadsAssigned:93634 NegativeStrandReadsAssigned:9526372 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172149-trimmed-pair1.fastq SRR7172149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,576,261 reads, 9,454,364 reads pseudoaligned [quant] estimated average fragment length: 243.098 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7172149.ke.tsv 34699 SRR7172149.se.tsv 87100 total ==> SRR7172149.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.9 665 35.1706 Potri.005G024800.1.v4.1 1035 792.902 259 30.6802 Potri.004G059700.1.v4.1 961 718.927 29 3.7887 Potri.007G009000.2.v4.1 1416 1173.9 0 0 Potri.003G141000.2.v4.1 2943 2700.9 226 7.85917 Potri.016G087400.1.v4.1 270 77.0416 838 1021.64 Potri.015G069301.1.v4.1 564 325.351 0 0 Potri.010G195200.1.v4.1 1773 1530.9 171.786 10.5394 Potri.012G127500.1.v4.1 977 734.922 3449 440.788 ==> SRR7172149.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 98 SRR7172149 completed mapping pipeline successfully